CN109295098A - For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene - Google Patents
For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene Download PDFInfo
- Publication number
- CN109295098A CN109295098A CN201811203666.1A CN201811203666A CN109295098A CN 109295098 A CN109295098 A CN 109295098A CN 201811203666 A CN201811203666 A CN 201811203666A CN 109295098 A CN109295098 A CN 109295098A
- Authority
- CN
- China
- Prior art keywords
- sequence
- adeno
- associated virus
- recombinant vector
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of adeno-associated virus recombinant vector for knocking out Egr3 gene and its construction method and purposes, carrier includes at least: the sequential element of following operability connection: 5 ' end reverse phase repetitive sequences, CMV promoter, sacas9 coded sequence, polyA signal sequence, U6 promoter sequence, gRNA sequence, 3 ' end reverse phase repetitive sequences.Adeno-associated virus recombinant vector carrier can efficiently knock out Egr3.By inventor the study found that Egr3 gene knockout carrier can effectively inhibit the growth of transplanted human and Tumor Angiongesis of HepG2 cell liver cancer model.Illustrate that technical solution of the present invention can be adapted for the treatment of liver cancer diseases.
Description
Technical field
The adeno-associated virus recombinant vector and its construction method and purposes that the present invention relates to a kind of for knocking out Egr3 gene,
Belong to field of biotechnology.
Background technique
Egr3 belongs to Egr (the getting up early growth response factor) family member, belongs to can reacting for transcription factor family member
The factor is primarily involved in growth, proliferation, differentiation and the apoptotic process for reconciling cell
Adeno-associated virus (adeno-associated virus, AAV), is Parvoviridae dependovirus, virus
Grain size is about 20~26nm, and complete life cycle needs helper virus (usually adeno-associated virus or herpesviral) to join
With.It encodes cap the and rep gene in the inverted repeats (ITR) of two ends.Wherein cap gene encoding virus coat
Albumen, rep gene participate in the duplication and integration of virus.There are many serotype, affinity of the different serotypes to different tissues by AAV
Difference is suitable for various In vivo infections and tests.The long advantage of timeliness is had a safety feature and expressed due to AAV, is had become at present
Most promising gene therapy tool.
AAV packaging system is divided into 3 plasmids, including the shuttle plasmid that foreign gene can be inserted, and coding rep and
The pAAV-RC of cap protein coding gene, and substitute the pHelper plasmid for the adeno-associated virus that adeno-associated virus is relied on.3
After kind plasmid co-transfection vehicles cells AAV-293, the AAV virion for carrying external source insertion gene can be formed.
CRISPR/Cas9(Clustered Regularly Interspaced Short Palindromic
It Repeats) is a kind of technology edited to target gene of Cas9 nuclease by RNA guidance occurred in the recent period.At this
In system, crRNA (CRISPR-derived RNA) passes through base pairing and tracrRNA (trans-activating RNA)
In conjunction with double-stranded RNA is formed, this tracrRNA/crRNA binary complex instructs Cas9 albumen to target site in crRNA boot sequence
Cut off double-stranded DNA.In genome editing process, tracrRNA and crRNA can be merged as 1 RNA (sgRNA) expression together
Sample can play the role of targeting shearing.
1971, Judah doctor Folkman be put forward for the first time " tumour growth depend on angiogenesis (tumor
Angiogenesis viewpoint) ": once tumour occurs, any amount of tumour cell increases, all will be with new capillary
Formation.New vessels provide nutrition supply by perfusion form for growth of tumour cell, while it is also tumour cell metabolism
The effective way of product excretion；And in the case where no vascularization, the nutrition supply and metabolite excretion of tumour are only capable of leaning on
Simple physical dispersion.Here it is seriously limit the growth of tumour cell.
The growth and transfer of tumour have close relationship with tumor vessel.Solid tumor is probably in 1~2mm size without new
Angiogenic, the nutrition for supplying its growth depend on the dispersion of surrounding tissue, and growing pullets are slowly or in " suspend mode " state.When
New vessels formation is necessary when tumour further increases, and cancer cell constantly absorbs nourishment substance and oxygen from supply blood vessel,
Metabolite is transported, the needs of growth of tumour cell are met.The nutrition supply of tumour is become being perfused from disperse at this time, and the stage is swollen
Tumor rapid growth simultaneously has transfer ability.Inhibit a kind of tumor vascular important means for being formed and can be used as oncotherapy at present.
Those skilled in the art, which have been devoted to exploitation, can effectively treat the gene technology of tumour.Problem in the prior art
It is the absence of the gene means and method of effectively treatment liver cancer.
Summary of the invention
In view of the foregoing deficiencies of prior art, the purpose of the present invention is to provide a kind of Egr3 gene knockout carrier and
Its construction method and purposes.
In order to achieve the above objects and other related objects, the present invention provides a kind of for knocking out the gland related diseases of Egr3 gene
Malicious recombinant vector, the gland relevant viral vector include at least the sequential element of following operability connection:
5 ' end reverse phase repetitive sequences, CMV promoter, sacas9 sequence, polyA signal sequence, U6 promoter sequence,
GRNA sequence, 3 ' end reverse phase repetitive sequences.
Adeno-associated virus is a kind of single-stranded no coating DNA virus.It is entered into the cell by receptor mediated endocytosis,
Then adeno-associated virus genome is transferred in nucleus, is maintained at outside chromosome, and unconformity enters in host cell gene group.
Accession number of the EGR3 gene in NCBI is 1960.
The present invention obtains one kind using natural adeno-associated virus after genetic modification and turns recombinant expression carrier.
Described " being operatively connected " or " operability connection " refers to two or more nucleic acid regions or nucleic acid sequence
Functional spatial arrangement.For example, promoter region is placed in the specific position relative to target gene nucleic acid sequence, so that nucleic acid
Guidance of the transcription of sequence by the promoter, thus, promoter region can be by " operability connection " to nucleic acid sequence.
" element " refers to the useful some column functional core acid sequences of some expression for albumen, the present invention
In, " element " is systematically constructed to form a kind of expression construct.Described " element " sequence is can the present invention
Middle offer, also include their variant, as long as remaining the function of " element " on these elements, by insertion or
Some bases, or random or rite-directed mutagenesis etc. are deleted to obtain.
The upstream of above-mentioned each element and downstream position, may also include the restriction enzyme site of restriction enzyme, these sites
Be conducive to the organic linking of each element.
Further, the recombinant vector sequence is as shown in SEQ ID NO.1.It is specific as follows:
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCG
GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTAGACTCG
AGGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGA
GTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAA
TGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC
CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTG
GCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCA
TGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCC
ATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATT
GACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTACCGGTGCCACCA
TGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAGCGGAACTACATCCTGGGCCTGGAC
ATCGGCATCACCAGCGTGGGCTACGGCATCATCGACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTT
CAAAGAGGCCAACGTGGAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGAGGCGGC
ATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGCGAGCTGAGCGGCATCAAC
CCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGCGAGGAAGAGTTCTCTGCCGCCCTGCTGCACCTGGC
CAAGAGAAGAGGCGTGCACAACGTGAACGAGGTGGAAGAGGACACCGGCAACGAGCTGTCCACCAAAGAGCAGATCA
GCCGGAACAGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGACGGCGAAGTG
CGGGGCAGCATCAACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAACAGCTGCTGAAGGTGCAGAAGGCCTA
CCACCAGCTGGACCAGAGCTTCATCGACACCTACATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTG
GCGAGGGCAGCCCCTTCGGCTGGAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCC
GAGGAACTGCGGAGCGTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGACCTGAACAATCTCGTGAT
CACCAGGGACGAGAACGAGAAGCTGGAATATTACGAGAAGTTCCAGATCATCGAGAACGTGTTCAAGCAGAAGAAGA
AGCCCACCCTGAAGCAGATCGCCAAAGAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCACC
GGCAAGCCCGAGTTCACCAACCTGAAGGTGTACCACGACATCAAGGACATTACCGCCCGGAAAGAGATTATTGAGAA
CGCCGAGCTGCTGGATCAGATTGCCAAGATCCTGACCATCTACCAGAGCAGCGAGGACATCCAGGAAGAACTGACCA
ATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAGCAGATCTCTAATCTGAAGGGCTATACCGGCACCCACAACCTG
AGCCTGAAGGCCATCAACCTGATCCTGGACGAGCTGTGGCACACCAACGACAACCAGATCGCTATCTTCAACCGGCT
GAAGCTGGTGCCCAAGAAGGTGGACCTGTCCCAGCAGAAAGAGATCCCCACCACCCTGGTGGACGACTTCATCCTGA
GCCCCGTCGTGAAGAGAAGCTTCATCCAGAGCATCAAAGTGATCAACGCCATCATCAAGAAGTACGGCCTGCCCAAC
GACATCATTATCGAGCTGGCCCGCGAGAAGAACTCCAAGGACGCCCAGAAAATGATCAACGAGATGCAGAAGCGGAA
CCGGCAGACCAACGAGCGGATCGAGGAAATCATCCGGACCACCGGCAAAGAGAACGCCAAGTACCTGATCGAGAAGA
TCAAGCTGCACGACATGCAGGAAGGCAAGTGCCTGTACAGCCTGGAAGCCATCCCTCTGGAAGATCTGCTGAACAAC
CCCTTCAACTATGAGGTGGACCACATCATCCCCAGAAGCGTGTCCTTCGACAACAGCTTCAACAACAAGGTGCTCGT
GAAGCAGGAAGAAAACAGCAAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAGCGACAGCAAGATCAGCT
ACGAAACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGCAGAATCAGCAAGACCAAGAAAGAGTATCTG
CTGGAAGAACGGGACATCAACAGGTTCTCCGTGCAGAAAGACTTCATCAACCGGAACCTGGTGGATACCAGATACGC
CACCAGAGGCCTGATGAACCTGCTGCGGAGCTACTTCAGAGTGAACAACCTGGACGTGAAAGTGAAGTCCATCAATG
GCGGCTTCACCAGCTTTCTGCGGCGGAAGTGGAAGTTTAAGAAAGAGCGGAACAAGGGGTACAAGCACCACGCCGAG
GACGCCCTGATCATTGCCAACGCCGATTTCATCTTCAAAGAGTGGAAGAAACTGGACAAGGCCAAAAAAGTGATGGA
AAACCAGATGTTCGAGGAAAAGCAGGCCGAGAGCATGCCCGAGATCGAAACCGAGCAGGAGTACAAAGAGATCTTCA
TCACCCCCCACCAGATCAAGCACATTAAGGACTTCAAGGACTACAAGTACAGCCACCGGGTGGACAAGAAGCCTAAT
AGAGAGCTGATTAACGACACCCTGTACTCCACCCGGAAGGACGACAAGGGCAACACCCTGATCGTGAACAATCTGAA
CGGCCTGTACGACAAGGACAATGACAAGCTGAAAAAGCTGATCAACAAGAGCCCCGAAAAGCTGCTGATGTACCACC
ACGACCCCCAGACCTACCAGAAACTGAAGCTGATTATGGAACAGTACGGCGACGAGAAGAATCCCCTGTACAAGTAC
TACGAGGAAACCGGGAACTACCTGACCAAGTACTCCAAAAAGGACAACGGCCCCGTGATCAAGAAGATTAAGTATTA
CGGCAACAAACTGAACGCCCATCTGGACATCACCGACGACTACCCCAACAGCAGAAACAAGGTCGTGAAGCTGTCCC
TGAAGCCCTACAGATTCGACGTGTACCTGGACAATGGCGTGTACAAGTTCGTGACCGTGAAGAATCTGGATGTGATC
AAAAAAGAAAACTACTACGAAGTGAATAGCAAGTGCTATGAGGAAGCTAAGAAGCTGAAGAAGATCAGCAACCAGGC
CGAGTTTATCGCCTCCTTCTACAACAACGATCTGATCAAGATCAACGGCGAGCTGTATAGAGTGATCGGCGTGAACA
ACGACCTGCTGAACCGGATCGAAGTGAACATGATCGACATCACCTACCGCGAGTACCTGGAAAACATGAACGACAAG
AGGCCCCCCAGGATCATTAAGACAATCGCCTCCAAGACCCAGAGCATTAAGAAGTACAGCACAGACATTCTGGGCAA
CCTGTATGAAGTGAAATCTAAGAAGCACCCTCAGATCATCAAAAAGGGCAAAAGGCCGGCGGCCACGAAAAAGGCCG
GCCAGGCAAAAAAGAAAAAGGGATCCTACCCATACGATGTTCCAGATTACGCTTACCCATACGATGTTCCAGATTAC
GCTTACCCATACGATGTTCCAGATTACGCTTAAGAATTCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGT
TGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTA
ATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCA
AGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGGTACCGAGGGCCTATTTCCCATGATTCCTTCATATT
TGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAAT
ACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCT
TACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTCATGAGCGCCG
GCATCTTGGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTT
GGCGAGATTTTTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTG
AGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGC
CTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCA
TAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAG
CGCCTTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAA
ATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGT
TCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACT
CTTGTTCCAAACTGGAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGG
TCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTA
TGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGC
GCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGA
GGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATG
ATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTA
AATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTA
TGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAA
ACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGG
TAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGG
TATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTAC
TCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGA
TAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGG
ATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAAT
AGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATA
AATCTGGAGCCGGTGAGCGTGGAAGCCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTA
GTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGAT
TAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAA
GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAA
ACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCA
GAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCT
ACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTC
AAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAA
CGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGAC
AGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA
TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGA
AAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT
Further, 5 ' the end reverse phase repetitive sequence such as SEQ ID NO.1: in shown in the 1st~141；
Further, the CMV promoter sequence such as SEQ ID NO.1: in shown in the 154th~737；
Further, the CMV promoter sequence such as SEQ ID NO.1: in shown in the 154th~737；
Further, the sacas9 coded sequence such as SEQ ID NO.1: in shown in the 762nd~3345；
Further, the polyA signal sequence such as SEQ ID NO.1: in shown in the 4137th~4344；
Further, the U6 promoter sequence such as SEQ ID NO.1: in shown in the 4351st~4591；
Further, the gRNA sequence such as SEQ ID NO.1: in shown in the 4600th~4620；
Further, 3 ' the end reverse phase repetitive sequence such as SEQ ID NO.1: in shown in the 4710th~4850.
Another aspect of the present invention provides above-mentioned adeno-associated virus recombinant vector and is used to prepare cancer treatment drug
Purposes.
Another aspect of the present invention provides a kind of cell, described to carry into the cell containing the recombination of above-mentioned adeno-associated virus
Body.
Another aspect of the present invention provides a kind of kit, adeno-associated virus recombinant vector and pharmaceutically acceptable
Carrier, or cell as described above and pharmaceutically acceptable salt.
Another aspect of the present invention provides the construction method of above-mentioned adeno-associated virus recombinant vector, and the method is extremely
Less the following steps are included:
(1) gRNA design and double-strand synthesis；
(2) AVV-sacas9 construction of recombinant vector.
Further, the sequence such as SEQ ID NO.2 institute of the forward primer used when gRNA is expanded in the step (1)
Show, the sequence of reverse primer is as shown in SEQ ID NO.3.
SEQ ID NO.2:CACCGTCATGAGCGCCGGCATCTTG
SEQ ID NO.3:AAACCAAGATGCCGGCGCTCATGAC
As described above, the adeno-associated virus recombinant vector for being used to knock out Egr3 gene of the invention, has below beneficial to effect
Fruit:
Using adeno-associated virus recombinant vector packaged by technical solution of the present invention, it can effectively inhibit liver cancer model
Growth and angiogenesis, difference have statistical significance, illustrate that technical solution of the present invention can treat liver especially suitable for production
The adeno-associated virus of cancer.
Detailed description of the invention
Fig. 1 carrier structure schematic diagram used in embodiment 1.
Fig. 2 is shown as in embodiment 2 measurement experiment group gross tumor volume table in different time points.
Fig. 3 is shown as in embodiment 2 measuring MVD result figure to different experiments group.
Specific embodiment
Illustrate embodiments of the present invention below by way of specific specific example, those skilled in the art can be by this specification
Other advantages and efficacy of the present invention can be easily understood for disclosed content.The present invention can also pass through in addition different specific realities
The mode of applying is embodied or practiced, the various details in this specification can also based on different viewpoints and application, without departing from
Various modifications or alterations are carried out under spirit of the invention.
1 experiment pertinent instruments of table
Embodiment 1
1, pHBAAV-CMV-Sacas9-U6-gRNA carrier (structure such as Fig. 1) BsaI digestion, digestion system are as follows:
2, glue recycling after the completion of carrier digestion (recycling step is shown in annex)
3, the preparation of Egr3-gRNA segment PCR
Upstream and downstream primer annealing, wherein the sequence of middle forward primer is as shown in SEQ IDNO.2, the sequence of reverse primer is such as
Shown in SEQ ID NO.3.
Table 2
Component will be mixed above with PCR instrument or water-bath, in 95 DEG C of warm bath 4min, be then taken out and be placed on room temperature cooling.
3, the target fragment and carrier coupled reaction system (20 μ l) handled well:
Table 3
The above reaction system is placed in 22 DEG C in warm bath 20min, and reaction such as cannot carry out subsequent operation at once after completing can
Response sample is kept in and is stored in 20 DEG C of ﹣；
5, (competent cell: stbl3) is converted.
Resistance: Amp, 37 DEG C, overnight incubation
6, the EGR3 plate after converting chooses bacterium, and 37 DEG C 250 revs/min are shaken bacterium 14 hours, carries out PCR identification with bacterium solution, will
Positive colony bacterium solution send sequencing company to be sequenced.As a result Egr3 gene knockout carrier sequencing result is obtained as shown in SEQ ID NO.1.
Embodiment 2
The adeno-associated virus injection liver cancer model mouse for knocking out Egr3 inhibits mice tumors grew and angiogenesis
1, experimental material
4-6 week old nude mouse (mouse is purchased from Shanghai Slac Experimental Animal Co., Ltd.), weight 16~
20g。
2, experimental method
2.1 mouse tumor modelings
24 nude mice every subcutaneous in preceding armpit by 1*10^6 HepG2 cell inoculation.24 mouse are divided at random after 2 weeks
At 3 groups, PBS group (blank control group), AAV-GFP group and AAV-EGR3-KO group.The growing state of observation nude mice daily.2.2 note
Penetrate AAV-GFP group and AAV-EGR3-KO group, control adeno-associated virus and PBS group
Absorption 5ul liquid inserting needle at away from tumour 5mm with micro-injection needle, subcutaneously migrates to liver cancer model position, slowly
Injection.It is injected again after 2 days primary.Control adeno-associated virus is AAV-GFP (adeno-associated virus with green fluorescent protein).
Blank control group is PBS.
The monitoring and microvessel density measurement of 2.3 gross tumor volumes
Weekly with the longest diameter (x) of vernier caliper measurement tumour and shortest diameter (y) gross tumor volume calculation formula after injection: V
=xy2/2。
All nude mices are put to death after experiment carries out microvessel density measurement.Tumor tissues are put into formaldehyde and fix, paraffin
Embedding.Slice is through dimethylbenzene, ethyl alcohol dewaxing aquation, serum closing slice.CD34 primary antibody, biotinylation two are successively added by step
It is anti-.After mounting light under the microscope and take pictures.It calculates microvessel density (MVD).
3, experimental result
AAV-EGR3-KO adeno-associated virus can significantly inhibit the tumour growth and angiogenesis of liver cancer model.
As shown in Fig. 2, PBS group and AAV group are compared, different number of days transplantable tumor volume is with microvessel density without bright after inoculation
Aobvious difference, in the experimental group for applying recombinant adeno-associated virus of the invention, transplantable tumor volume is significantly less than preceding two groups, and when 42d swells
Knurl product only has the 47.8% of control group.Microvessel density is substantially reduced compared with other two groups, and when 42d, number of microvessels are pair
According to 43.7%.With statistical difference.
As shown in figure 3, comparing the liver cancer mould of PBS control mouse, AAV2-GFP control mice and AAV-EGR3-KO injection
The gross tumor volume and blood vessel index of type mouse (mouse for knocking out Egr3 gene).Experiment shows to knock out Egr3 by adeno-associated virus
The tumour growth and angiogenesis of liver cancer model can effectively be inhibited.Illustrate that technical solution of the present invention is applicable to liver cancer diseases
Treatment.
Above embodiment is can not to be interpreted as in order to illustrate embodiment disclosed by the invention to limit of the invention
System.In addition, in various modifications and invention listed herein method, composition variation, do not departing from the scope of the present invention
Be obvious for those skilled in the art under the premise of spirit.Although having combined of the invention a variety of specific
Preferred embodiment has carried out specific description to the present invention, it is to be understood that, the present invention should not be limited only to these specific embodiments.
In fact, various obviously modify as described above for those skilled in the art to obtain invention all should include
Within the scope of the invention.
Sequence table
<110>Han Heng biotechnology (Shanghai) Co., Ltd.
<120>for knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 7447
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60
ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120
aggggttcct gcggcctcta gactcgaggc gttgacattg attattgact agttattaat 180
agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac 240
ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa 300
tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt 360
atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc 420
ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat 480
gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc 540
ggttttggca gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc 600
tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa 660
aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg 720
tctatataag cagagctctc tggctaacta ccggtgccac catggcccca aagaagaagc 780
ggaaggtcgg tatccacgga gtcccagcag ccaagcggaa ctacatcctg ggcctggaca 840
tcggcatcac cagcgtgggc tacggcatca tcgactacga gacacgggac gtgatcgatg 900
ccggcgtgcg gctgttcaaa gaggccaacg tggaaaacaa cgagggcagg cggagcaaga 960
gaggcgccag aaggctgaag cggcggaggc ggcatagaat ccagagagtg aagaagctgc 1020
tgttcgacta caacctgctg accgaccaca gcgagctgag cggcatcaac ccctacgagg 1080
ccagagtgaa gggcctgagc cagaagctga gcgaggaaga gttctctgcc gccctgctgc 1140
acctggccaa gagaagaggc gtgcacaacg tgaacgaggt ggaagaggac accggcaacg 1200
agctgtccac caaagagcag atcagccgga acagcaaggc cctggaagag aaatacgtgg 1260
ccgaactgca gctggaacgg ctgaagaaag acggcgaagt gcggggcagc atcaacagat 1320
tcaagaccag cgactacgtg aaagaagcca aacagctgct gaaggtgcag aaggcctacc 1380
accagctgga ccagagcttc atcgacacct acatcgacct gctggaaacc cggcggacct 1440
actatgaggg acctggcgag ggcagcccct tcggctggaa ggacatcaaa gaatggtacg 1500
agatgctgat gggccactgc acctacttcc ccgaggaact gcggagcgtg aagtacgcct 1560
acaacgccga cctgtacaac gccctgaacg acctgaacaa tctcgtgatc accagggacg 1620
agaacgagaa gctggaatat tacgagaagt tccagatcat cgagaacgtg ttcaagcaga 1680
agaagaagcc caccctgaag cagatcgcca aagaaatcct cgtgaacgaa gaggatatta 1740
agggctacag agtgaccagc accggcaagc ccgagttcac caacctgaag gtgtaccacg 1800
acatcaagga cattaccgcc cggaaagaga ttattgagaa cgccgagctg ctggatcaga 1860
ttgccaagat cctgaccatc taccagagca gcgaggacat ccaggaagaa ctgaccaatc 1920
tgaactccga gctgacccag gaagagatcg agcagatctc taatctgaag ggctataccg 1980
gcacccacaa cctgagcctg aaggccatca acctgatcct ggacgagctg tggcacacca 2040
acgacaacca gatcgctatc ttcaaccggc tgaagctggt gcccaagaag gtggacctgt 2100
cccagcagaa agagatcccc accaccctgg tggacgactt catcctgagc cccgtcgtga 2160
agagaagctt catccagagc atcaaagtga tcaacgccat catcaagaag tacggcctgc 2220
ccaacgacat cattatcgag ctggcccgcg agaagaactc caaggacgcc cagaaaatga 2280
tcaacgagat gcagaagcgg aaccggcaga ccaacgagcg gatcgaggaa atcatccgga 2340
ccaccggcaa agagaacgcc aagtacctga tcgagaagat caagctgcac gacatgcagg 2400
aaggcaagtg cctgtacagc ctggaagcca tccctctgga agatctgctg aacaacccct 2460
tcaactatga ggtggaccac atcatcccca gaagcgtgtc cttcgacaac agcttcaaca 2520
acaaggtgct cgtgaagcag gaagaaaaca gcaagaaggg caaccggacc ccattccagt 2580
acctgagcag cagcgacagc aagatcagct acgaaacctt caagaagcac atcctgaatc 2640
tggccaaggg caagggcaga atcagcaaga ccaagaaaga gtatctgctg gaagaacggg 2700
acatcaacag gttctccgtg cagaaagact tcatcaaccg gaacctggtg gataccagat 2760
acgccaccag aggcctgatg aacctgctgc ggagctactt cagagtgaac aacctggacg 2820
tgaaagtgaa gtccatcaat ggcggcttca ccagctttct gcggcggaag tggaagttta 2880
agaaagagcg gaacaagggg tacaagcacc acgccgagga cgccctgatc attgccaacg 2940
ccgatttcat cttcaaagag tggaagaaac tggacaaggc caaaaaagtg atggaaaacc 3000
agatgttcga ggaaaagcag gccgagagca tgcccgagat cgaaaccgag caggagtaca 3060
aagagatctt catcaccccc caccagatca agcacattaa ggacttcaag gactacaagt 3120
acagccaccg ggtggacaag aagcctaata gagagctgat taacgacacc ctgtactcca 3180
cccggaagga cgacaagggc aacaccctga tcgtgaacaa tctgaacggc ctgtacgaca 3240
aggacaatga caagctgaaa aagctgatca acaagagccc cgaaaagctg ctgatgtacc 3300
accacgaccc ccagacctac cagaaactga agctgattat ggaacagtac ggcgacgaga 3360
agaatcccct gtacaagtac tacgaggaaa ccgggaacta cctgaccaag tactccaaaa 3420
aggacaacgg ccccgtgatc aagaagatta agtattacgg caacaaactg aacgcccatc 3480
tggacatcac cgacgactac cccaacagca gaaacaaggt cgtgaagctg tccctgaagc 3540
cctacagatt cgacgtgtac ctggacaatg gcgtgtacaa gttcgtgacc gtgaagaatc 3600
tggatgtgat caaaaaagaa aactactacg aagtgaatag caagtgctat gaggaagcta 3660
agaagctgaa gaagatcagc aaccaggccg agtttatcgc ctccttctac aacaacgatc 3720
tgatcaagat caacggcgag ctgtatagag tgatcggcgt gaacaacgac ctgctgaacc 3780
ggatcgaagt gaacatgatc gacatcacct accgcgagta cctggaaaac atgaacgaca 3840
agaggccccc caggatcatt aagacaatcg cctccaagac ccagagcatt aagaagtaca 3900
gcacagacat tctgggcaac ctgtatgaag tgaaatctaa gaagcaccct cagatcatca 3960
aaaagggcaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag aaaaagggat 4020
cctacccata cgatgttcca gattacgctt acccatacga tgttccagat tacgcttacc 4080
catacgatgt tccagattac gcttaagaat tcctagagct cgctgatcag cctcgactgt 4140
gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 4200
aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 4260
taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 4320
agagaatagc aggcatgctg gggaggtacc gagggcctat ttcccatgat tccttcatat 4380
ttgcatatac gatacaaggc tgttagagag ataattggaa ttaatttgac tgtaaacaca 4440
aagatattag tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt 4500
ttaaaattat gttttaaaat ggactatcat atgcttaccg taacttgaaa gtatttcgat 4560
ttcttggctt tatatatctt gtggaaagga cgaaacaccg tcatgagcgc cggcatcttg 4620
gttttagtac tctggaaaca gaatctacta aaacaaggca aaatgccgtg tttatctcgt 4680
caacttgttg gcgagatttt tgcggccgca ggaaccccta gtgatggagt tggccactcc 4740
ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg 4800
ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagc tgcctgcagg ggcgcctgat 4860
gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatacgtc aaagcaacca 4920
tagtacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg 4980
accgctacac ttgccagcgc cttagcgccc gctcctttcg ctttcttccc ttcctttctc 5040
gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga 5100
tttagtgctt tacggcacct cgaccccaaa aaacttgatt tgggtgatgg ttcacgtagt 5160
gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat 5220
agtggactct tgttccaaac tggaacaaca ctcaactcta tctcgggcta ttcttttgat 5280
ttataaggga ttttgccgat ttcggtctat tggttaaaaa atgagctgat ttaacaaaaa 5340
tttaacgcga attttaacaa aatattaacg tttacaattt tatggtgcac tctcagtaca 5400
atctgctctg atgccgcata gttaagccag ccccgacacc cgccaacacc cgctgacgcg 5460
ccctgacggg cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg 5520
agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac gcgcgagacg aaagggcctc 5580
gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt 5640
ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 5700
aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg 5760
aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc 5820
cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg 5880
ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt 5940
cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta 6000
ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat 6060
gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga 6120
gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca 6180
acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact 6240
cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc 6300
acgatgcctg tagcaatggc aacaacgttg cgcaaactat taactggcga actacttact 6360
ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt 6420
ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt 6480
ggaagccgcg gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt 6540
atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata 6600
ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag 6660
attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat 6720
ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 6780
aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 6840
aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 6900
ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgttcttct agtgtagccg 6960
tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 7020
ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 7080
cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 7140
agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 7200
gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 7260
ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 7320
tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 7380
tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 7440
cacatgt 7447
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caccgtcatg agcgccggca tcttg 25
<210> 3
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aaaccaagat gccggcgctc atgac 25
Claims (7)
1. a kind of for knocking out the adeno-associated virus recombinant vector of Egr3 gene, which is characterized in that the adeno-associated virus recombination
Carrier includes at least the sequential element of following operability connection:
5 ' end reverse phase repetitive sequences, CMV promoter, sacas9 coded sequence, polyA signal sequence, U6 promoter sequence,
GRNA sequence, 3 ' end reverse phase repetitive sequences.
2. adeno-associated virus recombinant vector according to claim 1, it is characterised in that:
The adeno-associated virus recombinant vector sequence such as SEQ ID NO.1: it is shown,
5 ' the end reverse phase repetitive sequence such as SEQ ID NO.1: in shown in the 1st~141；
The CMV promoter sequence such as SEQ ID NO.1: in shown in the 154th~737；
The sacas9 coded sequence such as SEQ ID NO.1: in shown in the 762nd~3345；
The polyA signal sequence such as SEQ ID NO.1: in shown in the 4137th~4344；
The U6 promoter sequence such as SEQ ID NO.1: in shown in the 4351st~4591；
The gRNA sequence such as SEQ ID NO.1: in shown in the 4600th~4620；
3 ' the end reverse phase repetitive sequence such as SEQ ID NO.1: in shown in the 4710th~4850.
3. the purposes that adeno-associated virus recombinant vector as claimed in claim 1 or 2 is used to prepare cancer treatment drug.
4. a kind of cell, which is characterized in that described to contain adeno-associated virus recombinant vector as claimed in claim 1 or 2 into the cell.
5. a kind of kit, which is characterized in that include adeno-associated virus as claimed in claim 1 or 2 in the kit
Recombinant vector and pharmaceutically acceptable carrier, or cell as claimed in claim 4 and pharmaceutically acceptable salt.
6. the construction method of adeno-associated virus recombinant vector as claimed in claim 1 or 2, the method includes at least following step
It is rapid:
(1) gRNA design and double-strand synthesis；
(2) AVV-sacas9 construction of recombinant vector.
7. the construction method of EGR3 gene knockout carrier as claimed in claim 2 or claim 3, which is characterized in that in the step (1)
The sequence for the forward primer that gRNA is used when expanding is as shown in SEQ ID NO.2, the sequence of reverse primer such as SEQ ID NO.3 institute
Show.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811203666.1A CN109295098A (en) | 2018-10-16 | 2018-10-16 | For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811203666.1A CN109295098A (en) | 2018-10-16 | 2018-10-16 | For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109295098A true CN109295098A (en) | 2019-02-01 |
Family
ID=65162901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811203666.1A Pending CN109295098A (en) | 2018-10-16 | 2018-10-16 | For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109295098A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499335A (en) * | 2019-08-08 | 2019-11-26 | 复旦大学 | CRISPR/SauriCas9 gene editing system and its application |
| CN110551763A (en) * | 2019-08-08 | 2019-12-10 | 复旦大学 | CRISPR/SlutCas9 gene editing system and application thereof |
| CN110551762A (en) * | 2019-08-08 | 2019-12-10 | 复旦大学 | CRISPR/ShaCas9 gene editing system and application thereof |
| CN114588264A (en) * | 2022-02-25 | 2022-06-07 | 上海大学 | Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia-reperfusion injury medicine |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150202231A1 (en) * | 2007-11-20 | 2015-07-23 | The Brigham And Women's Hospital, Inc. | Modulation of the Immune Response |
-
2018
- 2018-10-16 CN CN201811203666.1A patent/CN109295098A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150202231A1 (en) * | 2007-11-20 | 2015-07-23 | The Brigham And Women's Hospital, Inc. | Modulation of the Immune Response |
Non-Patent Citations (2)
| Title |
|---|
| ZHONG-DONG WANG: "Involvement of microRNA-718, a new regulator of EGR3,in regulation of malignant phenotype of HCC cells", 《JOURNAL OF ZHEJIANG UNIVERSITY-SCIENCE B》 * |
| 连竹生: "肝癌的基因治疗---应用CRISPR_Cas9腺病毒系统靶向CDK1基因", 《万方数据知识服务平台》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110499335A (en) * | 2019-08-08 | 2019-11-26 | 复旦大学 | CRISPR/SauriCas9 gene editing system and its application |
| CN110551763A (en) * | 2019-08-08 | 2019-12-10 | 复旦大学 | CRISPR/SlutCas9 gene editing system and application thereof |
| CN110551762A (en) * | 2019-08-08 | 2019-12-10 | 复旦大学 | CRISPR/ShaCas9 gene editing system and application thereof |
| CN110551763B (en) * | 2019-08-08 | 2023-03-10 | 复旦大学 | CRISPR/SlutCas9 gene editing system and application thereof |
| CN110551762B (en) * | 2019-08-08 | 2023-03-10 | 复旦大学 | CRISPR/ShaCas9 gene editing system and application thereof |
| CN110499335B (en) * | 2019-08-08 | 2023-03-28 | 复旦大学 | CRISPR/SauriCas9 gene editing system and application thereof |
| CN114588264A (en) * | 2022-02-25 | 2022-06-07 | 上海大学 | Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia-reperfusion injury medicine |
| CN114588264B (en) * | 2022-02-25 | 2023-05-16 | 上海大学 | Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia reperfusion injury drugs |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295098A (en) | For knocking out the adeno-associated virus recombinant vector and its construction method and purposes of Egr3 gene | |
| AU655653B2 (en) | Hepatocyte growth stimulation with hepatocyte growth factor and gamma-interferon | |
| CN107236739A (en) | The method of CRISPR/SaCas9 specific knockdown people's CXCR4 genes | |
| CN114438130B (en) | Beta-globin recombinant lentiviral vector and application thereof | |
| CN109797167B (en) | Plasmid, system, preparation and preparation method for targeted knockout of human papilloma virus URR gene | |
| CN110951663A (en) | Recombinant bacterium for expressing PD-1 antibody and construction method and application thereof | |
| CN113897395B (en) | Recombinant adenovirus vaccine for African swine fever and construction method thereof | |
| CN109402071B (en) | Recombinant turkey herpesvirus expressing H9N2 subtype avian influenza virus H9 protein | |
| CN112159809B (en) | gRNA of target CTGF gene and application thereof | |
| CN111549001B (en) | Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application | |
| CN111154003B (en) | Cas9 fusion protein for improving gene knock-in efficiency and exogenous gene knock-in integration system | |
| CN109234314B (en) | Adeno-associated virus recombinant vector for knocking out CXCL12 gene and construction method and application thereof | |
| CN104587490A (en) | Therapeutic HBV minicircle DNA vaccine and preparation method thereof | |
| CN113430198B (en) | Method for increasing SMN protein expression based on CRISPR and application thereof | |
| CN110699308A (en) | AMH-INH-GNIH three-expression gene vaccine for improving animal fertility, and preparation method and application thereof | |
| CN112538500A (en) | Base editor and preparation method and application thereof | |
| CN106929483B (en) | Construction and application of recombinant turkey herpesvirus expressing newcastle disease virus F gene | |
| CN115340998B (en) | Recombinant viral vector, recombinant virus containing recombinant viral vector, novel coronavirus vaccine and application of novel coronavirus vaccine | |
| CN111574621B (en) | Monoclonal antibody for neutralizing EB virus and application thereof | |
| CN114457119A (en) | Application of lentiviral vector in preparation of drug for treating beta-thalassemia | |
| CN113943752A (en) | Constructs, oncolytic viruses with improved sensitivity and uses thereof | |
| CN110724710A (en) | Vector for controlling pig PFKM expression and application thereof | |
| KR100981995B1 (en) | FRM-EGF fusion protein and composition for wound healing comprising the same | |
| CN115011601B (en) | shRNA (short hairpin ribonucleic acid) interfering with JUND expression, recombinant adeno-associated virus vector and application thereof | |
| CN113897392B (en) | Trivalent recombinant adenovirus vaccine for foot-and-mouth disease and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190201 |