CN114588264A

CN114588264A - Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia-reperfusion injury medicine

Info

Publication number: CN114588264A
Application number: CN202210175264.5A
Authority: CN
Inventors: 肖俊杰; 周秋莲; 张潇; 孟丹妮
Original assignee: University of Shanghai for Science and Technology
Current assignee: University of Shanghai for Science and Technology
Priority date: 2022-02-25
Filing date: 2022-02-25
Publication date: 2022-06-07
Anticipated expiration: 2042-02-25
Also published as: CN114588264B

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an application of a reagent for knocking down or inhibiting EGR3 in preparation of a myocardial ischemia-reperfusion injury medicine. According to the invention, the EGR3 is knocked down to inhibit the expression of EGR3 protein, the cardiac function after myocardial ischemia reperfusion is improved, the cardiac fibrosis after myocardial ischemia reperfusion is reduced, and the myocardial hypertrophy after myocardial ischemia reperfusion is improved.

Description

Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia-reperfusion injury medicine

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an application of a reagent for knocking down or inhibiting EGR3 in preparation of a myocardial ischemia-reperfusion injury medicine.

Background

The myocardial ischemia-reperfusion injury refers to a pathological process in which tissue injury is progressively aggravated while normal perfusion of ischemic myocardium is restored when recanalization is regained after partial or complete acute occlusion of coronary artery. A series of damaging changes of myocardial ultrastructure, energy metabolism, cardiac function, electrophysiology and the like caused by an ischemic period are more prominent after revascularization, and even serious arrhythmia can occur to cause sudden death. Reperfusion injury after myocardial ischemia can occur in open heart surgery, coronary artery bypass surgery, coronary angioplasty, thrombolysis, sudden increase in myocardial medial branch circulation blood volume, and the like. The generation mechanism is thought to be mainly related to the massive production of intracellular oxygen free radicals, the overload of calcium ions, the inflammatory action of leukocytes, the deficiency of high-energy phosphate compounds and the like. In addition to the heart, ischemia reperfusion injury can also be seen in organs such as brain, lung, liver, pancreas, kidney, and gastrointestinal tract.

Early growth response gene 3(EGR3) is a member of the early growth response gene family and mediates signal pathways related to the nervous system/immune system and the like through transcriptional regulation. At present, the function and mechanism of EGR3 protein in myocardial ischemia-reperfusion injury have not been studied and reported in any way.

Disclosure of Invention

The invention aims to provide application of an EGR3 knocking down or inhibiting agent in preparation of a myocardial ischemia-reperfusion injury medicine and increase medical application of EGR 3.

The invention provides application of an EGR3 knocking down or inhibiting agent in preparation of a myocardial ischemia-reperfusion injury medicine.

Preferably, the myocardial ischemia-reperfusion injury comprises a pathologic remodeling of the ventricle and/or heart failure.

Preferably, the agent comprises an shRNA that knocks down the expression of EGR3 gene.

Preferably, the positive strand nucleotide sequence of the shRNA is shown as SEQ ID NO.1, and the reverse strand nucleotide sequence is shown as SEQ ID NO. 2.

Preferably, the reagent comprises an EGR3 inhibitor.

Preferably, the active ingredient of the EGR3 inhibitor comprises AAV-shEGR 3.

Preferably, the medicament also comprises pharmaceutically acceptable auxiliary materials.

Preferably, the pharmaceutically acceptable auxiliary materials are selected from one or more of buffer, encapsulating agent, filling agent, adhesive, transdermal absorbent, wetting agent, disintegrating agent, absorption promoter, surfactant, colorant, flavoring agent and adsorption carrier.

The invention provides a medicine for treating myocardial ischemia-reperfusion injury, wherein the effective component of the medicine comprises an agent for knocking down or inhibiting EGR 3.

The invention provides a kit for knocking down or inhibiting the expression of an EGR3 gene, which comprises a reagent for knocking down or inhibiting EGR 3.

The invention provides application of an EGR3 knocking down or inhibiting agent in preparation of a myocardial ischemia-reperfusion injury medicine. Animal experiments show that knocking down EGR3 can improve cardiac function after myocardial ischemia reperfusion, reduce cardiac fibrosis after myocardial ischemia reperfusion, and improve myocardial hypertrophy after myocardial ischemia reperfusion. The invention first confirms that the EGR3 can improve myocardial ischemia-reperfusion injury and/or heart failure, provides a new medicine development way and a medicine action target point for the diagnosis and treatment of the myocardial ischemia-reperfusion injury and/or heart failure, and has very important medicinal value.

Drawings

In order to more clearly illustrate the technical solution in the embodiments of the present invention, the drawings required to be used in the embodiments will be briefly described below.

FIG. 1 is a map of the interference vector pHBAAV-U6-MCS-CMV-EGFP vector;

FIG. 2 shows the sequencing result of AAV9-shEGR 3;

3-4 are ultrasonic cardiac chart detection results of knocking down EGR3 to intervene in myocardial ischemia reperfusion injury mouse cardiac function;

FIG. 5 shows the result of verifying AAV9-shEGR3 efficiency at RT-qPCR animal level;

FIG. 6 shows HE staining results of myocardial cell cross-sectional areas of mice with myocardial ischemia reperfusion injury by knocking down EGR 3;

FIG. 7 shows the WGA staining results of the cross-sectional area of the myocardial cells of mice with knocked-down EGR3 intervening myocardial ischemia-reperfusion injury;

fig. 8 shows the result of masson staining of mice with knocked-down EGR3 for intervention in myocardial ischemia-reperfusion injury.

Detailed Description

In the present invention, the myocardial ischemia-reperfusion injury preferably comprises ventricular pathologic remodeling and/or heart failure. The myocardial ischemia-reperfusion according to the invention preferably comprises cardiovascular disease induced myocardial ischemia-reperfusion.

In the present invention, the agent preferably comprises shRNA that knocks down the expression of EGR3 gene. The positive chain nucleotide sequence of shRNA expressed by the knocked-down EGR3 gene is shown as SEQ ID NO.1, and the reverse chain nucleotide sequence is shown as SEQ ID NO. 2.

The nucleotide sequences of the invention are as follows from 5 'to 3':

SEQ ID NO.1：AATTCGCCGGAACTCTCTTATTCGAGCTCTTCTCGAGA AGAGCTCGAATAAGAGAGTTCCGGTTTTTTG；

SEQ ID NO.2：GATCCAAAAAACCGGAACTCTCTTATTCGAGCTCTTCT CGAGAAGAGCTCGAATAAGAGAGTTCCGGCG。

the shRNA has a stem-loop (5 '-CTCGAG-3') structure, and separates inverted repeat sequences to form a hairpin structure, so that the effect of knocking down the expression of the EGR3 gene is achieved.

In the present invention, the agent preferably comprises an EGR3 inhibitor. The active ingredient of the EGR3 inhibitor preferably comprises AAV-shEGR3, and more preferably AAV9-shEGR 3. The AAV-shEGR3 source is not strictly required, the shRNA expressed by the knocked-down EGR3 gene is recombined to an adenovirus vector by adopting a conventional plasmid construction mode, and the recombined adenovirus AAV9-shEGR3 is obtained by the preparation of the adeno-associated virus vector, the packaging of the adeno-associated virus and the purification. Preferred adenoviral vectors of the invention are AAV 9. In the practice of the present invention, recombinant adenovirus AAV9-shEGR3 is preferably provided by Hantah Biotech (Shanghai) Inc.

After obtaining the recombinant adenovirus AAV9-shEGR3, the invention preferably selects the recombinant adenovirus AAV9-shEGR3And (6) packaging. The packaging mode is not particularly limited, and the titer of the recombinant adenovirus AAV9-shEGR3 is determined to be 1 × 10¹¹～1×10¹²The virus genome/mL may be, preferably, 3X 10¹¹～6×10¹¹Individual viral genome/mL.

The source of EGR3 is not particularly limited in the present invention, and it may be obtained by chemical synthesis or microbial metabolism.

The invention also provides a medicine for treating myocardial ischemia-reperfusion injury, and the effective component of the medicine comprises a reagent for knocking down or inhibiting EGR 3. According to the invention, the cardiac function can be improved after myocardial ischemia-reperfusion injury by knocking down or inhibiting EGR3, the cardiac fibrosis after myocardial ischemia-reperfusion injury is reduced, the myocardial hypertrophy after myocardial ischemia-reperfusion injury is inhibited, the pathologic remodeling of ventricles is inhibited, the heart failure is improved, and the reagent with the function of knocking down or inhibiting EGR3 is used as an active ingredient of the medicine, so that the myocardial ischemia-reperfusion injury can be improved.

In the present invention, the medicament preferably further comprises pharmaceutically acceptable excipients. The pharmaceutically acceptable auxiliary materials are selected from one or more of diluents, buffering agents, suspending agents, emulsions, granules, encapsulating agents, excipients, fillers, adhesives, spraying agents, transdermal absorbents, wetting agents, disintegrating agents, absorption promoters, surfactants, coloring agents, flavoring agents and adsorption carriers. In the specific implementation process of the invention, proper auxiliary materials are selected according to the dosage form of the medicine.

In order to further illustrate the present invention, the following detailed description of the technical solutions provided by the present invention is made with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

AAV9-shEGR3 adeno-associated virus vector construction

The interference vector pHBAAV-U6-MCS-CMV-EGFP (figure 1) and shRNA fragment (the positive strand nucleotide sequence is shown as SEQ ID NO. 1: 5'-AATTCGCCGGAA CTCTCTTATTCGAGCTCTTCTCGAGAAGAGCTCGAATAAGAGAGTTCCGGT TTTTTG-3', and the reverse strand nucleotide sequence is shown as SEQ I)D NO. 2: 5'-GATCCAAAAAACCGGAA CTCTCTTATTCGAGCTCTTCTCGAGAAGAGCTCGAATAAGAGAGTTCCGGC G-3'), then carrying out Escherichia coli transformation, screening a target strain by using a conditioned medium (a non-resistant LB medium) after transformation, sending the target strain to a Scout company for sequencing, carrying out plasmid extraction by using a nucleic acid extraction kit to obtain recombinant adenovirus AAV9-shEGR3, wherein the sequencing result is shown in figure 2. As can be seen from the sequencing structure in FIG. 2, the sequencing result is consistent with the target sequence, which indicates that the recombinant adenovirus AAV9-shEGR3 is successfully constructed (the adeno-associated virus construction process is carried out by Hanhengshen Biotech, Inc., and the constructed AAV9-shEGR3 is provided by Hanhengshen Biotech, Inc., and the titer is 1.4 × 10¹³μg/mL。

AAV9-Empty adeno-associated virus vector construction

In the same step 1, the positive strand nucleotide sequence of the shRNA fragment is shown as SEQ ID NO. 3: 5'-GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTC GGAGAATTTTTTC-3', respectively; the reverse-strand nucleotide sequence is shown as SEQ ID NO. 4: 5'-AATTGAA AAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGG AGAACG-3', recombinant adenovirus AAV9-Empty provided by Henan bioscience technology, Inc., and having a titer of 1.8X 10¹³μg/mL。

Example 2

1. Mouse grouping and model building

40 experimental mice purchased from Beijing Wittiulihua laboratory animal technology Co., Ltd were divided on average into an Ischemic Reperfusion Injury (IRI) group (experimental group) and a Sham operation (Sham) group (control group);

experimental groups: mice were anesthetized with 4% chloral hydrate by intraperitoneal injection at a dose of 10. mu.L/g. When pressure was applied to the tail ends of the rats and the four limbs with forceps, the mice did not respond and were considered to be fully anesthetized. Fully anesthetized mice were placed on a thermostatic pad at 37 ℃, depilated on their neck and chest, the neck of the mice exposed, and sterilized with 75% alcohol. Separating neck skin, muscle and tissue covered on trachea along straight line under microscope, cutting a small hole between two tracheal cartilage rings under glottis after trachea is exposed, inserting tracheal cannula, and fixing. Examination of the movement of the thorax ensures good ventilation of both lungs (120 breaths per minute). Then under a microscope, a transverse incision is made at the fourth, fifth, intercostal position of the left edge of the left sternum of the mouse by using small scissors, the incision is about 1.2cm long, chest wall muscles are separated layer by layer until the intercostal muscles are exposed, the intercostal muscles are separated bluntly by using a pair of microscopic forceps, the heart is exposed, and the left anterior descending artery (between the left auricle and the pulmonary artery cone, the ligation is determined according to the ischemia (whitening) condition of the lower apical part because the ligation is invisible to the naked eye) is ligated. The intercostal muscles and the chest wall muscles are sutured. After 30 minutes the chest was opened again and the ligature was cut off and removed. The intercostal muscles, the chest wall muscles and the skin are sutured, and the mouse is stimulated to pull out the respiratory tube after reaction. Iodine tincture sterilization is carried out on the wound after the operation, and if dehydration is shown after the operation, sterile physiological salt is injected into the abdominal cavity in time. Taking down the mouse from the constant temperature pad until the mouse wakes up, and putting the mouse back into the mouse cage;

control group: the procedure was identical to the experimental group except that the ligation portion was not performed. After the operation, the patient should be observed whether the patient has a poor breath or not, and if so, the respiratory tract should be cleaned in time. After awakening, mice were removed from the thermostatic pad and returned to their cages.

2. Tail vein injection of virus

The mice in the experimental group are averagely divided into two groups, namely an AAV9-Empty + IRI group and an AAV9-shEG R3+ IRI group, the mice in each group are placed on a tail vein injector one week before the treatment in the step 1, the tail of the mice is disinfected by alcohol, and the AAV9-shEGR3+ IRI group is injected by an insulin injector through the tail vein at a speed of 5 multiplied by 10¹¹Injecting AAV9-shEGR3 obtained in example 1 into the dosage of mu g/mL;

AAV9-Empty + IRI group was injected via tail vein using insulin syringe at 5X 10¹¹The AAV9-Empty obtained in example 1 was injected at a dose of μ g/mL, and after the injection was stopped by cotton wool, the mice were placed in a mouse cage, and the mice in the experimental group were subsequently treated according to the above step 1.

In the same manner, the control mice were divided equally into two groups, designated as AAV9-Empty + Sham group and AAV9-shEGR3+ Sham group, and treated in the same manner as the experimental mice.

Test example 1

Example 24 weeks after treatment, mice were anesthetized with 1.5% to 2% isoflurane and their cardiac function was assessed using a Visual sonic 2100 small animal ultrasound imaging system at a frequency of 30 MHZ. The left ventricular cardiogram (major axis and minor axis) of the B mode can be collected, the cardiogram of the M mode is collected at the maximum diameter position of the left ventricle, LVwall trace is adopted for measurement, and left ventricular Ejection Fraction (EF) and left ventricular minor axis shortening Fraction (FS) are measured. Each experimental index was measured 3 times per mouse and averaged. The results are shown in FIGS. 3-4, where FIG. 3 shows the scale: 50 μm; in FIG. 3, A is a cardiac ultrasound representation of a sham-operated mouse tail vein injected with AAV 9-Empty; b in figure 3 is a cardiac ultrasound representative diagram of a sham-operated mouse tail vein injection AAV9-shEGR 3; c in FIG. 3 is a cardiac ultrasound representative graph of mouse tail vein injection of AAV9-shEGR3 in a ischemia reperfusion injury model; d in FIG. 3 is a cardiac ultrasound representative graph of mouse tail vein injection of AAV9-shEGR3 in the ischemia reperfusion injury model; according to FIG. 1, it can be seen that the cardiac function of mice in the IRI group with myocardial ischemia-reperfusion injury was decreased and the mouse model was successfully constructed, as compared with the Sham group.

E in FIG. 4 is the statistics of left ventricular ejection fraction (EF,%) of mouse heart ultrasound, and from left to right are AAV9-Empty + Sham, AAV9-shEGR3+ Sham, AAV9-Empty + IRI and AAV9-shEGR3+ IRI treatment groups, respectively; f in FIG. 4 is the left ventricular short axis fractional shortening (FS,%) statistic of mouse heart ultrasound, and from left to right are AAV9-Empty + Sham, AAV9-shEGR3+ Sham, AAV9-Empty + IRI and AAV9-shEGR3+ IRI treatment groups, respectively. The left ventricular ejection fraction of the E mouse cardiac ultrasound in fig. 4 was 54.35%, 57.76%, 40.92%, 51.14% in sequence, and the left ventricular short axis shortening fraction of the F mouse cardiac ultrasound in fig. 4 was 27.64%, 29.70%, 19.52%, 25.58% in sequence, indicating that inhibition of EGR3 could improve the cardiac function of mice after ischemia reperfusion injury, with p < 0.001.

Test example 2

Example 2 after 4 weeks of treatment, experimental group mouse tissue RNA was extracted using the Trizol method and total RNA was reverse transcribed using the reventai First Strand cDNA Synthesis Kit (Thermo Scientific # K1622). Real-time by real-time in LightCycler480II (Roche) using iTaq Universal SYBR Green Supermix (Bio-Rad #1725121/-20 ℃)The cDNA was quantified by fluorescent quantitative polymerase chain reaction (qPCR). The relative expression level of EGR3 was detected using 18S as an internal reference. All qPCR reactions were 3 replicates and signals were collected at the end of each cycle. By 2^-ΔΔCtThe relative expression amount is calculated. The detection result is shown in a statistical chart in FIG. 5.

As can be seen from fig. 5, the relative expression amount of the mRNA of EGR3 in the heart tissue of the AAV9-shEGR3+ Sham group mice was reduced by 0.4 fold compared to the AAV9-Empty + Sham group, indicating that AAV9-shEGR3 effectively knocks off the mRNA expression of EGR3, indicating p < 0.01.

Test example 3

1.1. HE staining of mouse myocardial tissue: example 2 after the treatment was completed, the obtained mouse heart sample was fixed in a 4% paraformaldehyde solution, and then a paraffin sample of the heart tissue was prepared by dehydrating and embedding. Paraffin sections were cut, each 5 μm thick. Paraffin sample of mouse heart is first deparaffinized in xylene, then alcohol concentration is gradually decreased for hydration, and then slice is dyed by using HE dyeing kit (Kaiky Cat: KGA 224). The specific dyeing steps are as follows: firstly, 1 drop (50-100 mu L) of hematoxylin staining solution is dripped on a sample for staining for 5-10 minutes, and the staining solution is rinsed off by distilled water. Then 1 drop (50-100 mu L) of composite dye liquor is dripped to dye for 5 minutes, and the dye liquor is washed away. Then, one drop (50-100 mu L) of phosphomolybdic acid is added dropwise for dyeing for 1 minute, and the solution is dried by spinning or naturally dried. Finally, a drop (50-100 mu L) of brilliant green dye liquor is dripped to dye for 5 minutes, the dye liquor is washed off, and the mixture is put into an oven to be dried at 50-60 ℃ and sealed by neutral gum. The slides were observed and photographed under a microscope, and the cytoplasm of the myocardial tissue was red and the nucleus was purplish blue. Images were collected by NIS-ELements BR software and cardiomyocyte cross-sectional area was measured using ImageJ. The results are shown in fig. 6, scale: 50 μm.

FIG. 6A is a cross-sectional representation of the heart of a sham-operated mouse injected with AAV9-Empty via caudal vein; b is a cross-sectional representation diagram of the heart of a mouse subjected to mouse tail vein injection of AAV9-shEGR3 in a sham operation; c is a mouse heart cross-section representation picture of mouse tail vein injection AAV9-Empty under the ischemia reperfusion injury model; d is a mouse heart cross-section representation diagram of mouse tail vein injection AAV9-shEGR3 under the ischemia reperfusion injury model; e is the cell size system of the myocardial cross sectionThe result is shown in a graph from left to right, the result is respectively processed by AAV9-Empty + Sham, AAV9-shEGR3+ Sham, AAV9-Empty + IRI and AAV9-shEGR3+ IRI treatment groups, and the cross-sectional area of each group of myocardial cells is 401.0 mu m²，408.0μm²， 549.6μm²，461.4μm²It is shown that knocking down EGR3 can improve the size of the cross-sectional area of myocardial cells of mice with ischemia-reperfusion injury.

1.2. Wheat Germ Agglutinin (WGA) staining: example 2 at the end of the treatment, a transected sample of mouse heart tissue was placed in OCT complex and frozen at-80 ℃ for typing. Frozen sections of mouse heart tissue were prepared by a cryomicrotome and were subjected to WGA staining, which was performed by first rewarming the frozen sections for 15-30 minutes and washing 3 times with PBS buffer for 5 minutes each. Next, the cells were fixed with 4% paraformaldehyde for 15 minutes, and washed with PBS buffer 3 times for 5 minutes. The resulting mixture was incubated with WGA-FITC (sigma # L4895) in the dark for 30 minutes, and washed with PBS buffer. Finally, the cells were incubated with Hoechst (keygen # KGA212-1) dye solution for 30 minutes in the dark, washed with PBS buffer, and mounted with 50% glycerol in the dark. Images were collected by ZEN software and the cardiomyocyte cross-sectional area was measured using ImageJ, under a fluorescence microscope (CarLzeiss Microcopy GmbH) (Hoechst excitation wavelength 375nm, corresponding to an emission wavelength of 425nm, expressed in blue light; WGA-FITC excitation wavelength 485nm, emission wavelength 525nm, expressed in green light). The results are shown in fig. 7, scale: 50 μm.

FIG. 7A is a cross-sectional representation of the heart of a sham-operated mouse injected with AAV9-Empty via caudal vein; b is a cross-sectional representation diagram of the heart of a mouse subjected to mouse tail vein injection of AAV9-shEGR3 in a sham operation; c is a mouse heart cross-section representation picture of mouse tail vein injection AAV9-Empty under the ischemia reperfusion injury model; d is a cross-sectional representation of the heart of the mouse injected with AAV9-shEGR3 from the tail vein of the mouse under the ischemia reperfusion injury model, E is a cell size statistical result graph of the cross section of the cardiac muscle<0.01, represents p<0.001, in the figure 7, E from left to right are AAV9-Empty + Sham, AAV9-shEGR3+ Sham, AAV9-Empty + IRI and AAV9-shEGR3+ IRI treatment groups respectively, and the cross-sectional area of each group of myocardial cells is 423.4 mu m²，421.8μm²，563.8μm²，464.4μm²It is shown that knocking down EGR3 can improve the size of the cross-sectional area of myocardial cells of mice with ischemia-reperfusion injury.

1.3 dyeing of masson: example 2 after the treatment, a mouse heart sample was fixed in a paraformaldehyde solution with a mass concentration of 4%, and then a paraffin sample of heart tissue was prepared by dehydrating and embedding. Paraffin sections were cut, each 5 μm thick. The paraffin sample of the heart of the mouse is firstly put into dimethylbenzene for dewaxing, and then the ethanol concentration is gradually reduced for hydration. After washing with tap water for 15 minutes, the sections were stained with a Masson trichrome staining kit (Servicobio, Cat: G1006). The specific dyeing steps are as follows: first, the mixture is soaked in potassium dichromate (MassonA solution) overnight and washed with running water for 15 to 20 minutes. Then, the staining was performed with hematoxylin (Masson B fluid: Masson C fluid ═ 1:1), and the staining was performed for 5 to 10 minutes, followed by rinsing with running water. Then dyeing with ponceau acid reddish dye solution (Masson D solution) for 2-5 minutes, and washing with running water. Finally, differentiation was carried out with phosphomolybdic acid aqueous solution (Masson E solution) for 2 minutes, staining with aniline blue (Masson F solution) for 1 minute, and washing with running water. After the slide is naturally dried, the slide is sealed by neutral gum and a cover glass. The slides were observed and photographed under an upright microscope (NiKon ecLipse 80i) with blue collagen fibers, red cytoplasm of myocardial tissue and blue-black nucleus. Images were collected by NIS-ELements BR software and collagen fiber area and myocardial tissue area were calculated using ImageJ, and finally the percentage of collagen fiber area was calculated, the results are shown in fig. 8, scale bar: 50 μm.

A in figure 8 is a representation of mouse heart fibrosis in a sham-operated mouse injected with AAV9-Empty via tail vein; b is a representative diagram of mouse heart fibrosis of a sham-operated mouse by intravenous injection of AAV9-shEGR 3; c is a mouse heart fibrosis representation diagram of mouse tail vein injection AAV9-Empty under the ischemia reperfusion injury model; d is a mouse heart fibrosis representation diagram of mouse tail vein injection AAV9-shEGR3 under the ischemia reperfusion injury model; e is a statistical result graph of mouse heart fibrosis, in the graph, p is less than 0.001, AAV9-Empty + Sham, AAV9-shEGR3+ Sham, AAV9-Empty + IRI and AAV9-shEGR3+ IRI treatment groups are respectively arranged from left to right, the area percentages of the collagen fibers of each group are 0.2898%, 0.3202%, 10.22% and 5.455% in sequence, and the fact that the knocking down of EGR3 can improve the heart fibrosis of mice with ischemia-reperfusion injury is shown.

The reagent for knocking down or inhibiting EGR3 provided by the invention can improve the cardiac function after myocardial ischemia reperfusion, reduce cardiac fibrosis after myocardial ischemia reperfusion, improve myocardial cell hypertrophy after myocardial ischemia reperfusion, provide a new research and development approach of prevention and treatment drugs and drug action targets for diagnosis and treatment of myocardial ischemia reperfusion injury and/or heart failure, and has very important medicinal value.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> university at Shanghai

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aattcgccgg aactctctta ttcgagctct tctcgagaag agctcgaata agagagttcc 60

ggttttttg 69

<210> 2

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatccaaaaa accggaactc tcttattcga gctcttctcg agaagagctc gaataagaga 60

gttccggcg 69

<210> 3

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aattcgccgg aactctctta ttcgagctct tctcgagaag agctcgaata agagagttcc 60

ggttttttg 69

<210> 4

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatccaaaaa accggaactc tcttattcga gctcttctcg agaagagctc gaataagaga 60

gttccggcg 69

Claims

1. Application of an EGR3 knocking down or inhibiting agent in preparation of myocardial ischemia-reperfusion injury medicines.

2. The use according to claim 1, wherein the myocardial ischemia-reperfusion injury comprises ventricular pathologic remodeling and/or heart failure.

3. The use of claim 1, wherein the agent comprises an shRNA that knocks down the expression of EGR3 gene.

4. The use according to claim 3, wherein the shRNA has a plus-strand nucleotide sequence as shown in SEQ ID No.1 and a minus-strand nucleotide sequence as shown in SEQ ID No. 2.

5. The use of claim 1, wherein the agent comprises an EGR3 inhibitor.

6. The use of claim 5, wherein the active ingredient of an EGR3 inhibitor comprises AAV-shEGR 3.

7. The use of claim 1, wherein the medicament further comprises a pharmaceutically acceptable excipient.

8. The use according to claim 7, wherein the pharmaceutically acceptable excipient is selected from one or more of diluents, buffers, suspensions, emulsions, granules, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, colorants, flavors, and adsorptive carriers.

9. The medicine for treating myocardial ischemia-reperfusion injury is characterized in that the effective component of the medicine comprises an agent for knocking down or inhibiting EGR 3.

10. A kit for knocking down or inhibiting expression of EGR3 gene, comprising an agent for knocking down or inhibiting EGR 3.