CN110951663A

CN110951663A - Recombinant bacterium for expressing PD-1 antibody and construction method and application thereof

Info

Publication number: CN110951663A
Application number: CN201911369182.9A
Authority: CN
Inventors: 陈廷涛; 魏泓
Original assignee: Shenzhen Qianhai Jinzhuo Biotechnology Co ltd
Current assignee: Shenzhen Qianhai Jinzhuo Biotechnology Co ltd
Priority date: 2019-12-26
Filing date: 2019-12-26
Publication date: 2020-04-03

Abstract

The invention relates to a recombinant bacterium for expressing a PD-1 antibody and a construction method and application thereof. The recombinant bacterium for expressing the PD-1 antibody is obtained by transforming a recombinant expression vector for expressing the PD-1 antibody into attenuated salmonella typhimurium or escherichia coli Nissle 1917. The recombinant bacteria expressing the PD-1 antibody have good anti-tumor effect.

Description

Recombinant bacterium for expressing PD-1 antibody and construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant bacterium for expressing a PD-1 antibody and a construction method and application thereof.

Background

Programmed death receptor 1(PD-1) is an immunosuppressive molecule consisting of 288 amino acids, and is a type I transmembrane glycoprotein consisting of an intracellular region, an extracellular region, and a hydrophobic transmembrane region. The intracellular domain of PD-1 consists of two independent immunoreceptor tyrosine switch motifs and inhibitory motifs in the tail, and the extracellular domain consists of a signal sequence and an immunoglobulin variable domain at the top.

PD-1 can be expressed in various cells after induction, such as activated T cells, B cells, natural killer cells, monocytes, dendritic cells and the like. Research shows that the specific combination of PD-L1 expressed by tumor cells and PD-1 expressed by T cells can inhibit the proliferation and differentiation capacity of T cells, reduce the expression of various immune factors and promote the apoptosis of activated effector T cells, thereby mediating the immune escape of tumor cells. In this case, if a PD-1 antibody drug can be administered to specifically bind to PD-1 to block the binding of PD-L1 to PD-1 of T cells in tumor cells, a therapeutic effect on tumors can be achieved.

Although the above therapeutic pathway has proved to be effective, the current antitumor drugs containing PD-1 antibody as the main active ingredient have not been ideal in tumor treatment.

Disclosure of Invention

In view of this, it is necessary to provide a recombinant bacterium expressing a PD-1 antibody which has a good antitumor effect.

A recombinant bacterium for expressing PD-1 antibody is obtained by transforming a recombinant expression vector for expressing PD-1 antibody into attenuated Salmonella typhimurium or Escherichia coli Nissle 1917.

The recombinant bacterium for expressing the PD-1 antibody directly expresses the PD-1 antibody at a tumor by utilizing the tumor targeting property and the tumor inhibiting effect of attenuated salmonella typhimurium and escherichia coli Nissle1917, so that the PD-1 antibody has targeting property, the specific aggregation of the PD-1 antibody in tumor cells is avoided, the effective utilization rate of the PD-1 antibody is improved, and the anti-tumor effect of the PD-1 antibody is improved.

In one embodiment, the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009.

In one embodiment, the recombinant expression vector for expressing the PD-1 antibody comprises an expression fragment of interest, wherein the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No.1, or the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No.2, or the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No. 3.

A method for constructing a recombinant bacterium expressing a PD-1 antibody, comprising the steps of:

introducing a target expression fragment containing a nucleotide sequence for encoding the PD-1 antibody into an expression empty vector to obtain a recombinant expression vector; and

and transforming the recombinant expression vector into a host to obtain the recombinant bacteria for expressing the PD-1 antibody, wherein the host is attenuated salmonella typhimurium or escherichia coli Nissle 1917.

In one embodiment, the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No.1, or the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No.2, or the expression fragment of interest comprises a nucleotide sequence shown as SEQ ID No. 3.

In one embodiment, the method further comprises a step of preparing the expression fragment of interest, wherein the step of preparing the expression fragment of interest comprises:

using pUC57-hPD-1 as a template, and carrying out PCR amplification to obtain a target expression fragment containing a nucleotide sequence shown as SEQ ID No. 1; or

And using pUC57-mPD-1 as a template, and carrying out PCR amplification to obtain a target expression fragment containing the nucleotide sequence shown as SEQ ID No.2 or a target expression fragment containing the nucleotide sequence shown as SEQ ID No. 3.

In one embodiment, in the step of obtaining the expression fragment of interest having the nucleotide sequence shown in SEQ ID No.1, the primers for PCR are shown in SEQ ID No.6 and SEQ ID No. 7; in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.2, the primers of PCR are shown as SEQ ID No.8 and SEQ ID No. 9; in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.3, the primers of PCR are shown as SEQ ID No.10 and SEQ ID No. 11.

In one embodiment, the expression empty vector is an Abvec-Igk plasmid or a pET-28c plasmid.

In one embodiment, the target expression fragment contains a nucleotide sequence shown as SEQ ID No.1, or the target expression fragment contains a nucleotide sequence shown as SEQ ID No.2, the expression empty vector is an Abvec-Igk plasmid, and the host is attenuated Salmonella typhimurium.

The recombinant bacterium for expressing the PD-1 antibody or the recombinant bacterium for expressing the PD-1 antibody prepared by the construction method can be applied to the preparation of antitumor drugs.

In one embodiment, the tumor is melanoma, cervical cancer.

An anti-tumor drug, which comprises the recombinant bacterium expressing the PD-1 antibody or the recombinant bacterium expressing the PD-1 antibody prepared by the construction method of the recombinant bacterium expressing the PD-1 antibody.

Drawings

FIG. 1 is a schematic structural diagram of the recombinant plasmid Abvec-Igk-hPD-1, the recombinant plasmid Abvec-Igk-mPD-1 and the recombinant plasmid pET-28c-mPD-1 in example 1;

FIG. 2 is a graph of the change in tumor volume in cervical cancer model mice after injection of Abvec-Igk-hPD-1-VNP20009 in example 1;

FIG. 3 is a graph showing the change in tumor volume of melanoma model mice after injection of Abvec-Igk-mPD-1-VNP20009, pET-28c-mPD-1-VNP20009, and pET-28c-mPD-1-Nissle1917 in example 1.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Some embodiments of the invention are presented in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The recombinant bacterium expressing the PD-1 antibody according to one embodiment is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into attenuated Salmonella typhimurium or Escherichia coli Nissle 1917.

Although the PD-1 antibody can be used as an effective component of an antitumor drug, the PD-1 antibody cannot be specifically aggregated in a tumor in a conventional administration mode, so that the targeting property of the PD-1 antibody is poor. The recombinant bacteria expressing the PD-1 antibody directly express the PD-1 antibody at a tumor by utilizing the tumor targeting property and the tumor inhibiting effect of attenuated salmonella typhimurium and escherichia coli Nissle1917, so that the PD-1 antibody has targeting property, the specific aggregation of the PD-1 antibody on tumor cells is avoided, the effective utilization rate of the PD-1 antibody is improved, and the anti-tumor effect of the PD-1 antibody is improved.

Specifically, recombinant expression vectors expressing PD-1 antibodies include an expression fragment of interest. Expression fragments of interest include nucleotide fragments that express the PD-1 antibody. Further, the expression fragment of interest includes a nucleotide fragment expressing the PD-1 monoclonal antibody. In this embodiment, the desired expression fragment further comprises an enzyme cleavage site corresponding to the expression empty vector for preparing the recombinant expression vector.

In one embodiment, the expression fragment of interest comprises a nucleotide fragment encoding an expression of a human PD-1 monoclonal antibody. Furthermore, the target expression fragment contains a nucleotide sequence shown as SEQ ID No. 1. The nucleotide sequence shown as SEQ ID No.1 comprises enzyme cutting sites of Age I and Hind III and a nucleotide sequence for coding the human PD-1 monoclonal antibody. Specifically, the nucleotide sequence shown as SEQ ID No.1 is: 5'-ACCGGTCACCATCATCATCATCATTCTTCTGGTGAGAACCTGTACTTCCAAGGTGCTAGCGAACTGGTGGTAACTCAAGAACCGTCTCTGACCGTGTCTCCAGGTGGCACCGTCACTCTGACCTGTGGTTCTAGCACTGGTGCAGTCACCAGCGGTAACTATCCGAGCTGGCCGCAACAGAAACCAGCACAGGCTCCGCGTCCACTGATCTACACTACCACTAACAAACACTCTTGGACCCCAGCTCAGTTCTCTGGCTCTCTGCTCGGTGGCAAAGCTGTACTGACTCTGTCTGGTGTTCAGCCAGAAGACGAAGCTGACTATTACTGCCGTCTGTTCTATGGTGGTCCGTGGGTCTTTGGTGGCGGTACTCAGCTGACCGACCTGGGTGGTGGCTCTTCTCGTAGCTCCGAAGTTCAGCTGCTGGAATCTGGTCGTGGCCTGGTACAGCCAGGTGGCTCTCTGCGTCTGTCTTGTGCAGCTTCTGGCTTCACCTTCAGCAGCTATGCTACCAACTGGGTACGTCAGGCTCCAGGTAAAGGTCTGGAGTGGGTCTCTCTGATCTCTGGTAGCGGTGGTTCTACCTTCTACGCAGACTCTGTGAAAGACCGTTACACCATCTCTCGTGACAACTCCAAGAACACGGTGTATCTGCAGATGAACAGCCTGCGTGATGAAGACACTGCAGTCTATTACTGTGCACGTGTGTCTCCGTTCGACTACGGTGCTGATTATTGGGGTCAAGGTACTCTGGTCACCGTCAGCTCTGCATCTACTCAGTCTCCATCTGTCACTAGCTGAAAGCTT-3' are provided.

In one embodiment, the expression fragment of interest comprises a nucleotide fragment encoding an expression murine PD-1 monoclonal antibody. Furthermore, the target expression fragment contains a nucleotide sequence shown as SEQ ID No. 2. The nucleotide sequence shown as SEQ ID No.2 comprises enzyme cutting sites of Age I and Hind III and a nucleotide sequence for coding the murine PD-1 monoclonal antibody. Specifically, the nucleotide sequence shown as SEQ ID No.2 is:

5’-ACCGGTTATGAGCTGACTCAGCCACCTTCAGCATCAGTCAATGTAGGAGAGACTGTCAAAATCACCTGCTCTGGGGACCAATTGCCGAAATATTTTGCAGATTGGTTTCATCAAAGGTCAGACCAGACCATTTTGCAAGTGATATATGATGATAATAAGCGCCCCTCGGGGATCCCTGAAAGAATCTCTGGGTCCAGCTCAGGGACAACAGCCACCTTGACCATCAGAGATGTCCGGGCTGAGGATGAAGGTGACTATTACTGTATCTCAGGATATGTTGATAGTGATAGCAAATTGTATGTTTTTGGCAGCGGAACCCAGCTCACCGTCCTAGGTTGTGGCTGCGGCGGAGGCGGAAGCGGAGGCGGATGTGGCTGCTCATCCGTCACTGTCCAAACCGGGCAAGGTTGGTTCGATCTGTCTCCCTATGGAAGCGGAGATAGATCATGTTACTATACTGCCACGGACGAGACTAGACTGAACAACATGCAACTGTACGTTATGAGCCGATCCGATGATAGATCCATCACCTTCAGAGGCAAAGTGTCGGGTTCGTACTATACTGCATATAATTATAGTAAAACGTACATACACGCTGTTTGGGAGCTGGGGAAGGGGCCAGCTCAGCGCGTCTGGAGCATGTTCTATGACAGTTTCACCTTCGGATCTGCCGTGTGTTCCCTCAAACTGTCAGGGCAGCCTAAGGTGTTAGGAGGAGGTTCTGAGCTGCTTCGGGTGGAGCATCATCACCATCACCATTAAATGCTT-3’。

in another embodiment, the expression fragment of interest comprises a nucleotide fragment encoding an expression murine PD-1 monoclonal antibody, and the expression fragment of interest comprises the nucleotide sequence shown in SEQ ID No. 3. The nucleotide sequence shown in SEQ ID No.3 includes restriction sites of Nco I and Xho I and a nucleotide sequence encoding a murine PD-1 monoclonal antibody. Specifically, the nucleotide sequence shown as SEQID No.3 is as follows:

5’-ATGGAGTATGAGCTGACTCAGCCACCTTCAGCATCAGTCAATGTAGGAGAGACTGTCAAAATCACCTGCTCTGGGGACCAATTGCCGAAATATTTTGCAGATTGGTTTCATCAAAGGTCAGACCAGACCATTTTGCAAGTGATATATGATGATAATAAGCGCCCCTCGGGGATCCCTGAAAGAATCTCTGGGTCCAGCTCAGGGACAACAGCCACCTTGACCATCAGAGATGTCCGGGCTGAGGATGAAGGTGACTATTACTGTTTCTCAGGATATGTTGATAGTGATAGCAAATTGTATGTTTTTGGCAGCGGAACCCAGCTCACCGTCCTAGGTTGTGGCTGCGGCGGAGGCGGAAGCGGAGGCGGATGTGGCTGCTCATCCGTCACTGTCCAAACCGGGCAAGGTTGGTTCGATCTGTCTCCCTATGGAAGCGGAGATAGAACATGTTACTATACTGCCACGGACGAGACTAGACTGAACAACATGCAACTGTACGTCATGAGCCGATCCGATGATAGATCCATCACCTTCAGAGGCAAAGTGTCGGGTTCGTACTATACTGCATATAATTATAGTAAAACGTACATACACGCTGTTTGGGAGCTGGGGAAGGGGCCAGCTCAGCGCGTCTGGAGCATGTTCTATGACAGTTTCACCTTCGGATCTGCCGTGTGTTCCCTCAAACTGTCAGGGGAGCCTAAGGTGTTAGGAGGAGGTTCTGAGCTGCTTCGGGTGGAGCTCGAG-3’。

preferably, the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009. The attenuated salmonella typhimurium VNP20009 is a salmonella typhimurium with tumor targeting and tumor inhibiting effects; and the attenuated salmonella typhimurium VNP20009 has the advantages of reduced genetic toxicity (puri gene deletion), lowered septic shock potential (msbb gene deletion) and antibiotic sensitivity, and has excellent safety.

In one embodiment, the recombinant bacterium expressing the PD-1 antibody is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into attenuated Salmonella typhimurium VNP20009, wherein the recombinant expression vector expressing the PD-1 antibody comprises an expression fragment of interest comprising the nucleotide sequence shown in SEQ ID No. 1.

In one embodiment, the recombinant bacterium expressing the PD-1 antibody is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into attenuated Salmonella typhimurium VNP20009, wherein the recombinant expression vector expressing the PD-1 antibody comprises an expression fragment of interest comprising the nucleotide sequence shown in SEQ ID No. 2.

In one embodiment, the recombinant bacterium expressing the PD-1 antibody is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into attenuated Salmonella typhimurium VNP20009, wherein the recombinant expression vector expressing the PD-1 antibody comprises an expression fragment of interest comprising the nucleotide sequence shown in SEQ ID No. 3.

In one embodiment, the recombinant bacterium expressing the PD-1 antibody is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into Escherichia coli Nissle1917, wherein the recombinant expression vector expressing the PD-1 antibody comprises a target expression fragment containing a nucleotide sequence shown as SEQ ID No. 3.

In one embodiment, the empty vector of the recombinant expression vector is an Abvec-Igk plasmid or a pET-28c plasmid. The Abvec-Igk plasmid is a DNA molecule with a nucleotide sequence shown as SEQ ID No. 4; the pET-28c plasmid is a DNA molecule having the nucleotide sequence shown in SEQ ID No. 5. Specifically, the nucleotide sequence shown as SEQ ID No.4 is:

5'-TTCGAGCTCGCCCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGTGACACTATAGAATAACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCACCTCGGTTCTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACACTCGAGCGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAAGCTTGGCCGCCATGGCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCGATCGGGAATTAATTCGGCGCAGCACCATGGCCTGAAATAACCTCTGAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTGTTAACAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCCTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGTAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGTATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGATGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCAGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCA-3' are provided. Specifically, the nucleotide sequence shown as SEQ ID No.5 is:

5’-ATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATATGGCTGCCGCGCGGCACCAGGCCGCTGCTGTGATGATGATGATGATGGCTGCTGCCCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCTCGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGATCCCGGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACCGGGATCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCTAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGAATTAATTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCA-3’。

the method for constructing a recombinant bacterium that expresses a PD-1 antibody according to an embodiment includes step S110 to step S120. Specifically, the method comprises the following steps:

step S110: and introducing the target expression fragment containing the nucleotide sequence for encoding the PD-1 antibody into an expression empty vector to obtain a recombinant expression vector.

Specifically, the target expression fragment containing the nucleotide sequence encoding the PD-1 antibody is introduced into an expression empty vector by enzyme digestion and enzyme ligation. The target expression fragment comprises enzyme cutting sites corresponding to the enzyme cutting sites on the expression empty vector. The enzyme cutting site on the target expression fragment is used for connecting the target expression fragment and the expression empty vector under the action of ligase after the target expression fragment and the expression empty vector are cut by the same restriction enzyme so as to prepare the recombinant expression vector. Further, the ligase is T4 ligase.

In one embodiment, the expression fragment of interest comprises a nucleotide sequence as shown in SEQ ID No. 1; or the target expression fragment contains a nucleotide sequence shown as SEQ ID No. 2; or the target expression fragment contains a nucleotide sequence shown as SEQID No. 3.

In one embodiment, the method further comprises a step of preparing the target expression fragment. Specifically, the preparation method of the target expression fragment comprises the following steps: using pUC57-hPD-1 as a template, a target expression fragment containing the nucleotide sequence shown in SEQ ID No.1 was obtained by PCR amplification. Further, primers for PCR are shown as SEQ ID No.6 and SEQ ID No. 7. The nucleotide sequence of the primer shown as SEQID No.6 is as follows: 5'-CTTCACCGGTCACCATCATCATCATCAT-3', respectively; the nucleotide sequence of the primer shown as SEQ ID No.7 is as follows: 5'-TGCGAAGCTTTCAGCTAGTGACAGATGG-3' are provided.

In another embodiment, the step of preparing the expression fragment of interest comprises: and using pUC57-mPD-1 as a template, and carrying out PCR amplification to obtain a target expression fragment containing the nucleotide sequence shown as SEQ ID No.2 or a target expression fragment containing the nucleotide sequence shown as SEQ ID No. 3.

Further, in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.2, the primers of PCR are shown as SEQ ID No.8 and SEQ ID No. 9; specifically, the nucleotide sequence of the primer shown as SEQ ID No.8 is as follows: 5'-CTTCACCGGTTATGAGCTGACTCAG-3' are provided. Specifically, the nucleotide sequence of the primer shown as SEQ ID No.9 is as follows: 5'-TATTAAGCTTTTAATGGTGATGGTGATGATGCTCCACCCGAAGCAG-3' are provided.

Further, in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.3, the primers for PCR are shown as SEQ ID No.10 and SEQ ID No. 11. Specifically, the nucleotide sequence of the primer shown as SEQ ID No.10 is as follows: 5'-CTTCCCATGGAGTATGAGCTGACTCAG-3' are provided. The nucleotide sequence of the primer shown as SEQ ID No.11 is as follows: 5'-TATTCTCGAGCTCCACCCGAAGCAG-3' are provided.

The expression empty vector may be an empty vector commonly used in the art for expression. In this embodiment, the empty expression vector is an Abvec-Igk plasmid or a pET-28c plasmid. The Abvec-Igk plasmid is a DNA molecule with a nucleotide sequence shown as SEQ ID No. 4; the pET-28c plasmid is a DNA molecule having the nucleotide sequence shown in SEQ ID No. 5.

Furthermore, the target expression fragment containing the nucleotide sequence shown in SEQ ID No.1 is introduced into an Abvec-Igk plasmid to obtain an Abvec-Igk-hPD-1 recombinant plasmid. Introducing a target expression fragment containing a nucleotide sequence shown as SEQ ID No.2 into an Abvec-Igk plasmid to obtain an Abvec-Igk-mPD-1 recombinant plasmid. The target expression fragment containing the nucleotide sequence shown as SEQ ID No.3 is introduced into pET-28c plasmid to obtain pET-28c-mPD-1 recombinant plasmid.

Of course, the method further comprises the steps of verifying whether the target expression fragment is correctly introduced into the expression empty vector and performing scale-up culture on the recombinant expression vector into which the target expression fragment has been correctly inserted, after the target expression fragment is introduced into the expression empty vector. Specifically, the means for verifying whether the expression fragment of interest is correctly introduced into the expression empty vector includes colony resistance screening or sequencing.

Step S120: and transforming the recombinant expression vector into a host to obtain the recombinant bacteria for expressing the PD-1 antibody, wherein the host is attenuated salmonella typhimurium or escherichia coli Nissle 1917.

Preferably, the attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009.

In one embodiment, the recombinant expression vector is transformed into attenuated Salmonella typhimurium by electroporation. Specifically, a 0.1cm electric rotating cup is adopted, and the recombinant expression vector is electrically rotated into the sensitive attenuated salmonella typhimurium VNP20009 under the conditions of 1.8kV, 200 omega, 25 muF and 4.7 ms; then screening positive clones through ampicillin resistance to obtain recombinant bacteria expressing the PD-1 antibody.

Further, the Abvec-Igk-hPD-1 recombinant plasmid, the Abvec-Igk-mPD-1 recombinant plasmid and the pET-28c-mPD-1 recombinant plasmid are respectively electrically transferred into a competent attenuated Salmonella typhimurium VNP 20009; then screening positive clones through ampicillin resistance to obtain three recombinant bacteria expressing PD-1 antibodies.

In one embodiment, the preparation of competent attenuated salmonella typhimurium VNP20009 comprises: the attenuated salmonella typhimurium VNP20009 is streaked and inoculated to an LB plate without resistance and cultured overnight at 37 ℃; picking a single colony in 5mL LB culture medium, and carrying out shake culture at 37 ℃ for 12 h; inoculating the strain into 100mL LB culture medium according to the proportion of 1:100, and performing shaking culture until the OD value of bacteria is 0.4; ice-cooling for 20min, and centrifuging at 4 deg.C and 3000rpm for 10 min; washing thallus precipitate twice with 1/10 volume pre-cooled sterile deionized water, centrifuging at 4 deg.C and 3000rpm for 10 min; washing thallus with 1/100 volume precooled 10% glycerol, centrifuging at 4 deg.C and 3000rpm for 10 min; the pellet was resuspended in 1/100 volumes of pre-cooled 10% glycerol to give a competent attenuated Salmonella typhimurium VNP 20009.

In one example, the recombinant expression vector is transformed into E.coli Nissle1917 by heat shock transformation. Specifically, the recombinant expression vector and competent Escherichia coli Nissle1917 are mixed and iced for 30min, heat shock is carried out for 60s at 42 ℃, and iced for 2 min; then positive clones are screened out through kanamycin resistance, and recombinant bacteria expressing the PD-1 antibody are obtained. Further, the pET-28c-mPD-1 recombinant plasmid and competent Escherichia coli Nissle1917 are mixed and iced for 30min, heat shock is carried out for 60s at 42 ℃, and iced for 2 min; then positive clones are screened out through kanamycin resistance, and recombinant bacteria expressing the PD-1 antibody are obtained.

Further, competent E.coli Nissle1917 was prepared by the following method: coli Nissle1917 was streaked on a non-resistant LB plate and cultured overnight at 37 ℃; selecting a single colony, inoculating the single colony in 5mL LB culture medium, and carrying out shaking culture at 37 ℃ for 12 h; inoculating the strain into 100mL LB culture medium according to the proportion of 1:100, and performing shaking culture until the OD value of bacteria is 0.4; ice-cooling for 30min, and centrifuging at 4 deg.C and 5000rpm for 10 min; the thalli sediment is pre-cooled with 1/10 volumes of 0.1M CaCl₂Resuspending, washing for 1 time after ice bath for 20min, and centrifuging at 4 deg.C and 5000rpm for 10 min; resuspending the pellet in 1/100 volume of precooled CaCl-0.1M₂In 10% glycerol, a competent E.coli Nissle1917 was obtained.

Of course, in other embodiments, other transformation means commonly used in the art may be used to transform the recombinant expression vector into competent attenuated salmonella typhimurium.

The construction method of the recombinant bacteria for expressing the PD-1 antibody is simple, convenient and easy to operate, and is suitable for industrial production. In addition, the construction method of the recombinant bacteria for expressing the PD-1 antibody adopts attenuated salmonella typhimurium VNP20009 to mediate eukaryotic and prokaryotic plasmid transfected cells to realize eukaryotic and prokaryotic expression, and adopts escherichia coli Nissle1917 to mediate prokaryotic plasmid transfected cells to realize prokaryotic expression.

The anti-tumor drug comprises the recombinant bacterium expressing the PD-1 antibody, and the hPD-1 antibody or mPD-1 antibody is expressed by the recombinant bacterium expressing the PD-1 antibody at a solid tumor and is combined with PD-1 of a T cell, so that the combination of PD-L1 in the tumor cell and PD-1 of the T cell is blocked, and the effect of gathering at the tumor to kill the tumor cell is further realized. The anti-tumor medicament can kill tumor cells specifically and in a targeted manner, simultaneously reduces the damage of the tumor cells to normal cells of an organism, and has good anti-tumor effect.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The experimental methods without specific conditions in the examples are realized according to conventional conditions, such as the conditions described in documents and books or the methods recommended by manufacturers, the original plasmids pet28c, E.coli DH5 α, Escherichia coli Nissle1917, restriction enzymes, T4DNA ligase, LB solid medium and liquid medium used in the following experiments are all conventional biochemical experimental materials and are all purchased from the market, and the Abvec-Igk plasmid can be prepared according to the prior art.

Example 1

(1) Obtaining the target expression fragment:

using pUC57-hPD-1 plasmid containing humanized hPD-1 sequence as template, nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7 as primers, and obtaining the target expression fragment shown in SEQ ID No.1 by PCR amplification: Age-I-hPD-1-Hind III fragment.

Using pUC57-mPD-1 plasmid containing murine mPD-1 as a template, using nucleotide sequences shown as SEQ ID No.8 and SEQ ID No.9 as primers, and carrying out PCR amplification to obtain a target expression fragment shown as SEQ ID No. 2; Age-I-mPD-1-Hind III fragment.

Using pUC57-mPD-1 plasmid containing murine mPD-1 as a template, using nucleotide sequences shown as SEQ ID No.10 and SEQ ID No.11 as primers, and carrying out PCR amplification to obtain a target expression fragment shown as SEQ ID No. 3: nco I-mPD-1-Xho I fragment.

(2) Construction of recombinant expression vectors:

and (2) carrying out double digestion on the Age-I-hPD-1-Hind III fragment obtained in the step (1) and the Abvec-Igk plasmid (SEQ ID No.4) by Age I and Hind III respectively, purifying double digestion products, and then connecting the double digestion products by using T4 ligase to obtain a recombinant expression vector Abvec-Igk-hPD-1 or a recombinant plasmid Abvec-Igk-hPD-1. The structural schematic diagram of the recombinant plasmid Abvec-Igk-hPD-1 is shown in FIG. 1.

And (2) carrying out double enzyme digestion on the Age-I-mPD-1-Hind III fragment and the Abvec-Igk plasmid obtained in the step (1) respectively through Age I and Hind III, purifying double enzyme digestion products, and then connecting the double enzyme digestion products by adopting T4 ligase to obtain a recombinant expression vector Abvec-Igk-mPD-1, or called a recombinant plasmid Abvec-Igk-mPD-1. The structural schematic diagram of the recombinant plasmid Abvec-Igk-mPD-1 is shown in FIG. 1.

The Nco I-mPD-1-Xho I fragment obtained in the step (1) and pET-28c (SEQ ID No.5) are subjected to double enzyme digestion by Nco I and Xho I respectively, and after the double enzyme digestion products are purified, T4 ligase is adopted for connection to obtain a recombinant expression vector pET-28c-mPD-1 or recombinant plasmid pET-28 c-mPD-1. The structural schematic diagram of the recombinant plasmid pET-28c-mPD-1 is shown in figure 1.

(3) And (3) competent preparation:

the attenuated salmonella typhimurium VNP20009 preserved at-80 ℃ is streaked and inoculated to an LB plate without resistance and cultured overnight at 37 ℃; picking a single colony in 5mL LB, and carrying out shake culture at 37 ℃ for 12 h; according to the following steps: inoculating 100 proportion of the strain in 100mL LB, and performing shaking culture until the OD of the bacteria is about 0.4; after ice-bath for 20min, centrifuging at 4 ℃ and 5000rpm for 10 min; washing thallus precipitate twice with 1/10 volume of precooled sterile deionized water, and centrifuging at 4 ℃ and 5000rpm for 10 min; washing thallus with 1/100 volume precooled 10% glycerol, centrifuging at 4 deg.C and 5000rpm for 10 min; and (3) suspending the thallus precipitate in 1/100 volume of precooled 10% glycerol to obtain competent attenuated salmonella typhimurium VNP20009, and keeping the competent attenuated salmonella typhimurium at-80 ℃ for later use after subpackaging.

Escherichia coli Nissle1917 stored at-80 ℃ is streaked and inoculated on an LB plate without resistance, and cultured overnight at 37 ℃; picking a single colony in 5mL LB, and carrying out shake culture at 37 ℃ for 12 h; according to the following steps: inoculating 100 proportion of the strain in 100mL LB, and performing shaking culture until the OD of the bacteria is about 0.4; after ice-cooling for 30min, centrifuging at 5000rpm for 10mi at 4 DEG Cn; the thalli sediment is pre-cooled with 1/10 volumes of 0.1M CaCl₂Resuspending, washing for 1 time after ice bath for 20min, centrifuging for 10min at 4 ℃ and 5000 rpm; resuspending the pellet in 1/100 volume of precooled CaCl-0.1M₂In 10% glycerol, making into competent Escherichia coli Nissle1917, subpackaging, and keeping at-80 deg.C for use.

(4) Transformation and screening:

and (3) respectively electrotransfering the recombinant plasmid Abvec-Igk-hPD-1, the recombinant plasmid Abvec-Igk-mPD-1 and the recombinant plasmid pET-28c-mPD-1 obtained in the step (2) into competent attenuated salmonella typhimurium VNP20009 by adopting a 0.1cm electrotransfer cup, wherein the electrotransfer conditions are as follows: 1.8kv 200 omega 25 muF, 4.7ms of electric conversion; then screening out positive clones through ampicillin and kanamycin resistance to obtain three recombinant attenuated salmonella typhimurium VNP 20009. The three recombinant attenuated salmonella typhimurium VNP20009 are correspondingly named as Abvec-Igk-hPD-1-VNP20009, Abvec-Igk-mPD-1-VNP20009 and pET-28c-mP D-1-VNP 20009.

Transforming the recombinant plasmid pET-28c-mPD-1 obtained in the step (2) into competent Escherichia coli Nissle1917, and carrying out the following conditions: ice-cooling for 30min, and then 60s at 42 ℃ for 2 min; positive clones were screened for kanamycin resistance to obtain recombinant E.coli Nissle1917, which was designated pET-28c-mPD-1-Nissle 1917.

(5) And (3) effect testing:

human cervical carcinoma HeLa cells (2X 10)⁷/mL) of the compound is dissolved in PBS solution, and is injected into vaginal submucosa of a unbl-c nude mouse close to the cervix, 25 mu L of each mouse, and the injection is continued for 7 days, so as to obtain a mouse cervical cancer model. Mouse melanoma B16F10 cells were inoculated subcutaneously into C57BL/6 mice to obtain melanoma model mice.

The cervical cancer Model mice were randomly and equally divided into 3 groups of 10 mice each, and named Model group, VNP20009 group and Abvec-Igk-hPD-1-VNP20009 group. Then the attenuated Salmonella typhimurium VNP20009 and the Abvec-Igk-hPD-1-VNP20009 obtained in the step (4) are respectively passed through the tail vein at 1 × 10⁵The injection amount of CFU was injected into the cervical cancer Model mice of the corresponding group, wherein the Model group was a blank control using physiological saline as an injection. Treatment of groups of cervical cancer model mice every three daysThe tumor volume of the cervical cancer model mouse was measured once every 3 days, and the tumor was taken out of the cervical cancer model mouse after the end of the experiment (or the death of the mouse) and the diameter was measured and weighed, and the results are shown in fig. 2. In FIG. 2, the abscissa is time (day) and the ordinate is tumor volume (mm)³)。

Melanoma Model mice were randomly divided equally into 5 groups of 10 mice each, and named Model group, VNP20009 group, Abvec-Igk-mPD-1-VNP20009 group, pET-28c-mPD-1-VNP20009 group, and pET-28c-mPD-1-Nissle1917 group. Attenuated Salmonella typhimurium VNP20009, Abvec-Igk-mPD-1-VNP20009 obtained in step (4), pET-28c-mPD-1-VNP20009 and pET-28c-mPD-1-Nissle1917 were introduced through the tail vein at 1X 10⁵The injection amount of CFU was injected into melanoma Model mice of the corresponding group, wherein the Model group was a blank control with saline as an injection. Treatment of each group of melanoma model mice was performed every three days, and the tumor volume of the melanoma model mice was measured every 3 days, and after the experiment was completed (or the mice died), the tumors were removed from the mice and measured for diameter and weighed, and the results are shown in fig. 3. In FIG. 3, the abscissa is time (day) and the ordinate is tumor volume (mm)³)

As shown in FIG. 2, Abvec-Igk-hPD-1-VNP20009 has significant inhibition on the growth of cervical cancer cells.

As shown in FIG. 3, Abvec-Igk-mPD-1-VNP20009, pET-28c-mPD-1-VNP20009 and pET-28c-mPD-1-Nissle1917 have obvious inhibition on the growth of melanoma cells.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen Shenzhu Biotechnology Limited

<120> recombinant bacterium expressing PD-1 antibody, and construction method and application thereof

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>807

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

accggtcacc atcatcatca tcattcttct ggtgagaacc tgtacttcca aggtgctagc 60

gaactggtgg taactcaaga accgtctctg accgtgtctc caggtggcac cgtcactctg 120

acctgtggtt ctagcactgg tgcagtcacc agcggtaact atccgagctg gccgcaacag 180

aaaccagcac aggctccgcg tccactgatc tacactacca ctaacaaaca ctcttggacc 240

ccagctcagt tctctggctc tctgctcggt ggcaaagctg tactgactct gtctggtgtt 300

cagccagaag acgaagctga ctattactgc cgtctgttct atggtggtcc gtgggtcttt 360

ggtggcggta ctcagctgac cgacctgggt ggtggctctt ctcgtagctc cgaagttcag 420

ctgctggaat ctggtcgtgg cctggtacag ccaggtggct ctctgcgtct gtcttgtgca 480

gcttctggct tcaccttcag cagctatgct accaactggg tacgtcaggc tccaggtaaa 540

ggtctggagt gggtctctct gatctctggt agcggtggtt ctaccttcta cgcagactct 600

gtgaaagacc gttacaccat ctctcgtgac aactccaaga acacggtgta tctgcagatg 660

aacagcctgc gtgatgaaga cactgcagtc tattactgtg cacgtgtgtc tccgttcgac 720

tacggtgctg attattgggg tcaaggtact ctggtcaccg tcagctctgc atctactcag 780

tctccatctg tcactagctg aaagctt 807

<210>2

<211>768

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

accggttatg agctgactca gccaccttca gcatcagtca atgtaggaga gactgtcaaa 60

atcacctgct ctggggacca attgccgaaa tattttgcag attggtttca tcaaaggtca 120

gaccagacca ttttgcaagt gatatatgat gataataagc gcccctcggg gatccctgaa 180

agaatctctg ggtccagctc agggacaaca gccaccttga ccatcagaga tgtccgggct 240

gaggatgaag gtgactatta ctgtatctca ggatatgttg atagtgatag caaattgtat 300

gtttttggca gcggaaccca gctcaccgtc ctaggttgtg gctgcggcgg aggcggaagc 360

ggaggcggat gtggctgctc atccgtcact gtccaaaccg ggcaaggttg gttcgatctg 420

tctccctatg gaagcggaga tagatcatgt tactatactg ccacggacga gactagactg 480

aacaacatgc aactgtacgt tatgagccga tccgatgata gatccatcac cttcagaggc 540

aaagtgtcgg gttcgtacta tactgcatat aattatagta aaacgtacat acacgctgtt 600

tgggagctgg ggaaggggcc agctcagcgc gtctggagca tgttctatga cagtttcacc 660

ttcggatctg ccgtgtgttc cctcaaactg tcagggcagc ctaaggtgtt aggaggaggt 720

tctgagctgc ttcgggtgga gcatcatcac catcaccatt aaatgctt 768

<210>3

<211>747

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atggagtatg agctgactca gccaccttca gcatcagtca atgtaggaga gactgtcaaa 60

atcacctgct ctggggacca attgccgaaa tattttgcag attggtttca tcaaaggtca 120

gaccagacca ttttgcaagt gatatatgat gataataagc gcccctcggg gatccctgaa 180

agaatctctg ggtccagctc agggacaaca gccaccttga ccatcagaga tgtccgggct 240

gaggatgaag gtgactatta ctgtttctca ggatatgttg atagtgatag caaattgtat 300

gtttttggca gcggaaccca gctcaccgtc ctaggttgtg gctgcggcgg aggcggaagc 360

ggaggcggat gtggctgctc atccgtcact gtccaaaccg ggcaaggttg gttcgatctg 420

tctccctatg gaagcggaga tagaacatgt tactatactg ccacggacga gactagactg 480

aacaacatgc aactgtacgt catgagccga tccgatgata gatccatcac cttcagaggc 540

aaagtgtcgg gttcgtacta tactgcatat aattatagta aaacgtacat acacgctgtt 600

tgggagctgg ggaaggggcc agctcagcgc gtctggagca tgttctatga cagtttcacc 660

ttcggatctg ccgtgtgttc cctcaaactg tcaggggagc ctaaggtgtt aggaggaggt 720

tctgagctgc ttcgggtgga gctcgag 747

<210>4

<211>4119

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ttcgagctcg cccgacattg attattgact agttattaat agtaatcaat tacggggtca 60

ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct 120

ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta 180

acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac 240

ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt 300

aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag 360

tacatctacg tattagtcat cgctattacc atggtgatgc ggttttggca gtacatcaat 420

gggcgtggat agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat 480

gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa caactccgcc 540

ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcgt 600

ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct ccatagaaga 660

caccgggacc gatccagcct ccgcggccgg gaacggtgca ttggaacgcg gattccccgt 720

gccaagagtg acgtaagtac cgcctataga gtctataggc ccaccccctt ggcttcgtta 780

gaacgcggct acaattaata cataacctta tgtatcatac acatacgatt taggtgacac 840

tatagaataa catccacttt gcctttctct ccacaggtgt ccactcccag gtccaactgc 900

acctcggttc tatcgattga attccaccat gggatggtca tgtatcatcc tttttctagt 960

agcaactgca accggtgtac actcgagcgt acggtggctg caccatctgt cttcatcttc 1020

ccgccatctg atgagcagtt gaaatctgga actgcctctg ttgtgtgcct gctgaataac 1080

ttctatccca gagaggccaa agtacagtgg aaggtggata acgccctcca atcgggtaac 1140

tcccaggaga gtgtcacaga gcaggacagc aaggacagca cctacagcct cagcagcacc 1200

ctgacgctga gcaaagcaga ctacgagaaa cacaaagtct acgcctgcga agtcacccat 1260

cagggcctga gctcgcccgt cacaaagagc ttcaacaggg gagagtgtta gaagcttggc 1320

cgccatggcc caacttgttt attgcagctt ataatggtta caaataaagc aatagcatca 1380

caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca 1440

tcaatgtatc ttatcatgtc tggatcgatc gggaattaat tcggcgcagc accatggcct 1500

gaaataacct ctgaaagagg aacttggtta ggtaccttct gaggcggaaa gaaccagctg 1560

tggaatgtgt gtcagttagg gtgtggaaag tccccaggct ccccagcagg cagaagtatg 1620

caaagcatgc atctcaatta gtcagcaacc aggtgtggaa agtccccagg ctccccagca 1680

ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccatagtccc gcccctaact 1740

ccgcccatcc cgcccctaac tccgcccagt tccgcccatt ctccgcccca tggctgacta 1800

atttttttta tttatgcaga ggccgaggcc gcctcggcct ctgagctatt ccagaagtag 1860

tgaggaggct tttttggagg cctaggcttt tgcaaaaagc tgttaacagc ttggcactgg 1920

ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg 1980

cagcacatcc ccccttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt 2040

cccaacagtt gcgtagcctg aatggcgaat ggcgcctgat gcggtatttt ctccttacgc 2100

atctgtgcgg tatttcacac cgcatacgtc aaagcaacca tagtacgcgc cctgtagcgg 2160

cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc 2220

cctagcgccc gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc 2280

ccgtcaagct ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct 2340

cgaccccaaa aaacttgatt tgggtgatgg ttcacgtagt gggccatcgc cctgatagac 2400

ggtttttcgc cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac 2460

tggaacaaca ctcaacccta tctcgggcta ttcttttgat ttataaggga ttttgccgat 2520

ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa 2580

aatattaacg tttacaattt tatggtgcac tctcagtaca atctgctctg atgccgcata 2640

gttaagccaa ctccgctatc gctacgtgac tgggtcatgg ctgcgccccg acacccgcca 2700

acacccgctg acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct 2760

gtgaccgtct ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg 2820

aggcagtatt cttgaagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc 2880

atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc 2940

cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc 3000

tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc 3060

gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg 3120

gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat 3180

ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc 3240

acttttaaag ttctgctatg tggcgcggta ttatcccgtg atgacgccgg gcaagagcaa 3300

ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa 3360

aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt 3420

gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct 3480

tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat 3540

gaagccatac caaacgacga gcgtgacacc acgatgccag cagcaatggc aacaacgttg 3600

cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg 3660

atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt 3720

attgctgata aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg 3780

ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg 3840

gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg 3900

tcagaccaag tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa 3960

aggatctagg tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt 4020

tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt 4080

tttctgcgcg taatctgctg cttgcaaaca aaaaaacca 4119

<210>5

<211>5367

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180

cgacggagct cgaattcgga tccgacccat ttgctgtcca ccagtcatgc tagccatatg 240

gctgccgcgc ggcaccaggc cgctgctgtg atgatgatga tgatggctgc tgcccatggt 300

atatctcctt cttaaagtta aacaaaatta tttctagagg ggaattgtta tccgctcaca 360

attcccctat agtgagtcgt attaatttcg cgggatcgag atctcgatcc tctacgccgg 420

acgcatcgtg gccggcatca ccggcgccac aggtgcggtt gctggcgcct atatcgccga 480

catcaccgat ggggaagatc gggctcgcca cttcgggctc atgagcgctt gtttcggcgt 540

gggtatggtg gcaggccccg tggccggggg actgttgggc gccatctcct tgcatgcacc 600

attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca 660

ggagtcgcat aagggagagc gtcgagatcc cggacaccat cgaatggcgc aaaacctttc 720

gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat gtgaaaccag 780

taacgttata cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt tcccgcgtgg 840

tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg gcgatggcgg 900

agctgaatta cattcccaac cgcgtggcac aacaactggc gggcaaacag tcgttgctga 960

ttggcgttgc cacctccagt ctggccctgc acgcgccgtc gcaaattgtc gcggcgatta 1020

aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa cgaagcggcg 1080

tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt gggctgatca 1140

ttaactatcc gctggatgac caggatgcca ttgctgtgga agctgcctgc actaatgttc 1200

cggcgttatt tcttgatgtc tctgaccaga cacccatcaa cagtattatt ttctcccatg 1260

aagacggtac gcgactgggc gtggagcatc tggtcgcatt gggtcaccag caaatcgcgc 1320

tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg tctggctggc tggcataaat 1380

atctcactcg caatcaaatt cagccgatag cggaacggga aggcgactgg agtgccatgt 1440

ccggttttca acaaaccatg caaatgctga atgagggcat cgttcccact gcgatgctgg 1500

ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc gggctgcgcg 1560

ttggtgcgga tatctcggta gtgggatacg acgataccga agacagctca tgttatatcc 1620

cgccgttaac caccatcaaa caggattttc gcctgctggg gcaaaccagc gtggaccgct 1680

tgctgcaact ctctcagggc caggcggtga agggcaatca gctgttgccc gtctcactgg 1740

tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 1800

attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 1860

gcaattaatg taagttagct cactcattag gcaccgggat ctcgaccgat gcccttgaga 1920

gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt 1980

atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt 2040

ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc 2100

ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa acgtttcggc 2160

gagaagcagg ccattatcgc cggcatggcg gccccacggg tgcgcatgat cgtgctcctg 2220

tcgttgagga cccggctagg ctggcggggt tgccttactg gttagcagaa tgaatcaccg 2280

atacgcgagc gaacgtgaag cgactgctgc tgcaaaacgt ctgcgacctg agcaacaaca 2340

tgaatggtct tcggtttccg tgtttcgtaa agtctggaaa cgcggaagtc agcgccctgc 2400

accattatgt tccggatctg catcgcagga tgctgctggc taccctgtgg aacacctaca 2460

tctgtattaa cgaagcgctg gcattgaccc tgagtgattt ttctctggtc ccgccgcatc 2520

cataccgcca gttgtttacc ctcacaacgt tccagtaacc gggcatgttc atcatcagta 2580

acccgtatcg tgagcatcct ctctcgtttc atcggtatca ttacccccat gaacagaaat 2640

cccccttaca cggaggcatc agtgaccaaa caggaaaaaa ccgcccttaa catggcccgc 2700

tttatcagaa gccagacatt aacgcttctg gagaaactca acgagctgga cgcggatgaa 2760

caggcagaca tctgtgaatc gcttcacgac cacgctgatg agctttaccg cagctgcctc 2820

gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca 2880

gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt 2940

ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg atagcggagt gtatactggc 3000

ttaactatgc ggcatcagag cagattgtac tgagagtgca ccatatatgc ggtgtgaaat 3060

accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 3120

tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 3180

aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 3240

gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 3300

ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 3360

ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 3420

gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 3480

ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 3540

cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 3600

cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 3660

gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 3720

aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 3780

tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca 3840

gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc 3900

tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgaaca ataaaactgt 3960

ctgcttacat aaacagtaat acaaggggtg ttatgagcca tattcaacgg gaaacgtctt 4020

gctctaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 4080

gcgataatgt cgggcaatca ggtgcgacaa tctatcgatt gtatgggaag cccgatgcgc 4140

cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 4200

tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 4260

ctcctgatga tgcatggtta ctcaccactg cgatccccgg gaaaacagca ttccaggtat 4320

tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 4380

ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 4440

ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 4500

gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac 4560

cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 4620

aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 4680

ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 4740

aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 4800

ttttctaaga attaattcat gagcggatac atatttgaat gtatttagaa aaataaacaa 4860

ataggggttc cgcgcacatt tccccgaaaa gtgccacctg aaattgtaaa cgttaatatt 4920

ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 4980

atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 5040

gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 5100

gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 5160

aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 5220

ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 5280

gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 5340

ccgctacagg gcgcgtccca ttcgcca 5367

<210>6

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cttcaccggt caccatcatc atcatcat 28

<210>7

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tgcgaagctt tcagctagtg acagatgg 28

<210>8

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cttcaccggt tatgagctga ctcag 25

<210>9

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tattaagctt ttaatggtga tggtgatgat gctccacccg aagcag 46

<210>10

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cttcccatgg agtatgagct gactcag 27

<210>11

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

tattctcgag ctccacccga agcag 25

Claims

1. A recombinant bacterium expressing a PD-1 antibody, which is obtained by transforming a recombinant expression vector expressing the PD-1 antibody into attenuated Salmonella typhimurium or Escherichia coli Nissle 1917.

2. The recombinant bacterium expressing a PD-1 antibody according to claim 1, wherein said attenuated salmonella typhimurium is attenuated salmonella typhimurium VNP 20009.

3. The recombinant bacterium expressing a PD-1 antibody according to claim 1 or 2, characterized in that said recombinant expression vector expressing a PD-1 antibody comprises an expression fragment of interest, said expression fragment of interest containing the nucleotide sequence shown as SEQ ID No.1, or said expression fragment of interest containing the nucleotide sequence shown as SEQ ID No.2, or said expression fragment of interest containing the nucleotide sequence shown as SEQ ID No. 3.

4. A method for constructing a recombinant bacterium expressing a PD-1 antibody, comprising the steps of:

5. The method of claim 4, wherein the attenuated Salmonella typhimurium is attenuated Salmonella typhimurium VNP 20009.

6. The method for constructing the recombinant bacterium expressing the PD-1 antibody according to claim 4, characterized in that the expression fragment of interest contains a nucleotide sequence shown as SEQ ID No.1, or the expression fragment of interest contains a nucleotide sequence shown as SEQ ID No.2, or the expression fragment of interest contains a nucleotide sequence shown as SEQ ID No. 3.

7. The method of claim 6, further comprising a step of preparing the expression fragment of interest, wherein the step of preparing the expression fragment of interest comprises:

8. The method for constructing a recombinant bacterium that expresses a PD-1 antibody according to claim 7, wherein in the step of obtaining a target expression fragment containing a nucleotide sequence represented by SEQ ID No.1, primers for PCR are represented by SEQ ID nos. 6 and 7; in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.2, the primers of PCR are shown as SEQ ID No.8 and SEQ ID No. 9; in the step of obtaining the target expression fragment containing the nucleotide sequence shown as SEQ ID No.3, the primers of PCR are shown as SEQ ID No.10 and SEQ ID No. 11.

9. The method for constructing recombinant bacteria expressing PD-1 antibody according to any one of claims 4 to 6, characterized in that the expression empty vector is an Abvec-Igk plasmid or a pET-28c plasmid.

10. The method for constructing the recombinant bacterium expressing the PD-1 antibody according to claim 4, characterized in that the target expression fragment contains a nucleotide sequence shown as SEQ ID No.1, or the target expression fragment contains a nucleotide sequence shown as SEQ ID No.2, the expression empty vector is an Abvec-Igk plasmid, and the host is attenuated Salmonella typhimurium.

11. Use of the recombinant bacterium expressing the PD-1 antibody according to any one of claims 1 to 3 or the recombinant bacterium expressing the PD-1 antibody according to any one of claims 4 to 10 in the preparation of an antitumor drug.

12. The use according to claim 11, wherein the tumor is melanoma, cervical cancer.

13. An antitumor agent comprising the recombinant bacterium expressing a PD-1 antibody according to any one of claims 1 to 3 or the recombinant bacterium expressing a PD-1 antibody produced by the method for constructing the recombinant bacterium expressing a PD-1 antibody according to any one of claims 4 to 10.