CN110499335A

CN110499335A - CRISPR/SauriCas9 gene editing system and its application

Info

Publication number: CN110499335A
Application number: CN201910731803.7A
Authority: CN
Inventors: 王永明; 胡子英; 王大奇; 王帅
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2019-08-08
Filing date: 2019-08-08
Publication date: 2019-11-26
Anticipated expiration: 2039-08-08
Also published as: CN110499335B

Abstract

The invention belongs to gene editing technical field, specially a kind of CRISPR/SauriCas9 gene editing system and its application.Gene editing system of the present invention isSauriThe complex that Cas9 albumen and sgRNA are formed, can accurately target DNA sequence dna, and generate cutting, make DNA that double-strand break damage occur；The gene editing is to carry out gene editing in cell or in vitro；SauriCas9 albumen is small, is 1061 amino acid, the PAM sequence of identification is simple, describedSauriCas9 albumen has amino acid sequence shown in SEQ ID NO:1, and the sgRNA has nucleotide sequence shown in SEQ ID NO:2.The present invention is with a wide range of applications in gene editing field.

Description

CRISPR/SauriCas9 gene editing system and its application

Technical field

The invention belongs to gene editing technical fields, and in particular to a kind of that gene editing can be carried out in cell CRISPR/SauriCas9 system and its related application.

Background technique

CRISPR/Cas9 is bacterium and archeobacteria is that the one kind resisting exogenous virus or plasmid invasion and evolving acquired is exempted from Epidemic disease system.In CRISPR/Cas9 system, crRNA (CRISPR-derived RNA), tracrRNA (trans- Activating RNA) and Cas9 albumen formed complex after, identify PAM (the Protospacer Adjacent of target site Motif) sequence, crRNA can form complementary structure with target DNA sequence, and Cas9 albumen exercises the function of cutting DNA, sends out DNA Raw fracture damage.Wherein, tracrRNA and crRNA can be merged by catenation sequence as singlestranded guide RNA (single Guide RNA, sgRNA).After fracture damage occurs for DNA, two kinds of intracellular main DNA damage repair mechanisms are responsible for repairing It is multiple: non-homologous end joining (Non-homologous end-joining, NHEJ) and homologous recombination (homologous recombination,HR).The result that NHEJ is repaired can cause the missing or insertion of base, can carry out gene knockout；It is mentioning In the case where for homologous templates, the accurate replacement that can carry out the fixed point insertion and base of gene is repaired using HR.

Other than basic scientific research, CRISPR/Cas9 also has extensive potential applicability in clinical practice.Utilize CRISPR/Cas9 system When system does gene therapy, Cas9 and sgRNA is needed to imported into vivo.Doing the most effective delivery vector of gene therapy at present is AAV virus.But the DNA of AAV virus packaging is usually no more than 4.5kb.SpCas9 because PAM sequence simple (identification NGG) and Activity is high and is used widely.But SpCas9 albumen has 1367 amino acid, in addition sgRNA and promoter, it can not be effective Be packaged into AAV virus in, limit its application in clinic.In order to overcome this problem, several small Cas9 are invented Out, including SaCas9 (PAM sequence be NNGRRT)；St1Cas9 (PAM sequence is NNAGAW)；(PAM sequence is NmCas9 NNNNGATT)；Nme2Cas9 (PAM sequence is NNNNCC)；CjCas9 (PAM sequence be NNNNRYAC), but these Cas9 or Person PAM sequence complicated (DNA sequence dna that can be targeted in genome is few) or editorial efficiency are low, it is difficult to be widely applied.It finds Cas9 albumen is small, and the simple CRISPR/Cas9 system of PAM sequence is the hope place to solve the above problems.

Summary of the invention

In view of the above-mentioned problems, it is an object of that present invention to provide a kind of editor's activity height, Cas9 albumen is small, PAM sequence is simple The new gene editing system and its application of CRISPR/Cas9.

CRISPR/Cas9 gene editing system provided by the invention is formed for SauriCas9 albumen with sgRNA compound Body is denoted as CRISPR/SauriCas9 gene editing system (i.e. SauriCas9 albumen, it and single guide RNA (sgRNA) collective effect realizes gene editing)；DNA sequence dna can be accurately targeted, and generates cutting, makes DNA that double-strand break occur Damage；The gene editing is to carry out gene editing in cell or in vitro；SauriCas9 albumen is small, is 1061 amino acid, The PAM sequence of identification is simple (NNGG), and the SauriCas9 albumen has amino acid sequence shown in SEQ ID NO:1, or Amino acid sequence identical with amino acid sequence at least 80% shown in SEQ ID NO:1；The sgRNA has SEQ ID NO: Nucleotide sequence shown in 2, or the sgRNA sequence based on SEQ ID NO:2 transformation.

In the present invention, the cell includes eukaryocyte and prokaryotic cell；The eukaryotic cells include mammal Cell and plant cell.

In the present invention, the mammalian cell includes Chinese hamster ovary cell, baby hamster kidney cell, mouse Sertoli cell, mammary gland of mouse oncocyte, buffalo rat hepatocytes, rat liver tumor cell, the monkey kidney CVI converted by SV40 System, MK cells, canine kidney cells, human cervical carcinoma cell, human pneumonocyte, human liver cell, HIH/3T3 cell, people's U2-OS osteosarcoma Cell, people A549 cell, people K562 cell, people HEK293 cell, people HEK293T cell, people HCT116 cell or people MCF-7 Cell or TRI cell.

In the present invention, the CRISPR/Cas9 system is Staphylococcus auricularisSaCas9 (SauriCas9) albumen, it and single guide RNA (sgRNA) collective effect realize gene editing.

In the present invention, the SauriCas9 albumen belongs to Er Shi staphylococcus (Staphylococcus Auricularis), the searching number of the UniProt of the SauriCas9 albumen is A0A2T4M4R5.

In the present invention, the SauriCas9 albumen includes no cleavage activity or only with single-stranded cleavage activity or has double The SauriCas9 albumen of strand cleavage activity.

In the present invention, the DNA sequence dna that is accurately positioned includes 5 ' the end 20bp or 21bp sequences and targeting DNA in sgRNA Sequence can form base pair complementarity structure.

In the present invention, the accurate positioning targeting DNA sequence dna includes SauriCas9 albumen and sgRNA complex identification target PAM sequence in DNA sequence.

In the present invention, the PAM sequence is NNGG or NNNGG, the targeting DNA sequence dna are as follows:

NNNNNNNNNNNNNNNNNNNNNNNGG(SEQ ID NO:3)。

In the present invention, the SauriCas9 albumen and the compound physical efficiency of sgRNA accurately target DNA sequence dna and refer to SauriCas9 egg White and sgRNA complex can identify and combine specific dna sequence, or refer to other albumen with SauriCas9 protein fusion Or the protein band of specific recognition sgRNA extremely targets the position of DNA.

In the present invention, the SauriCas9 albumen and sgRNA complex or other eggs with SauriCas9 protein fusion White or specific recognition sgRNA albumen can be modified and be regulated and controled to targeting region of DNA domain, the modification and regulation include but It is not limited to the regulation, DNA methylation regulation, DNA acetylation modification, Mechanisms of Histone Acetylation Modification, single alkali of gene transcription level Base converter or chromatin imaging tracking.

In the present invention, the single base converter includes but is not limited to that bases adenine is arrived to guanine or cytimidine Thymidine or cytimidine are to the conversion between uracil or other bases.

Gene editing system editor activity provided by the invention is high, has apparent advantage compared with Cas9 before.

The present invention passes through gene chemical synthesis, molecular cloning, cell transfecting, PCR product deep sequencing, bioinformatic analysis etc. The editorial efficiency of technology detection CRISPR/SauriCas9 system.

CRISPR/SauriCas9 gene editing system provided by the invention can carry out gene editing in cell, including Positioning targeting DNA is identified by the compound of SauriCas9 albumen and sgRNA, and DNA is edited；Finally detection editor effect Rate.

Specific steps are as follows:

(1) the SauriCas9 gene order of humanization is synthesized；And be cloned on expression vector, obtain pAAV2_ SauriCas9_ITR；

(2) the corresponding oligonucleotides single stranded DNA of synthesis sgRNA, i.e. Oligo-F and Oligo-R sequence, are connected to after annealing The BsaI restriction enzyme site of plasmid pAAV2_SauriCas9_U6_BsaI, obtains pAAV2_SauriCas9-hU6-sgRNA；

It (3) will be in vehicle delivery to the cell containing target site that SauriCas9 albumen, sgRNA be expressed；

(4) edited target site is subjected to PCR amplification, T7EI digestion or two generations sequencing detection editorial efficiency.

In the present invention, the sgRNA of any targeting, and one can be designed for DNA sequence dna to be edited according to specific needs Determine to carry out modification known in the art to sgRNA in degree, the modification include but is not limited to phosphorylation, shortening, lengthening, Vulcanization, methylation, hydroxylating.

In the present invention, the CRISPR/SauriCas9 system that can according to specific needs, be delivered to cell includes but unlimited Due to expression SauriCas9 albumen or sgRNA plasmid, retrovirus, adenovirus, gland relevant viral vector or RNA or SauriCas9 albumen.

It will be appreciated by persons skilled in the art that base N indicates any one of tetra- kinds of bases of A, T, C or G.

Further, in step (3), the means of the delivering include but is not limited to liposome, cationic polymer, receive Rice grain, Multi-function envelope formula nanometer and viral vectors.

Further, in step (3), the cell includes but is not limited to people's cell, zooblast, plant cell, thin Bacterium cell, fungal cell.

Further, in step (2), the sgRNA has nucleotide sequence shown in SEQ ID NO:2, or and SEQ The identical nucleotide sequence of nucleotide sequence shown in ID NO:2 at least 80%, or the modification carried out based on nucleotide sequence, are repaired Decorations include but is not limited to phosphorylation, shortening, lengthening, vulcanization or methylation.

More specifically, in a specific embodiment, the corresponding oligonucleotides single-stranded DNA sequence of synthesis sgRNA, i.e., Oligo-F and Oligo-R, the oligonucleotides single-stranded DNA sequence are as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG, (SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)。

More specifically, in a specific embodiment, it will be appreciated by persons skilled in the art that Oligo-F and Oligo-R, which carries out annealing, becomes double-stranded DNA, and annealing reaction system is 1 μ L, 100 μM of oligo-F, 1 100 μM of μ L Oligo-R, 28 μ L water are placed in PCR instrument after concussion mixes and run cycle of annealing；Cycle of annealing is as follows: 95 DEG C _ 5min, 85 DEG C _ 1min, 75 DEG C _ 1min, 65 DEG C _ 1min, 55 DEG C _ 1min, 45 DEG C _ 1min, 35 DEG C _ 1min, 25 DEG C _ 1min, 4 DEG C of guarantors It deposits, 0.3 DEG C/s of rate of temperature fall.

More specifically, in a specific embodiment, the plasmid pAAV2_SauriCas9_ITR needs to limit by BsaI Property restriction endonuclease (NEB) processed carries out linearization process.

Product and linearisation more specifically, in a specific embodiment, after the Oligo-F and Oligo-R annealing Treated pAAV2_SauriCas9_ITR skeleton carrier is attached reaction by DNA ligase.

More specifically, in a specific embodiment, connection product is converted to competent cell, it is sequenced through Sanger Verifying is correctly cloned, and it is spare then to extract plasmid.

More specifically, in a specific embodiment, the cell in step (3) is HEK293T, it includes target site tool There is nucleotide sequence shown in SEQ ID NO:7.

More specifically, in a specific embodiment, the delivery means in step (3) are liposome, including2000 or PEI.

More specifically, in a specific embodiment of first aspect present invention, the mould of PCR in the experimental procedure (4) Plate is edited HEK293T genomic DNA.

More specifically, in a specific embodiment, the primer sequence of PCR amplification in step (4) are as follows:

F1-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGCGAGAAAAGCCTTGTTT(SEQ ID NO: 7)

R1-ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGAACTTGTGGCCGTTTAC

(SEQ ID NO:8)

F2-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC(SEQ ID NO:9)

R2-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTG(SEQ ID NO: 10)。

The present invention also provides a kind of CRISPR/SauriCas9 system kit for gene editing, which includes SauriCas9 albumen targets the sgRNA of the DNA sequence dna or DNA of targeting.

The present invention also provides CRISPR/SauriCas9 gene editing systematic differences, including gene knockout, fixed point base Change, fixed point insertion, the regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, acetylation of histone repair Decorations, single base converter or chromatin imaging tracking.

Detailed description of the invention

Fig. 1 is CRISPR/SauriCas9 gene editing system cutting targeting DNA schematic diagram.Wherein, gray ellipse table Show that SauriCas9 albumen, black bending indicate sgRNA sequence, darkened regions indicate PAM sequence NNGG in genome cochain.

Fig. 2 is plasmid pAAV2_SauriCas9_U6_BsaI map schematic diagram.Wherein, including AAV2 ITR, CMV enhance Son, CMV promoter, SV40 NLS, SauriCas9, nucleoplasmin NLS, 3x HA, bGH poly (A), people U6 starting The elements such as sub (hU6), BsaI restriction enzyme site, sgRNA scaffold sequence.

Fig. 3 is the edited part two generations sequencing result of target site DNA sequence dna.Wherein edited result has missing, insertion Or mispairing, last 4bp indicate PAM sequence NNGG.

Fig. 4 is the T7 Endonuclease I digestion result of endogenous loci.Wherein, arrow indicates the clip size cut.

Specific embodiment

The present invention will be further illustrated by embodiment below, but embodiment does not do any type of limit to the present invention It is fixed.

Unless stated otherwise, the present invention uses reagent, method and apparatus for the art conventional reagent, method and are set It is standby.Unless stated otherwise, following embodiment agents useful for same and material are commercially available.Test method without specific conditions is led to Often according to normal conditions or condition proposed by manufacturer implement.

In a specific embodiment, CRISPR/SauriCas9 system provided by the invention is a kind of new gene editing System, method, kit and its application.

In a specific embodiment of the invention, CRISPR/SauriCas9 system can carry out gene editing in cell, Described method includes following steps:

1, plasmid pAAV2_SaCas9-R5_ITR is constructed

Step (1) downloads its amino acid sequence according to searching number A0A2T4M4R5 of the SauriCas9 gene on UniProt Column, as shown in SEQ ID NO:1.

The amino acid sequence of SauriCas9 is carried out codon optimization, obtains SauriCas9 in people's cell by step (2) In highly expressed coded sequence, as shown in SEQ ID NO:11.

The coded sequence for obtaining gene SauriCas9 is carried out gene chemical synthesis in company, and constructed extremely by step (3) On pAAV2_ITR skeleton plasmid, plasmid pAAV2_SauriCas9_ITR is obtained, as shown in Figure 2.

2, linearization plasmid pAAV2_SauriCas9_ITR is prepared

Plasmid pAAV2_SauriCas9_ITR is carried out linearization for enzyme restriction, enzyme with BasI restriction enzyme by step (1) Cut system: 1 μ g plasmid pAAV2_SauriCas9_ITR, 5 μ L 10xCutSmart buffers, 1 μ LBasI restriction endonuclease, water are supplied To 50 μ l, 37 DEG C are reacted 1 hour.

Step (2), by the product after digestion on 1% Ago-Gel electrophoresis, 120V electrophoresis 30 minutes.

The step of step (3) cuts off the DNA fragmentation of 7447bp size, provided with plastic recovery kit according to producer carries out Recycling, is finally eluted with ultrapure water.

The linearization plasmid pAAV2_SauriCas9_ITR of recycling NanoDrop is measured DNA concentration by step (4), standby With or be placed in -20 DEG C and carry out long-term preservation.

3, plasmid pAAV2_SaCas9-hU6-sgRNA is constructed

Step (1) designs sgRNA sequence.

Step (2), design sgRNA sequence to positive-sense strand and antisense strand on respectively add linearization plasmid pAAV2_

The corresponding cohesive end sequence in the two sides SauriCas9_ITR, and two oligonucleotides single stranded DNAs are synthesized in company, Particular sequence are as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG, (SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)

Step (3), oligonucleotides single stranded DNA, which carries out annealing, becomes double-stranded DNA, annealing reaction system: 1 μ L, 100 μ Moligo-F, 1 100 μM of μ L oligo-R, 28 μ L water are placed in PCR instrument after concussion mixes and run cycle of annealing: 95 DEG C _ 5min, 85 DEG C _ 1min, 75 DEG C _ 1min, 65 DEG C _ 1min, 55 DEG C _ 1min, 45 DEG C _ 1min, 35 DEG C _ 1min, 25 DEG C _ 1min, 4 DEG C of preservations, 0.3 DEG C/s of rate of temperature fall.

Step (4), by after annealing product and linearization plasmid pAAV2_SauriCas9_ITR DNA ligase work It is attached with lower the step of being provided according to product.

Step (5) takes 1 μ L connection product to carry out Competent conversion, and the bacterial clone of growth is carried out Sanger survey Sequence verifying.

Sequence verification is connected correctly clone and shakes bacterium, extracts plasmid pAAV2_SauriCas9-hU6- by step (6) SgRNA is spare.

4, the plasmid pAAV2_SauriCas9-hU6-sgRNA of transfection expression SauriCas9 albumen and sgRNA

Step (1), the 0th day, according to needed for transfection, by the HEK293T cell line containing sgRNA target site in 6 orifice plates Bed board is carried out, cell density about 30% or so, target site sequence is as shown in SEQ ID NO:6.

Step (2) the 1st day, is transfected, and rotaring redyeing system is as follows,

I. 2 μ g plasmid pAAV2_SaCas9-hU6-sgRNA to be transfected is taken to be added into 100 μ lOpti-MEM culture mediums, gently Mixing is played in featheriness；

Ii. will2000 flick mixing, draw 5 μ l and are added into 100 μ lOpti-MEM culture mediums, It mixes gently, is stored at room temperature 5min；

It iii. will be diluted2000 and diluted plasmid mixed, gently piping and druming mix, room temperature 20min is stood, is then added into the culture medium of cell to be transfected.

Cell is placed in 37 DEG C, continues to cultivate in 5% CO2 incubator by step (3).

5, two generation sequencing libraries are prepared

The step of step (1) is collected HEK293T cell of the editor after 3 days, provided with DNA kit according to product is extracted Genomic DNA.

Step (2) carries out PCR and builds library first round PCR, carries out PCR reaction, PCR primer such as SEQ with 2xQ5 Mastermix Shown in ID NO:7-SEQ ID NO:8, reaction system is as follows:

It is as follows that PCR runs program:

Step (3) carries out PCR and builds the wheel PCR of library second, carries out PCR reaction with 2xQ5 Mastermix, PCR primer is such as Shown in SEQ ID NO:9--SEQ ID NO:10, reaction system is as follows:

It is as follows that PCR runs program:

Step (4), the step of the PCR product of the second wheel is provided with plastic recovery kit according to producer, purifying 366bp is big Small DNA fragmentation, the preparation of two generation sequencing libraries finish.

6, two generation sequencing results are analyzed

The two generation sequencing libraries prepared are transferred to company to carry out both-end sequencing on HiseqXTen by step (1).

Step (2) bioinformatic analysis two generations sequencing result, part edited result are as shown in Figures 2 and 3.

7, endogenous loci is verified

Step (1) passes through the plasmid pAAV2_SaCas9-hU6-sgRNA for expressing SauriCas9 and sgRNA2000 transfect the step of offer according to producer into HEK293T cell, wherein

SgRNA sequence are as follows: AGATGCGGGTGATGATGCTCT, (SEQ ID NO:12)

The particular sequence of target site are as follows: AGATGCGGGTGATGATGCTCTTTGG；(SEQ ID NO:13)

Step (2) extracts cell genomic dna of the editor after 5 days, by 2x Q5 Master mix, with primer Test- F and Test-R is expanded DNA sequence dna is targeted；Wherein:

The particular sequence of Test-F are as follows: CAGGGAGTCGACGAGTTGAA, (SEQ ID NO:14)

The particular sequence of Test-R are as follows: TAATTGCTGGCCTATCCACGC；(SEQ ID NO:15)

PCR product is recycled by Ago-Gel, purifies the DNA fragmentation of 570bp size by step (3)；

Step (4) carries out digestion to the DNA fragmentation of purifying according to the specification of T7 Endonuclease I, then runs glue Detection cuts targeting sequence without sgRNA, T7 Endonuclease I when transfection as a result as shown in figure 4, left side is negative control group Afterwards without the segment of incision, illustrate not edit；Right side is experimental group, and when transfection has sgRNA, T7 Endonuclease I to cut There is the segment cut after targeting sequence, illustrates to be edited.

SEQUENCE LISTING

<110>Fudan University

<120>CRISPR/SauriCas9 gene editing system and its application

<130> 1119

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 1061

<212> PRT

<213>artificial sequence

<400> 1

Met Gln Glu Asn Gln Gln Lys Gln Asn Tyr Ile Leu Gly Leu Asp Ile

1 5 10 15

Gly Ile Thr Ser Val Gly Tyr Gly Leu Ile Asp Ser Lys Thr Arg Glu

20 25 30

Val Ile Asp Ala Gly Val Arg Leu Phe Pro Glu Ala Asp Ser Glu Asn

35 40 45

Asn Ser Asn Arg Arg Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg

50 55 60

Arg Ile His Arg Leu Asn Arg Val Lys Asp Leu Leu Ala Asp Tyr Gln

65 70 75 80

Met Ile Asp Leu Asn Asn Val Pro Lys Ser Thr Asp Pro Tyr Thr Ile

85 90 95

Arg Val Lys Gly Leu Arg Glu Pro Leu Thr Lys Glu Glu Phe Ala Ile

100 105 110

Ala Leu Leu His Ile Ala Lys Arg Arg Gly Leu His Asn Ile Ser Val

115 120 125

Ser Met Gly Asp Glu Glu Gln Asp Asn Glu Leu Ser Thr Lys Gln Gln

130 135 140

Leu Gln Lys Asn Ala Gln Gln Leu Gln Asp Lys Tyr Val Cys Glu Leu

145 150 155 160

Gln Leu Glu Arg Leu Thr Asn Ile Asn Lys Val Arg Gly Glu Lys Asn

165 170 175

Arg Phe Lys Thr Glu Asp Phe Val Lys Glu Val Lys Gln Leu Cys Glu

180 185 190

Thr Gln Arg Gln Tyr His Asn Ile Asp Asp Gln Phe Ile Gln Gln Tyr

195 200 205

Ile Asp Leu Val Ser Thr Arg Arg Glu Tyr Phe Glu Gly Pro Gly Asn

210 215 220

Gly Ser Pro Tyr Gly Trp Asp Gly Asp Leu Leu Lys Trp Tyr Glu Lys

225 230 235 240

Leu Met Gly Arg Cys Thr Tyr Phe Pro Glu Glu Leu Arg Ser Val Lys

245 250 255

Tyr Ala Tyr Ser Ala Asp Leu Phe Asn Ala Leu Asn Asp Leu Asn Asn

260 265 270

Leu Val Val Thr Arg Asp Asp Asn Pro Lys Leu Glu Tyr Tyr Glu Lys

275 280 285

Tyr His Ile Ile Glu Asn Val Phe Lys Gln Lys Lys Asn Pro Thr Leu

290 295 300

Lys Gln Ile Ala Lys Glu Ile Gly Val Gln Asp Tyr Asp Ile Arg Gly

305 310 315 320

Tyr Arg Ile Thr Lys Ser Gly Lys Pro Gln Phe Thr Ser Phe Lys Leu

325 330 335

Tyr His Asp Leu Lys Asn Ile Phe Glu Gln Ala Lys Tyr Leu Glu Asp

340 345 350

Val Glu Met Leu Asp Glu Ile Ala Lys Ile Leu Thr Ile Tyr Gln Asp

355 360 365

Glu Ile Ser Ile Lys Lys Ala Leu Asp Gln Leu Pro Glu Leu Leu Thr

370 375 380

Glu Ser Glu Lys Ser Gln Ile Ala Gln Leu Thr Gly Tyr Thr Gly Thr

385 390 395 400

His Arg Leu Ser Leu Lys Cys Ile His Ile Val Ile Asp Glu Leu Trp

405 410 415

Glu Ser Pro Glu Asn Gln Met Glu Ile Phe Thr Arg Leu Asn Leu Lys

420 425 430

Pro Lys Lys Val Glu Met Ser Glu Ile Asp Ser Ile Pro Thr Thr Leu

435 440 445

Val Asp Glu Phe Ile Leu Ser Pro Val Val Lys Arg Ala Phe Ile Gln

450 455 460

Ser Ile Lys Val Ile Asn Ala Val Ile Asn Arg Phe Gly Leu Pro Glu

465 470 475 480

Asp Ile Ile Ile Glu Leu Ala Arg Glu Lys Asn Ser Lys Asp Arg Arg

485 490 495

Lys Phe Ile Asn Lys Leu Gln Lys Gln Asn Glu Ala Thr Arg Lys Lys

500 505 510

Ile Glu Gln Leu Leu Ala Lys Tyr Gly Asn Thr Asn Ala Lys Tyr Met

515 520 525

Ile Glu Lys Ile Lys Leu His Asp Met Gln Glu Gly Lys Cys Leu Tyr

530 535 540

Ser Leu Glu Ala Ile Pro Leu Glu Asp Leu Leu Ser Asn Pro Thr His

545 550 555 560

Tyr Glu Val Asp His Ile Ile Pro Arg Ser Val Ser Phe Asp Asn Ser

565 570 575

Leu Asn Asn Lys Val Leu Val Lys Gln Ser Glu Asn Ser Lys Lys Gly

580 585 590

Asn Arg Thr Pro Tyr Gln Tyr Leu Ser Ser Asn Glu Ser Lys Ile Ser

595 600 605

Tyr Asn Gln Phe Lys Gln His Ile Leu Asn Leu Ser Lys Ala Lys Asp

610 615 620

Arg Ile Ser Lys Lys Lys Arg Asp Met Leu Leu Glu Glu Arg Asp Ile

625 630 635 640

Asn Lys Phe Glu Val Gln Lys Glu Phe Ile Asn Arg Asn Leu Val Asp

645 650 655

Thr Arg Tyr Ala Thr Arg Glu Leu Ser Asn Leu Leu Lys Thr Tyr Phe

660 665 670

Ser Thr His Asp Tyr Ala Val Lys Val Lys Thr Ile Asn Gly Gly Phe

675 680 685

Thr Asn His Leu Arg Lys Val Trp Asp Phe Lys Lys His Arg Asn His

690 695 700

Gly Tyr Lys His His Ala Glu Asp Ala Leu Val Ile Ala Asn Ala Asp

705 710 715 720

Phe Leu Phe Lys Thr His Lys Ala Leu Arg Arg Thr Asp Lys Ile Leu

725 730 735

Glu Gln Pro Gly Leu Glu Val Asn Asp Thr Thr Val Lys Val Asp Thr

740 745 750

Glu Glu Lys Tyr Gln Glu Leu Phe Glu Thr Pro Lys Gln Val Lys Asn

755 760 765

Ile Lys Gln Phe Arg Asp Phe Lys Tyr Ser His Arg Val Asp Lys Lys

770 775 780

Pro Asn Arg Gln Leu Ile Asn Asp Thr Leu Tyr Ser Thr Arg Glu Ile

785 790 795 800

Asp Gly Glu Thr Tyr Val Val Gln Thr Leu Lys Asp Leu Tyr Ala Lys

805 810 815

Asp Asn Glu Lys Val Lys Lys Leu Phe Thr Glu Arg Pro Gln Lys Ile

820 825 830

Leu Met Tyr Gln His Asp Pro Lys Thr Phe Glu Lys Leu Met Thr Ile

835 840 845

Leu Asn Gln Tyr Ala Glu Ala Lys Asn Pro Leu Ala Ala Tyr Tyr Glu

850 855 860

Asp Lys Gly Glu Tyr Val Thr Lys Tyr Ala Lys Lys Gly Asn Gly Pro

865 870 875 880

Ala Ile His Lys Ile Lys Tyr Ile Asp Lys Lys Leu Gly Ser Tyr Leu

885 890 895

Asp Val Ser Asn Lys Tyr Pro Glu Thr Gln Asn Lys Leu Val Lys Leu

900 905 910

Ser Leu Lys Ser Phe Arg Phe Asp Ile Tyr Lys Cys Glu Gln Gly Tyr

915 920 925

Lys Met Val Ser Ile Gly Tyr Leu Asp Val Leu Lys Lys Asp Asn Tyr

930 935 940

Tyr Tyr Ile Pro Lys Asp Lys Tyr Glu Ala Glu Lys Gln Lys Lys Lys

945 950 955 960

Ile Lys Glu Ser Asp Leu Phe Val Gly Ser Phe Tyr Tyr Asn Asp Leu

965 970 975

Ile Met Tyr Glu Asp Glu Leu Phe Arg Val Ile Gly Val Asn Ser Asp

980 985 990

Ile Asn Asn Leu Val Glu Leu Asn Met Val Asp Ile Thr Tyr Lys Asp

995 1000 1005

Phe Cys Glu Val Asn Asn Val Thr Gly Glu Lys Arg Ile Lys Lys

1010 1015 1020

Thr Ile Gly Lys Arg Val Val Leu Ile Glu Lys Tyr Thr Thr Asp

1025 1030 1035

Ile Leu Gly Asn Leu Tyr Lys Thr Pro Leu Pro Lys Lys Pro Gln

1040 1045 1050

Leu Ile Phe Lys Arg Gly Glu Leu

1055 1060

<210> 2

<211> 101

<212> RNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (1)..(20)

<223> n is a, c, g, or u

<400> 2

nnnnnnnnnn nnnnnnnnnn guuuuaguac ucuggaaaca gaaucuacua aaacaaggca 60

aaaugccgug uuuaucucgu caacuuguug gcgagauuuu u 101

<210> 3

<211> 25

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (1)..(23)

<223> n is a, c, g, or t

<400> 3

nnnnnnnnnn nnnnnnnnnn nnngg 25

<210> 4

<211> 24

<212> DNA

<213>artificial sequence

<400> 4

caccgctcgg agatcatcat tgcg 24

<210> 5

<211> 24

<212> DNA

<213>artificial sequence

<400> 5

aaaccgcaat gatgatctcc gagc 24

<210> 6

<211> 25

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (21)..(25)

<223> n is a, c, g, or t

<400> 6

gctcggagat catcattgcg nnnnn 25

<210> 7

<211> 55

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (34)..(37)

<223> n is a, c, g, or t

<400> 7

acactctttc cctacacgac gctcttccga tctnnnngcg agaaaagcct tgttt 55

<210> 8

<211> 51

<212> DNA

<213>artificial sequence

<400> 8

actggagttc agacgtgtgc tcttccgatc tctgaacttg tggccgttta c 51

<210> 9

<211> 45

<212> DNA

<213>artificial sequence

<400> 9

aatgatacgg cgaccaccga gatctacact ctttccctac acgac 45

<210> 10

<211> 52

<212> DNA

<213>artificial sequence

<400> 10

caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tg 52

<210> 11

<211> 3183

<212> DNA

<213>artificial sequence

<400> 11

atgcaggaga accagcagaa gcagaactac atcctgggcc tggacatcgg aatcaccagc 60

gtcggctacg gactgatcga tagcaagaca agagaagtga tcgacgccgg cgttagactc 120

tttccagaag ctgatagcga gaacaactcc aaccgcagaa gcaagcgggg cgccagacgg 180

ttaaaacgga gaagaatcca ccggctgaac cgggtcaaag acctgctcgc tgattaccag 240

atgatcgatc ttaacaatgt tcctaagagc accgacccct acaccatcag agtgaagggc 300

ctccgggagc ctctgacaaa agaagaattc gccatcgccc tcctgcatat cgctaagaga 360

agaggcctgc acaacatcag tgtgtccatg ggcgacgaag agcaggacaa tgaactgagc 420

accaagcagc agctgcaaaa gaatgcccag caactgcagg acaagtatgt gtgcgaactg 480

cagttagaac ggctgaccaa catcaacaag gtcagaggcg agaagaacag atttaagaca 540

gaggactttg tgaaagaagt gaaacagctg tgcgaaaccc agagacagta ccacaacatc 600

gacgaccaat tcatccagca gtacatcgac ctggtgtcta caagacggga gtacttcgag 660

ggccccggca acggctctcc atacggctgg gacggcgacc tgctgaagtg gtacgagaag 720

ctgatgggca gatgcaccta tttccccgaa gaactgaggt ccgtgaagta cgcctacagc 780

gccgacctct tcaacgccct gaacgacctg aacaacctcg ttgtgaccag ggatgacaat 840

ccaaagcttg agtactacga gaagtaccac attattgaga acgtgttcaa gcaaaagaag 900

aatcccacac tcaaacaaat cgccaaagag atcggcgtgc aagattacga catccggggc 960

tatagaatca caaagagcgg caaacctcag ttcacctctt ttaagctgta tcacgacctg 1020

aagaacatct tcgagcaggc caaatacctg gaagatgtgg aaatgctgga cgagatcgcc 1080

aagatcctga ccatctacca ggatgagatt agcatcaaga aagccctgga ccagctgccc 1140

gaactgctga cagagagcga gaaatctcag atcgcacagc tcaccggcta tacaggcacc 1200

cacagactga gcctgaagtg catccacatt gtgatcgacg agctgtggga gagccccgag 1260

aaccagatgg aaatctttac cagactgaat ctgaaaccta agaaggtgga aatgagcgag 1320

atcgacagca tacccaccac cctggtcgac gagttcatcc tctcacctgt ggtgaagcgg 1380

gccttcatcc agagcatcaa ggtaatcaac gcagtgatca atcggttcgg cctgccagag 1440

gacatcatca tcgagctggc cagagaaaag aatagcaagg atcggagaaa gttcattaac 1500

aagctgcaga aacaaaatga ggccacaaga aagaaaatcg aacagctgct ggccaagtac 1560

ggcaacacca atgccaagta catgatcgag aagatcaagc tgcacgacat gcaggagggc 1620

aagtgcctgt acagcctgga ggctattcct ctggaagacc tgctgagcaa cccgacacac 1680

tacgaagttg accacattat ccccagatct gtgagctttg acaacagcct gaacaacaaa 1740

gtgctggtga aacaaagcga aaacagcaag aagggcaatc gcacccctta ccagtacctg 1800

agcagcaacg agtctaagat tagctacaac cagtttaagc agcacatcct gaacctgagc 1860

aaggccaagg acagaatcag caagaaaaaa agagatatgc tgctggaaga gagagatatc 1920

aacaagttcg aagtgcagaa ggaattcatt aaccggaacc tggtggatac acggtacgcc 1980

accagagaac tgtctaacct gctgaagacc tacttcagca cccatgacta cgccgtgaag 2040

gtgaagacca tcaacggcgg cttcactaac cacctgagga aggtgtggga tttcaagaag 2100

cacagaaacc acggctacaa gcaccacgcc gaagatgccc tggtgatcgc caacgccgac 2160

ttcctgttta agacacataa ggccctgcgg agaaccgata agatcctgga acaacctggc 2220

ctggaagtga atgatacaac cgtgaaagtg gacaccgagg aaaaatacca ggagctgttc 2280

gagacaccta agcaagtgaa gaacatcaag cagttccggg acttcaagta cagccaccga 2340

gtggacaaga agcctaaccg gcagcttatc aacgacacac tgtactccac cagagagatt 2400

gatggcgaaa cctacgtggt gcagaccctt aaggatctgt acgccaagga caacgagaaa 2460

gtgaagaagc tgttcaccga aagacctcag aagatcctga tgtaccagca cgaccctaag 2520

accttcgaga aactgatgac aatcctgaac cagtacgctg aggccaagaa ccctctggct 2580

gcttattacg aggacaaagg cgagtacgtg accaagtacg ccaagaaagg caatggacct 2640

gccatccaca agatcaagta tatcgataag aagcttggat cttacctgga tgttagcaac 2700

aagtatcctg agacacagaa caagcttgtg aagctgtccc tgaagagctt tagattcgac 2760

atctacaagt gtgaacaggg ctacaagatg gtgtccatcg gatacctgga cgtgctgaag 2820

aaagataact actactacat ccctaaggac aagtacgagg ccgagaagca gaaaaagaag 2880

atcaaggaat ctgatctttt tgtgggcagc ttctactaca acgacctcat catgtacgag 2940

gatgaactgt tcagagtgat aggagtgaac agcgacatca acaatctggt tgagctaaac 3000

atggtcgaca ttacctacaa ggacttctgc gaggtgaaca acgtgacagg cgagaaaaga 3060

atcaaaaaga ctatcggcaa gcgcgtggtc ctgatcgaga agtacaccac agatattcta 3120

ggcaacctgt acaagactcc cctgcctaag aagccccagc ttatcttcaa gcggggagaa 3180

ctg 3183

<210> 12

<211> 21

<212> DNA

<213>artificial sequence

<400> 12

agatgcgggt gatgatgctc t 21

<210> 13

<211> 25

<212> DNA

<213>artificial sequence

<400> 13

agatgcgggt gatgatgctc tttgg 25

<210> 14

<211> 20

<212> DNA

<213>artificial sequence

<400> 14

cagggagtcg acgagttgaa 20

<210> 15

<211> 21

<212> DNA

<213>artificial sequence

<400> 15

taattgctgg cctatccacg c 21

Claims

1. a kind of CRISPR/Cas9 gene editing system, gene editing is to carry out gene editing in cell or in vitro, special Sign is that the CRISPR/Cas9 system isSauriCas9 albumen and sgRNA complex can be accurately positioned targeting DNA sequence dna, And cutting is generated, make DNA that double-strand break damage occur；It is describedSauriCas9 albumen has amino acid shown in SEQ ID NO:1 Sequence, or amino acid sequence identical with amino acid sequence at least 80% shown in SEQ ID NO:1；The sgRNA has SEQ Nucleotide sequence shown in ID NO:2, or the sgRNA sequence based on SEQ ID NO:2 transformation.

2. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that the cell includes eukaryon Cell and prokaryotic cell；The eukaryotic cells include mammalian cell and plant cell；The mammalian cell packet Include Chinese hamster ovary cell, baby hamster kidney cell, mouse Sertoli cell, mammary gland of mouse oncocyte, buffalo rats'liver Cell, rat liver tumor cell, the monkey kidney CVI system by SV40 conversion, MK cells, canine kidney cells, human cervical carcinoma cell, people's lung Cell, human liver cell, HIH/3T3 cell, people U2-OS osteosarcoma cell, people A549 cell, people K562 cell, people HEK293 cell, people HEK293T cell, people HCT116 cell or people MCF-7 cell or TRI cell.

3. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that describedSauriCas9 albumen Including no cleavage activity or only with single-stranded cleavage activity or with double-strand cleavage activitySauriCas9 albumen.

4. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that the accurate positioning DNA sequence Column include that 5 ' end 20bp or 21bp sequences in sgRNA can form base pair complementarity structure with targeting DNA sequence dna.

5. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that the accurate positioning targeting DNA sequence dna includesSauriPAM sequence on Cas9 albumen and sgRNA complex identification targeting DNA sequence dna.

6. CRISPR/Cas9 gene editing system according to claim 5, which is characterized in that the PAM sequence is NNGG, the targeting DNA sequence dna are shown in SEQ ID NO3.

7. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that the sgRNA can be carried out Phosphorylation, shortening, lengthening, vulcanization, methylation or hydroxylating modification.

8. CRISPR/Cas9 gene editing system according to claim 1, which is characterized in that describedSauriCas9 albumen DNA sequence dna is accurately targeted with the compound physical efficiency of sgRNA to refer toSauriCas9 albumen and sgRNA complex can be identified and be combined specific DNA sequence dna, or refer to by withSauriThe protein band of other albumen of Cas9 protein fusion or specific recognition sgRNA are to targeting DNA Position.

9. CRISPR/Cas9 gene editing system according to claim 8, which is characterized in that describedSauriCas9 albumen With sgRNA complex or withSauriOther albumen of Cas9 protein fusion or the albumen of specific recognition sgRNA can be to targetings Region of DNA domain is modified and is regulated and controled, and the modification and regulation include the regulation of gene transcription level, DNA methylation regulation, DNA Acetylation modification, Mechanisms of Histone Acetylation Modification, single base converter or chromatin imaging tracking.

10. CRISPR/Cas9 gene editing system according to claim 9, which is characterized in that the single base converter Including the conversion between bases adenine to guanine, cytimidine to thymidine, cytimidine to uracil or other bases.

11. the CRISPR/ as described in one of claim 1-10SauriCas9 gene editing system carries out gene volume in cell The method collected, including pass throughSauriThe compound of Cas9 albumen and sgRNA identification positioning targeting DNA, edit DNA；Most After detect editorial efficiency；Specific steps are as follows:

(1) humanization is synthesizedSauriCas9 gene order；And be cloned on expression vector, obtain pAAV2_ SauriCas9_ ITR；

(2) the corresponding oligonucleotides single stranded DNA of synthesis sgRNA, i.e. Oligo-F and Oligo-R sequence, are connected to plasmid after annealing pAAV2_SauriThe BsaI restriction enzyme site of Cas9_U6_BsaI, obtains pAAV2_ SauriCas9-hU6-sgRNA；

It (3) will expressionSauriCas9 albumen, sgRNA vehicle delivery in the cell containing target site；

12. according to the method for claim 11, which is characterized in that the pAAV2_ SauriCas9-hU6-sgRNA is Adeno-associated virus skeleton plasmid comprising AAV2 ITR, cmv enhancer, CMV promoter, SV40 NLS, SauriCas9, Nucleoplasmin NLS, 3x HA, bGH poly (A), people U6 promoter, BsaI restriction enzyme site, sgRNA scaffold Sequence.

13. according to the method for claim 11, which is characterized in that be delivered to the CRISPR/ of cellSauriCas9 system packet Include expressionSauriThe plasmid of Cas9 albumen or sgRNA, retrovirus, adenovirus, gland relevant viral vector or RNA orSauriCas9 albumen.

14. according to the method for claim 11, which is characterized in that the corresponding oligonucleotides single stranded DNA sequence of synthesis sgRNA Column, i.e. Oligo-F and Oligo-R sequence are shown in SEQ ID NO4 and SEQ ID NO5.

15. according to the method for claim 11, which is characterized in that the target site of the cell in step (3) has SEQ ID Nucleotide sequence shown in NO:6.

16. according to the method for claim 11, which is characterized in that the template of PCR is edited DNA in step (4)； The primer sequence of PCR amplification are as follows: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10.

17. the CRISPR/ as described in one of claim 1-10SauriThe kit of Cas9 gene editing system, the kit packet It includesSauriCas9 albumen or the sgRNA or targeting DNA for targeting DNA sequence dna.

18. the CRISPR/ as described in one of claim 1-10SauriCas9 gene editing systematic difference, including gene knockout, Pinpoint change, fixed point insertion, the regulation of gene transcription level, the DNA methylation regulation, DNA acetylation modification, histone of base Acetylation modification, single base converter or chromatin imaging tracking.