CN114517209B - Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof - Google Patents

Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof Download PDF

Info

Publication number
CN114517209B
CN114517209B CN202210175382.6A CN202210175382A CN114517209B CN 114517209 B CN114517209 B CN 114517209B CN 202210175382 A CN202210175382 A CN 202210175382A CN 114517209 B CN114517209 B CN 114517209B
Authority
CN
China
Prior art keywords
circttc3
adeno
associated virus
expression
circular rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210175382.6A
Other languages
Chinese (zh)
Other versions
CN114517209A (en
Inventor
肖俊杰
王丽君
陈奕文
吴心盈
杨子江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Shanghai for Science and Technology
Original Assignee
University of Shanghai for Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Shanghai for Science and Technology filed Critical University of Shanghai for Science and Technology
Priority to CN202210175382.6A priority Critical patent/CN114517209B/en
Publication of CN114517209A publication Critical patent/CN114517209A/en
Application granted granted Critical
Publication of CN114517209B publication Critical patent/CN114517209B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/532—Closed or circular
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Analytical Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cardiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Vascular Medicine (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a circular RNAcircTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof, belonging to the technical field of biological medicine. The invention uses AAV9 virus vector to deliver circular RNA-circTTC3, which can be used for preparing medicaments for preventing and/or treating myocardial Ischemia Reperfusion Injury (IRI). The invention delivers the gene sequence capable of transcribing the annular RNA-circTTC3 into heart tissues based on AAV virus, and stably and highly expresses the gene sequence in heart tissues, and upregulates the circTTC3 to generate heart protection effect, thereby effectively reducing myocardial infarction area and protecting myocardial infarction. According to the invention, through over-expressing the circTTC3 in the primary myocardial cells of the newborn rats, the circTTC3 is found to be capable of remarkably promoting proliferation and growth of the primary myocardial cells of the newborn rats.

Description

Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof.
Background
Acute myocardial infarction is one of the main causes of mortality and disability in cardiovascular diseases. For patients with acute myocardial infarction, the post-myocardial ischemia reperfusion therapy commonly used clinically reduces the acute-phase death caused by myocardial infarction to a certain extent, but the myocardial damage caused by the myocardial infarction and the adverse promotion effect on ventricular remodeling seriously influence the prognosis of patients with myocardial infarction, and the process and the phenomenon are called myocardial ischemia reperfusion injury. Thus, studies effective against myocardial ischemia reperfusion injury have been receiving extensive attention. At present, the prevention and treatment of myocardial ischemia reperfusion injury is commonly performed by exogenously increasing myocardial oxygen and energy supply, reducing heart burden and energy consumption, but the curative effect is not obvious, and no ideal myocardial protection medicine is obtained clinically at present.
Circular RNAs are a recently discovered class of closed circular structural RNAs that do not have a 5 '-end cap and a 3' -end tail, which are present in large numbers within the cytoplasm of eukaryotic cells. The circular RNA has a plurality of important regulation and control functions, has conservation and tissue specificity in different species, is insensitive to the ribonucleic acid exonuclease and is more stable than the linear RNA, and the characteristics lead the circular RNA to have great potential for developing novel diagnosis and treatment methods of diseases and have great research significance. The prior art discloses that circular RNA Hectd1 (circHectd 1) and UCK2 (circUCK 2) can be used as potential therapeutic targets for cerebral ischemia reperfusion injury (PMID: 29938598,33230465), and circular RNA cWdr37 can be used as potential therapeutic targets for retinal ischemia reperfusion injury (PMID: 33771636).
However, there is currently no report on the diagnosis, prevention and treatment of myocardial ischemia reperfusion injury by circular RNA.
Disclosure of Invention
In view of the above, the present invention aims to provide a circular RNA circTTC3 over-expressed adeno-associated virus vector, adeno-associated virus and application thereof, and the circular RNA circTTC3 over-expressed adeno-associated virus vector of the present invention can be used for preparing diagnostic tools for diagnosing myocardial ischemia reperfusion injury and preparing medicines for preventing and/or treating myocardial ischemia reperfusion injury.
The invention provides a circular RNA circTTC3 over-expression adeno-associated virus vector, wherein the nucleotide sequence of the circular RNA circTTC3 is shown as SEQ ID NO. 1.
Preferably, the circular RNA circTTC3 over-expression adeno-associated virus vector comprises a primary vector and a coding gene of the circTTC3 inserted on the primary vector; the nucleotide sequence of the coding gene of the circTTC3 is shown as SEQ ID NO. 2.
Preferably, the expression control element of the coding gene of circTTC3 comprises a CMV promoter.
The invention also provides an adeno-associated virus packaged with the circular RNA circTTC3 over-expression adeno-associated virus vector.
Preferably, the adeno-associated virus is packaged from pAAV2/9, pDeltaF6 and the circular RNA circTTC3 over-expressed adeno-associated virus vector.
The invention also provides application of the circular RNA circTTC3 over-expression adeno-associated virus vector or adeno-associated virus in preparing medicaments for preventing and/or treating ischemia reperfusion injury.
Preferably, the ischemia reperfusion injury comprises myocardial ischemia reperfusion injury.
Preferably, the dosage form of the medicament comprises an injection.
The invention also provides application of the reagent for detecting the expression level of the annular RNA circTTC3 in preparing a diagnostic tool for diagnosing myocardial ischemia reperfusion injury.
Preferably, the reagent for detecting the expression level of the circular RNA circTTC3 comprises a primer group and a reagent for PCR detection; the primer group comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 3; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4.
The invention provides a circular RNA circTTC3 over-expression adeno-associated virus vector, wherein the nucleotide sequence of the circular RNA circTTC3 is shown as SEQ ID NO. 1. The invention utilizes AAV9 virus vector to deliver annular RNA circTTC3_007 (RNA circTTC3 for short) and can be used for preparing medicaments for preventing and/or treating myocardial Ischemia Reperfusion Injury (IRI). The AAV9 virus-based gene sequence of the transcribed circular RNA-circTTC3 can be delivered to heart tissues, and stable high expression is achieved in the heart tissues, the circTTC3 is upregulated to generate a heart protection effect, myocardial infarction area is effectively reduced, and accordingly myocardial infarction protection effect is achieved. According to the invention, through over-expressing the circTTC3 in the primary myocardial cells of the newborn rats, the circTTC3 is found to be capable of remarkably promoting proliferation and growth of the primary myocardial cells of the newborn rats. Furthermore, the circTTC3 can also reduce myocardial cell apoptosis induced by an oxygen glucose deprivation/complex glucose reoxygenation model (OGD/R), and in addition, AAV9-circTTC3 virus (the circTTC3 is overexpressed in heart tissue) is administered one week before a mouse myocardial ischemia reperfusion operation, so that myocardial infarction area caused by ischemia reperfusion can be remarkably reduced. It can be seen that the circular RNA circTTC3 over-expression adeno-associated virus vector can be used for preventing myocardial ischemia reperfusion injury.
Drawings
FIG. 1 shows that CircTTC3 has protective effects on myocardial ischemia/reperfusion injury in mice; wherein A-C are TTC staining to detect the acute myocardial ischemia/reperfusion post-operation infarct area of the mice, blue in the figure represents a safe area, and white is an infarct area; red + white represents ischemic areas, and the result shows that the circTTC3 can reduce myocardial infarction area, n= 8:9; d is qPCR detection of the expression level of the circTTC3 in the heart tissue of the mouse, and the result shows that the expression of the circTTC3 of the mouse injected with AAV9-circTTC3-OE virus is obviously increased, which indicates that the circTTC3 is excessively expressed in the heart tissue of the mouse in a successful manner; * Represents p <0.05, n=5; EV stands for empty, OE stands for over-expression;
fig. 2 shows that CircTTC3 is capable of promoting primary cardiomyocyte growth in neonatal rats in vitro, where n=4, denotes p <0.001, hoechst is a nuclear dye, with blue fluorescence, α -actinin is α -rhabdomyoactin, with red fluorescence, showing the morphology of whole cardiomyocytes;
FIG. 3 shows that CircTTC3 is capable of promoting proliferation of rat primary cardiomyocytes in vitro; wherein a and B represent Ki67 staining indicating that circTTC3 is able to promote proliferation of primary cardiomyocytes in neonatal rats in vitro, n=6; c and D represent EdU staining indicating that circTTC3 is able to promote proliferation of primary cardiomyocytes in neonatal rats in vitro, n=6, p <0.05, hoechst is a nuclear dye with blue fluorescence; alpha-actinin is alpha striated muscle actin, and has red fluorescence, and can display the form of the whole myocardial cell; both Ki67 and EdU were used to label proliferating cardiomyocytes;
FIG. 4 shows that CircTTC3 is resistant to OGD/R (oxygen deprivation/complex carbohydrate reoxygenation model) induced cardiomyocyte apoptosis, wherein A and B show Tunel staining indicates that CircTTC3 is resistant to OGD/R induced cardiomyocyte apoptosis; n=4, p <0.01, p <0.001, ogd/R for oxygen glucose deprivation/resumption treatment, control for Control, without oxygen glucose deprivation/resumption treatment;
FIG. 5 shows upregulation of circTTC3 expression in physiologically hypertrophic hearts and downregulation in myocardial ischemia reperfusion acute injury hearts; wherein, a is qPCR to detect the expression level of circTTC3 in heart tissue of a still mouse and a swimming mouse (physiological myocardial hypertrophy), and the result shows that the expression of circTTC3 in heart of the swimming mouse is significantly up-regulated, n=6, and the experimental result is shown in fig. 5A; b is qPCR detection of the expression level of circTTC3 in heart tissue of sham operated mice and myocardial ischemia reperfusion acute injury mice, and the result shows that the expression of circTTC3 in heart of myocardial ischemia reperfusion acute injury is significantly down-regulated, n=6; * P <0.01, p <0.001; sed stands for sitting group, swim stands for swimming group, sham stands for Sham surgery group, infarct (Infarct zone), border, remote respectively stands for heart tissue partitioned according to distance of ligation site after myocardial ischemia reperfusion surgery.
Detailed Description
The invention provides a circular RNA circTTC3 over-expression adeno-associated virus vector, wherein the nucleotide sequence of the circular RNA circTTC3 is shown as SEQ ID NO.1, and the circular RNA circTTC3 is specifically as follows: 5'-gactgtgcagcatggatgactttgctgagggaggtctcagtttggcagatgatatcttactggaagattacccttat gaggatgactgtatctgtactcctgactttaccactgacgattatgttcgagtaacccagctttactatgaaggcgtgggtatgcaatataaagattatgcccaaagtgagaaaaatttagaatatgacatctgcaatatctggtgcagtaagccactctccatcctgcaagattactgtgatgccattaagctgtacatcttctggccacttctttttcaacatcaacacagttctataatatcaagattgcacccctgtgtagaagccatccgttctcgtgctgctgagataagtttgaagaaattacaacatcttgagttgatggaagacattgtggatttggcaaagaaagttgcaaatgattcattccttattgaaggcttattgaaaattggttataaaatagaaaataaaatcttggcaatggaagatgctttaaattggataaaatacacgggtgatgtaacaattctacctaaattaggatcagttgacaattgctggcccatgctaagtattttctttactgaatataagtaccatattactagagttgtaactgaaaattgcaacttgctagaagaatttagaaggcatagttgcatgcagtgtgtgaagcaaggagaactcatgaaaatgagaggaaatgaagagttctcaaaggaaaagtttgaaatagctgttatttattacaccagagccattgaatatagacctgaaaaccatcttctttatggtaaccgagctctctgttttcttcgtatggggcagtttagaaatgcacttagcgatggaaagagggccattgttttgaagaacacctggccaaag-3'.
The circular RNA circTTC3 over-expression adeno-associated virus vector is named as follows: pAAV-CMV-circTTC3.
In the invention, the position information of the circTTC3 on the chromosome is |Chr16:943839412_94403368_ +. In the present invention, the circTTC3 is highly conserved across different species; such species include humans, mice and rats.
In the present invention, the circular RNA circTTC3 overexpressing adeno-associated viral vector preferably comprises a primary vector and a coding gene for circTTC3 inserted on the primary vector; the nucleotide sequence of the coding gene of the circTTC3 is shown as SEQ ID NO.2, and specifically comprises the following steps:
5'-gactgtgcagcatggatgactttgctgagggaggtctcagtttggcagatgatatcttactggaagattacccttatgaggatgactgtatctgtactcctgactttaccactgacgattatgttcgagtaacccagctttactatgaaggcgtgggtatgcaatataaagattatgcccaaagtgagaaaaatttagaatatgacatctgcaatatctggtgcagtaagccactctccatcctgcaagattactgtgatgccattaagctgtacatcttctggccacttctttttcaacatcaacacagttctataatatcaagattgcacccctgtgtagaagccatccgttctcgtgctgctgagataagtttgaagaaattacaacatcttgagttgatggaagacattgtggatttggcaaagaaagttgcaaatgattcattccttattgaaggcttattgaaaattggttataaaatagaaaataaaatcttggcaatggaagatgctttaaattggataaaatacacgggtgatgtaacaattctacctaaattaggatcagttgacaattgctggcccatgctaagtattttctttactgaatataagtaccatattactagagttgtaactgaaaattgcaacttgctagaagaatttagaaggcatagttgcatgcagtgtgtgaagcaaggagaactcatgaaaatgagaggaaatgaagagttctcaaaggaaaagtttgaaatagctgttatttattacaccagagccattgaatatagacctgaaaaccatcttctttatggtaaccgagctctctgttttcttcgtatggggcagtttagaaatgcacttagcgatggaaagagggccattgttttgaagaacacctggccaaag-3'。
in the present invention, the expression control element of the coding gene of circTTC3 preferably includes a CMV promoter. The CMV promoter is a strong promoter for promoting eukaryotic gene expression, and can make the target gene be highly expressed in heart tissue.
In the present invention, the original vector preferably includes an AAV9 viral vector. AAV9 viral vectors have high affinity for heart tissue and allow the virus to reach heart tissue to the greatest extent.
The invention also provides an adeno-associated virus packaged with the circular RNA circTTC3 over-expression adeno-associated virus vector.
In the present invention, the adeno-associated virus is preferably packaged from pAAV2/9, pDeltaF6 and the circular RNA circTTC3 overexpressing adeno-associated virus vector.
In the present invention, the packaging cells used for the packaging preferably comprise 293T cells.
In the present invention, the packaged system is preferably 1mL, including 10. Mu.g pAAV2/9, 10. Mu.g pDeltaF6, 10. Mu.g pAAV-CMV-circTTC3, 90. Mu.L PEI (Polyscience), and DMEM to 1mL.
The method of the present invention is not particularly limited, and conventional methods in the art may be employed.
The invention also provides application of the circular RNA circTTC3 over-expression adeno-associated virus vector or adeno-associated virus in preparing medicaments for preventing and/or treating ischemia reperfusion injury.
In the present invention, the ischemia reperfusion injury preferably includes myocardial ischemia reperfusion injury; the myocardial ischemia reperfusion injury includes acute myocardial ischemia reperfusion injury or chronic myocardial ischemia reperfusion injury.
In the present invention, the prevention and/or treatment of myocardial ischemia reperfusion injury preferably comprises one or more of the following:
1) Reducing myocardial infarction area;
2) Reduce myocardial apoptosis;
3) Promote proliferation and/or growth of primary cardiomyocytes.
In the present invention, the myocardial ischemia reperfusion injury preferably comprises myocardial ischemia reperfusion injury induced by an oxygen glucose deprivation/complex carbohydrate reoxygenation model.
In the present invention, the dosage form of the drug preferably includes an injection. In the present invention, the administration mode of the drug preferably includes intravenous injection or tissue in-situ injection, by which the drug is delivered to the heart along with blood circulation; when used to treat myocardial ischemia reperfusion injury, the tissue in situ injection preferably comprises cardiac tissue in situ injection; in the present invention, the drug is preferably administered in a dose of 100. Mu.L/time/mouse.
In the present invention, the titer of the adeno-associated virus in the medicament is preferably 0.8X10 13 ～2.2×10 13 vg/mL。
In the invention, by up-regulating the expression level of the circTTC3 in myocardial cells or tissues, a certain protection effect on myocardial ischemia reperfusion injury is achieved.
The invention also provides application of the reagent for detecting the expression level of the annular RNA circTTC3 in preparing a diagnostic tool for diagnosing myocardial ischemia reperfusion injury.
In the invention, the reagent for detecting the expression level of the circular RNA circTTC3 comprises a primer group and a reagent for PCR detection; the primer group comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3, and specifically comprises the following components: 5'-ACTTAGCGATGGAAAGAGGGC-3'; the nucleotide sequence of the downstream primer is shown as SEQ ID NO.4, and specifically comprises the following steps: 5'-TATATTGCATACCCACGCCTTCA-3'.
In the present invention, the reagent for detecting the expression level of circular RNA circTTC3 preferably further comprises a probe; the nucleotide sequence of the probe is shown as SEQ ID NO.5, and specifically comprises the following steps: 5'-aaaCCATGGTGCACAAGTCTTTGGCCAAGTGTT-3'.
In the present invention, the diagnostic tool preferably comprises one or more of a reagent, a kit, a chip, a test paper and a high throughput sequencing platform; the chip preferably comprises a solid support and probes immobilized on the solid support; the test paper comprises the primer group and the probe according to the scheme; the high throughput sequencing platform comprises the primer set and the probe according to the scheme.
In the present invention, the expression of circTTC3 is significantly up-regulated in physiological myocardial hypertrophy, whereas the significantly down-regulated expression of circTTC3 in myocardial ischemia reperfusion acute injury model suggests that circTTC3 has a protective effect on heart, and its expression in diseases is lower than healthy state, and thus can be used for diagnosis of diseases. Diagnosing whether the disease state is present by detecting the expression of circTTC3 in the tissue.
The technical solutions of the present invention will be clearly and completely described in the following in connection with the embodiments of the present invention.
Example 1
1. Mouse myocardial ischemia reperfusion injury model
Mice were anesthetized by intraperitoneal injection with 1mg/10g of sodium pentobarbital. Removing hair with depilatory cream. Mice were fixed on a 37 ℃ heat preservation pad. An incision was made along the trachea, and the muscles and tissues covering the trachea were carefully separated, exposing the trachea. And (3) inserting an endotracheal tube between the subglottic tracheal cartilages for fixation. The assisted respiration rate was 120 times/min and the tidal volume was 2mL. Approximately 1cm of a straight incision is made at the armpit of about 0.5cm, and the skin, pectoral muscle and intercostal muscle are incised layer by layer. And a blunt elbow ophthalmic forceps is inserted between the third rib and the fourth rib, and the heart is exposed by blunt intercostal muscles. The left atrial appendage to apex line was tied with a low elastic 7-0 suture at about 1/3 of the point and the point below the tie was whitened to the apex indicating successful left anterior descending coronary artery ligation. The time was 30min, and the hemostatic clip was used to clamp the chest skin and temporarily close the chest. The chest was opened again before the end of the timing, ensuring that the ligature was untwisted within 30s after the end of the timing. The 4-0 suture lines stitch the rib and pectoral muscle and skin layer by layer. After the tail of the mouse is reflected and recovered slightly, the tracheal cannula is removed, the leaked tracheal secretion is sucked by sterile gauze, and the tracheal incision is not sutured. And removing the medical adhesive tape, continuously placing the mice on the heat preservation pad, and placing the mice back into the rearing cage with the new padding after the mice recover. The left anterior descending branch of the coronary artery is not ligated after the thoracic opening of the sham operation group, and the rest steps are the same as the operation group.
TTC staining
The hearts were rinsed rapidly in three passes of 1 XPBS, blotted dry, and frozen at-20℃for 20min, and subsequently cut into 1mm flakes on a die with a sharp knife. The heart sheet was placed in a 2mL EP tube, 1mL of 1% TTC solution was added, and the mixture was water-bath at 37℃for 10min. The sections were then placed in new EP tubes, 1mL of 4% PFA solution was added, and the mixture was fixed for 1h. After fixing, the sections were removed, blotted dry and weighed. And after the fixation is started, the fixation is observed under a body type mirror for 4 hours, and photographing is carried out to prevent fading. The white part after dyeing is a infarct area, the pure red part is an ischemic area, the two parts are combined to form a dangerous area, and the deep blue colored area is an uninfluenced area. The images were analyzed with Image J. The image area is uniformly weighted by the slice weight.
3. Culture of primary cardiomyocytes NRCM of neonatal rat for verification of circTTC3 function and 293T cells for packaging AAV9 virus.
NRCM cells and 293T cells were selected from DMEM complete medium containing 10% fbs,1% penicillin-streptomycin solution. The cell culture environment contains 5% CO 2 A constant temperature incubator at 37 ℃ with saturated humidity.
AAV9-circTTC3 virus is packaged by pAAV2/9, pDeltaF6 and pAAV-CMV-circTTC3 three-plasmid virus packaging system, and the packaging cell is 293T cell. The specific packaging method comprises the following steps: 293T cells of a 10cm dish were prepared, and after cells were attached for 20 to 24 hours, the cells were transfected with PEI (Polyscience), and the transfection system of the 293T cells of each 10cm dish was 1mL of a mixture (10. Mu.g pAAV2/9, 10. Mu.g pDeltaF6, 10. Mu.g pAAV-CMV-circTTC3, 90. Mu.L PEI, DMEM to 910. Mu.L), and after the mixture was prepared, the mixture was homogenized by shaking, allowed to stand at room temperature for 15 minutes, and then added to the dish. After 9-10 h of transfection, the liquid is changed, and the culture medium is changed to a new complete culture medium. After 60 hours of co-transformation of the three plasmids in 293T cells, the cells and their supernatants were collected. Wherein the supernatant was concentrated to 10-15 mL (centrifugation conditions 4000rpm 4 ℃) by centrifugation on a concentration column (Merck UFC 905096), and the cells were re-spun with 3mL of cell lysis buffer (150mM NaCl,20mM tris pH8.0, sterilized water) and repeatedly freeze-thawed three times in an alcohol bath at-80℃and a water bath at 37 ℃. Mixing concentrated supernatant and freeze-thawing cell suspension, adding 1M MgCl 2 The final concentration was 1mM. And Benzonase (Merck, 70746-10 kU) was added to a final concentration of 25U/mL. Mixing, and water-bathing at 37deg.C for 40min. The supernatant was then centrifuged at 4000rpm at 4℃for 30 min. The obtained supernatant is densified with iodixanolGradient centrifugation (iodixanol gradient is configured as follows, 3.5mL of 60%, 3.5mL of 40%, 4mL of 25%, 4mL of 17% iodixanol are slowly added into a centrifuge tube from bottom to top, concentrated supernatant after centrifugation and cell lysate are slowly added into the uppermost layer of the centrifuge tube), centrifugation is performed for 2h at 60000rpm and 4 ℃, and the rotor 70Ti accelerates by 6 and decelerates by 9. The model of the centrifuge is Beckman OPTIMAL-80XP. After centrifugation, 40% concentration iodixanol layer was transferred to a concentration column, and the mixture was added to 10mL PBS 4000rpm 4 ℃and centrifuged for 20 minutes, and the mixture was repeated 3 times. The virus was concentrated to 500. Mu.L by centrifugation. Extracting genome with 5 μl of virus solution using kit (radix Rhizomatis), and performing fluorescent quantitative PCR with 2 μl of genome DNA (10 μl of SYBR,2 μl of cDNA template, 0.2 μl of forward primer, 0.2 μl of backward primer, 2.6 μ L H) 2 O) the reaction procedure was 95℃for 5min,95℃for 15s,57℃for 30s,72℃for 30s,95℃for 15s,60℃for 60s. Wherein the forward primer sequence is 5'-AAGTACGCCCCCTATTGACG-3' (SEQ ID NO. 6); the reverse primer sequence was 5'-CACGCCCATTGATGTACTGC-3' (SEQ ID NO. 7). Viral titers were calculated from the ct values obtained by quantitative PCR. The calculation formula is as follows:
iodixanol gradient configuration:
17% = 5mL 10x phosphate buffer, 0.05mL 1m magnesium chloride, 0.125mL 1m potassium chloride, 10mL 5m sodium chloride, 12.5mL iodixanol, sterile water to a volume of 50mL.
25% = 5mL 10x phosphate buffer, 0.05mL 1m magnesium chloride, 0.125mL 1m potassium chloride, 20mL iodixanol, 0.1mL 0.5% phenol red, sterile water to a volume of 50mL.
40% = 5mL 10x phosphate buffer, 0.05mL 1m magnesium chloride, 0.125mL 1m potassium chloride, 33.3mL iodixanol, sterile water to a volume of 50mL.
60% = 0.05mL 1m magnesium chloride, 0.125mL 1m potassium chloride, 50mL iodixanol, 0.025mL 0.5% phenol red.
In the present invention the drug is a viral suspension of AAV9-circTTC3 having activity. The virus suspensionTiter is 2.2 x 10 13 vg/mL, administered by tail vein injection at a dose of 100 μl per mouse.
RNA extraction
Total RNA in cells or tissues was extracted using RNAiso Plus (Takara), reverse transcription of mRNA was performed using Oligo (dT) and Random Hexamer as primers, and the expression levels of the common genes mRNA and circTTC3 were detected by performing a real-time fluorescent quantitative PCR experiment using specific primers. The fluorescent quantitative PCR reaction system was 10. Mu.L (5. Mu.L SYBR, 2. Mu.L cDNA template, 0.4. Mu.L forward primer, 0.4. Mu.L backward primer, 2.2. Mu. L H) 2 O), the reaction procedure was 95℃for 5min,95℃for 15s,57℃for 30s,72℃for 30s,95℃for 15s,60℃for 60s. Wherein the forward primer sequence is: 5'-ACTTAGCGATGGAAAGAGGGC-3' (SEQ ID NO. 3) and the reverse primer sequence 5'-TATATTGCATACCCACGCCTTCA-3' (SEQ ID NO. 4). Relative quantification is carried out by fluorescent quantitative PCR through an internal reference method, and 2 is selected as a calculation method -ΔΔCt A method of manufacturing the same. The relative expression level of circTTC3 can be judged according to the calculation result. The experimental results are shown in FIG. 1D, and compared with the control group, the expression level of the circTTC3 of the mice injected with AAV9-circTTC3-OE virus is obviously increased.
AAV vector delivery circTTC3 targeting
The target gene fragment capable of expressing circTTC3 is delivered into myocardial cells through AAV virus, and RNA is extracted from heart tissue, and the extraction method is the extraction method of example 4-RNA. The expression of circTTC3 was then detected using a fluorescent quantitative PCR method. The fluorescent quantitative PCR method reaction system and conditions and the calculation method are shown in the step 4-RNA extraction.
6. Tail intravenous injection of AAV9-circTTC3 virus
Integration of the fragment capable of synthesizing circTTC3 into AAV vector, packaging with the aid of AAV9 capsid plasmid and Helper plasmid to obtain AAV9 virus, separating and purifying, determining AAV9 virus titer, and administering the virus at 0.8x10 by tail vein injection 12 VG/dose was injected into the heart and samples were taken 24 hours later to detect myocardial infarction in mice. The detection method is TTC staining analysis, and the experimental result is shown in figure 1. The results indicate that circTTC3 is able to reduce myocardial infarction area.
Example 2
1. Primary rat cardiomyocyte isolation and culture
The chest of the newborn rat was sterilized with 75% alcohol, the heart of the rat was removed under aseptic conditions, the ventricular tissue was dissected and isolated, the ventricular tissue was placed in ice 1 XDDS buffer (1L 10 XDS buffer preparation: 68g sodium chloride, 47.6g 4-hydroxyethyl piperazine ethane sulfonic acid, 1.38g sodium dihydrogen phosphate, 6g glucose, 4g potassium chloride, 2.05g magnesium sulfate, sterilized water to 1L) and rinsed, the tissue was minced in a sterile glass bottle, and 20mL pancreatin collagenase digest was added for digestion. Placing the digestion bottle into a shaking table (37 ℃ C., 90-120 rpm), digesting for 10 minutes each time, transferring the cell suspension into a 50mL centrifuge tube, adding 1/5 volume horse serum to stop digestion, centrifuging for 5 minutes at 1,000rmp, discarding cell supernatant, re-suspending, repeating the above digestion steps until flocculent, filtering by a filter screen, spreading onto a cell culture dish, gently shaking, placing into a cell culture box for differential adherence for 30-60 minutes, collecting non-adherent cells, and centrifuging by a density gradient to obtain rat myocardial cells. Cell counts were plated and cultured in cardiomyocyte medium (500 mL dmem+25mL fetal bovine serum+50 mL horse serum+5 mL penicillin mix).
2. Immunofluorescent alpha-actinin staining
Removing the culture medium after the cell experiment is finished, and cleaning by using phosphate buffer solution; 4% paraformaldehyde, incubating for 20min at normal temperature, and cleaning with phosphate buffer; membrane rupture of 0.5% triton X-100 at room temperature for 20min, and washing with phosphate buffer; blocking the 5% bovine serum albumin solution for 1h at room temperature; incubation of primary antibody alpha-Actinin (1:200), and overnight at 4 ℃; recovering primary antibody, and cleaning with phosphate buffer solution; the secondary antibody CY3 (1:200) is incubated for 2h at room temperature in a dark place, DAPI (1:2000) is washed by phosphate buffer solution, and the secondary antibody is incubated for 20min at room temperature, and the phosphate buffer solution is washed. And (5) photographing by a fluorescence microscope and carrying out statistical analysis. The experimental results are shown in FIG. 2.
Example 3
1. Primary rat cardiomyocyte isolation and culture
The chest of the newborn rat was sterilized with 75% alcohol, the heart of the rat was removed under aseptic conditions, the ventricular tissue was dissected and isolated, the ventricular tissue was placed in ice 1 XDDS buffer (1L 10 XDS buffer preparation: 68g sodium chloride, 47.6g 4-hydroxyethyl piperazine ethane sulfonic acid, 1.38g sodium dihydrogen phosphate, 6g glucose, 4g potassium chloride, 2.05g magnesium sulfate, sterilized water to 1L) and rinsed, the tissue was minced in a sterile glass bottle, and 20mL pancreatin collagenase digest was added for digestion. Placing the digestion bottle into a shaking table (37 ℃ C., 90-120 rpm), digesting for 10 minutes each time, transferring the cell suspension into a 50mL centrifuge tube, adding 1/5 volume of horse serum to stop digestion, centrifuging for 5 minutes at 1,000rmp, discarding cell supernatant, re-suspending, repeating the above digestion steps until flocculent, filtering by a filter screen, spreading the flocculent on a cell culture dish, gently shaking the flocculent, placing the flocculent on a cell culture dish, placing the flocculent on the cell culture dish, placing the flocculent on a differential wall of a cell culture box for 30-60 minutes, collecting non-adherent cells, and centrifuging by a density gradient to obtain rat myocardial cells. Cell counts were plated and cultured in cardiomyocyte medium (500 mL dmem+25mL fetal bovine serum+50 mL horse serum+5 mL penicillin mix).
2. Immunofluorescence alpha-actinin and ki67 staining
Removing the culture medium after the cell experiment is finished, and cleaning by using phosphate buffer solution; 4% paraformaldehyde, incubating for 20min at normal temperature, and cleaning with phosphate buffer; membrane rupture of 0.5% triton X-100 at room temperature for 20min, and washing with phosphate buffer; blocking the 5% bovine serum albumin solution for 1h at room temperature; co-incubating a primary antibody, alpha-Actinin (1:200) and ki67 (1:200), at 4 ℃ overnight; recovering primary antibody, and cleaning with phosphate buffer solution; incubating the secondary antibody CY3 (1:200) and 488 rabbit secondary antibody (1:200) for 2h at room temperature in a dark place, and washing with phosphate buffer; DAPI (1:2000) was incubated at room temperature for 20min and washed with phosphate buffer. And (5) photographing by a fluorescence microscope and carrying out statistical analysis. The experimental results are shown in FIG. 3A.
3. Immunofluorescent alpha-actinin and EdU staining
Adding EdUA solution (1:1000) into the cell culture solution 24h before the cell experiment is finished, removing the culture medium after the cell experiment is finished, and cleaning with phosphate buffer solution; 4% paraformaldehyde, incubating for 20min at normal temperature, and cleaning with phosphate buffer; membrane rupture of 0.5% triton X-100 at room temperature for 20min, and washing with phosphate buffer; blocking the 5% bovine serum albumin solution for 1h at room temperature; incubation of primary antibody alpha-Actinin (1:200), and overnight at 4 ℃; recovering primary antibody, and cleaning with phosphate buffer solution; incubating the secondary antibody CY3 (1:200) for 2h at room temperature in a dark place, and washing with a phosphate buffer solution; incubating the EdU staining working solution for 40min, and cleaning the solution by using a phosphate buffer; DAPI (1:2000) was incubated at room temperature for 20min and washed with phosphate buffer. And (5) photographing by a fluorescence microscope and carrying out statistical analysis. The experimental results are shown in FIG. 3B.
Example 4
1. Isolation and culture of primary neonatal rat cardiomyocytes
The chest of the newborn rat was sterilized with 75% alcohol, the heart of the rat was removed under aseptic conditions, the ventricular tissue was dissected and isolated, the ventricular tissue was placed in ice 1 XDDS buffer (1L 10 XDS buffer preparation: 68g sodium chloride, 47.6g 4-hydroxyethyl piperazine ethane sulfonic acid, 1.38g sodium dihydrogen phosphate, 6g glucose, 4g potassium chloride, 2.05g magnesium sulfate, sterilized water to 1L) and rinsed, the tissue was minced in a sterile glass bottle, and 20mL pancreatin collagenase digest was added for digestion. Placing the digestion bottle into a shaking table (37 ℃ C., 90-120 rpm), digesting for 10 minutes each time, transferring the cell suspension into a 50mL centrifuge tube, adding 1/5 volume of horse serum to stop digestion, centrifuging for 5 minutes at 1,000rmp, discarding cell supernatant, re-suspending, repeating the digestion steps until flocculent, filtering by a filter screen, spreading the flocculent on a cell culture dish, gently shaking the flocculent, placing the flocculent on the cell culture dish, placing the flocculent on a differential wall of a cell culture box for 30-60 minutes, collecting non-adherent cells, and centrifuging by a density gradient to obtain the myocardial cells of the rat. Cell counts were plated and cultured in cardiomyocyte medium (500 mL dmem+25mL fetal bovine serum+50 mL horse serum+5 mL penicillin mix).
2. Myocardial cell OGD/R model
Changing the culture medium of cardiomyocyte to sugar-free DMEM culture medium, placing the cell culture plate in an anaerobic box (an anaerobic bag is placed in one anaerobic box, and air in the anaerobic box is exhausted as much as possible with sterile filler), and placing at 37deg.C and 5% CO 2 Culturing in an incubator for 8 hours. Then the cell culture plate is taken out from the anaerobic box, the operation of reoxygenation is carried out, and the sugar-free DMEM culture medium is replaced by the normal myocardial cell culture medium for culture at 37 ℃ and 5 percent CO 2 Culturing in an incubator for 12h. And (5) collecting cells.
3. Immunofluorescent alpha-actininh and Tunel staining
Removing the culture medium after the cell experiment is finished, and cleaning by using phosphate buffer solution; 4% paraformaldehyde, incubating for 20min at normal temperature, and cleaning with phosphate buffer; membrane rupture of 0.5% triton X-100 at room temperature for 20min, and washing with phosphate buffer; blocking the 5% bovine serum albumin solution for 1h at room temperature; incubation of primary antibody alpha-Actinin (1:200), and overnight at 4 ℃; recovering primary antibody, and cleaning with phosphate buffer solution; incubating the secondary antibody CY3 (1:200) for 2h at room temperature in a dark place, and washing with a phosphate buffer solution; incubating for 30min at room temperature with 1 Xequilibration solution (Novain, K250-100), rinsing with phosphate buffer, adding TUNEL staining working solution (Novain, K250-100), incubating at 37deg.C in the absence of light for 1h, and rinsing with phosphate buffer; DAPI (1:2000) was incubated at room temperature for 20min and washed with phosphate buffer. And (5) photographing by a fluorescence microscope and carrying out statistical analysis. The experimental results are shown in FIG. 4.
Example 5
RNA extraction
Total RNA in cells or tissues was extracted using RNAiso Plus (Takara), reverse transcription of mRNA was performed using Oligo (dT) and Random Hexamer as primers, and the expression levels of the common genes mRNA and circTTC3 were detected by performing a real-time fluorescent quantitative PCR experiment using specific primers. The fluorescent quantitative PCR reaction system was 10. Mu.L (5. Mu.L SYBR, 2. Mu.L cDNA template, 0.4. Mu.L forward primer, 0.4. Mu.L backward primer, 2.2. Mu. L H) 2 O), the reaction procedure was 95℃for 5min,95℃for 15s,57℃for 30s,72℃for 30s,95℃for 15s,60℃for 60s. Wherein the forward primer sequence is: 5'-ACTTAGCGATGGAAAGAGGGC-3' (SEQ ID NO. 3) and the reverse primer sequence 5'-TATATTGCATACCCACGCCTTCA-3' (SEQ ID NO. 4). The fluorescence quantitative PCR is relatively quantified by an internal reference method, and a 2-delta Ct method is selected by a calculation method. The relative expression level of circTTC3 can be judged according to the calculation result. The experimental results are shown in A and B of FIG. 5, and the expression level of the mouse circTTC3 injected with AAV9-circTTC3-OE virus is significantly increased compared with the control group.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, according to which one can obtain other embodiments without inventiveness, these embodiments are all within the scope of the invention.
Sequence listing
<110> Shanghai university
<120> circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 911
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gactgtgcag catggatgac tttgctgagg gaggtctcag tttggcagat gatatcttac 60
tggaagatta cccttatgag gatgactgta tctgtactcc tgactttacc actgacgatt 120
atgttcgagt aacccagctt tactatgaag gcgtgggtat gcaatataaa gattatgccc 180
aaagtgagaa aaatttagaa tatgacatct gcaatatctg gtgcagtaag ccactctcca 240
tcctgcaaga ttactgtgat gccattaagc tgtacatctt ctggccactt ctttttcaac 300
atcaacacag ttctataata tcaagattgc acccctgtgt agaagccatc cgttctcgtg 360
ctgctgagat aagtttgaag aaattacaac atcttgagtt gatggaagac attgtggatt 420
tggcaaagaa agttgcaaat gattcattcc ttattgaagg cttattgaaa attggttata 480
aaatagaaaa taaaatcttg gcaatggaag atgctttaaa ttggataaaa tacacgggtg 540
atgtaacaat tctacctaaa ttaggatcag ttgacaattg ctggcccatg ctaagtattt 600
tctttactga atataagtac catattacta gagttgtaac tgaaaattgc aacttgctag 660
aagaatttag aaggcatagt tgcatgcagt gtgtgaagca aggagaactc atgaaaatga 720
gaggaaatga agagttctca aaggaaaagt ttgaaatagc tgttatttat tacaccagag 780
ccattgaata tagacctgaa aaccatcttc tttatggtaa ccgagctctc tgttttcttc 840
gtatggggca gtttagaaat gcacttagcg atggaaagag ggccattgtt ttgaagaaca 900
cctggccaaa g 911
<210> 2
<211> 911
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gactgtgcag catggatgac tttgctgagg gaggtctcag tttggcagat gatatcttac 60
tggaagatta cccttatgag gatgactgta tctgtactcc tgactttacc actgacgatt 120
atgttcgagt aacccagctt tactatgaag gcgtgggtat gcaatataaa gattatgccc 180
aaagtgagaa aaatttagaa tatgacatct gcaatatctg gtgcagtaag ccactctcca 240
tcctgcaaga ttactgtgat gccattaagc tgtacatctt ctggccactt ctttttcaac 300
atcaacacag ttctataata tcaagattgc acccctgtgt agaagccatc cgttctcgtg 360
ctgctgagat aagtttgaag aaattacaac atcttgagtt gatggaagac attgtggatt 420
tggcaaagaa agttgcaaat gattcattcc ttattgaagg cttattgaaa attggttata 480
aaatagaaaa taaaatcttg gcaatggaag atgctttaaa ttggataaaa tacacgggtg 540
atgtaacaat tctacctaaa ttaggatcag ttgacaattg ctggcccatg ctaagtattt 600
tctttactga atataagtac catattacta gagttgtaac tgaaaattgc aacttgctag 660
aagaatttag aaggcatagt tgcatgcagt gtgtgaagca aggagaactc atgaaaatga 720
gaggaaatga agagttctca aaggaaaagt ttgaaatagc tgttatttat tacaccagag 780
ccattgaata tagacctgaa aaccatcttc tttatggtaa ccgagctctc tgttttcttc 840
gtatggggca gtttagaaat gcacttagcg atggaaagag ggccattgtt ttgaagaaca 900
cctggccaaa g 911
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
acttagcgat ggaaagaggg c 21
<210> 4
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
tatattgcat acccacgcct tca 23
<210> 5
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
aaaccatggt gcacaagtct ttggccaagt gtt 33
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aagtacgccc cctattgacg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cacgcccatt gatgtactgc 20

Claims (9)

1. The nucleotide sequence of the circular RNA circTTC3 is shown as SEQ ID NO. 1.
2. The circular RNA circTTC3 overexpressing adeno-associated viral vector of claim 1, wherein the circular RNA circTTC3 overexpressing adeno-associated viral vector comprises a primary vector and a gene encoding circTTC3 inserted on the primary vector; the nucleotide sequence of the coding gene of the circTTC3 is shown as SEQ ID NO. 2.
3. The circular RNA circTTC3 over-expression adeno-associated virus vector according to claim 2,
the expression control element of the coding gene of the circTTC3 comprises a CMV promoter.
4. An adeno-associated virus packaged with the circular RNA circTTC 3-overexpressing adeno-associated virus vector of any one of claims 1-3.
5. The adeno-associated virus of claim 4, wherein the adeno-associated virus is packaged from a pAAV2/9, pdelta f6, and the circular RNA circTTC3 overexpressing adeno-associated virus vector.
6. Use of the circular RNA circTTC3 over-expression adeno-associated virus vector of any one of claims 1-3 or the adeno-associated virus of claim 4 or 5 in the preparation of a medicament for preventing and/or treating ischemia reperfusion injury;
the ischemia reperfusion injury is myocardial ischemia reperfusion injury.
7. The use according to claim 6, wherein the medicament is in the form of an injection.
8. The application of the reagent for detecting the expression quantity of the annular RNA circTTC3 in preparing a diagnostic tool for diagnosing myocardial ischemia reperfusion injury is provided, wherein the nucleotide sequence of the annular RNA circTTC3 is shown as SEQ ID NO. 1.
9. The use according to claim 8, wherein the reagent for detecting the expression level of cyclic RNAcircTTC3 comprises a primer set; the primer group comprises an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 3; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4.
CN202210175382.6A 2022-02-25 2022-02-25 Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof Active CN114517209B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210175382.6A CN114517209B (en) 2022-02-25 2022-02-25 Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210175382.6A CN114517209B (en) 2022-02-25 2022-02-25 Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof

Publications (2)

Publication Number Publication Date
CN114517209A CN114517209A (en) 2022-05-20
CN114517209B true CN114517209B (en) 2023-09-15

Family

ID=81598428

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210175382.6A Active CN114517209B (en) 2022-02-25 2022-02-25 Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof

Country Status (1)

Country Link
CN (1) CN114517209B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106222173A (en) * 2016-08-12 2016-12-14 青岛大学 CircRNA MNCR nucleotide, medical composition and its use containing this nucleotide
CN113234811A (en) * 2021-05-10 2021-08-10 青岛大学附属医院 Application of CircRNA000338 and medicine thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106222173A (en) * 2016-08-12 2016-12-14 青岛大学 CircRNA MNCR nucleotide, medical composition and its use containing this nucleotide
CN113234811A (en) * 2021-05-10 2021-08-10 青岛大学附属医院 Application of CircRNA000338 and medicine thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Circular RNA Ttc3 regulates cardiac function after myocardial infarction by sponging miR-15b;Lidong Cai等;《Journal of Molecular and Cellular Cardiology》;全文 *
Circular RNA TTC3 regulates cerebral ischemia- reperfusion injury and neural stem cells by miR-372-3p/TLR4 axis in cerebral infarction;Bo Yang等;《Stem Cell Research & Therapy》;第12卷(第1期);全文 *

Also Published As

Publication number Publication date
CN114517209A (en) 2022-05-20

Similar Documents

Publication Publication Date Title
CN104450747B (en) For treating the full length gene of recombinant adeno-associated virus nadh dehydrogenase subunit 4 and medicament of Leber hereditary optic neuropathies
CN101805750B (en) Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector
CN107385033B (en) PiRNA-5938 and application of antisense nucleic acid thereof in diagnosis and treatment of ischemic heart diseases
CN107794280B (en) Targeted cell-penetrating peptide gene vector and application thereof
CN106222173B (en) Effect of circRNA MNCR in regulating myocardial cell necrosis and myocardial ischemia injury
CN111494634B (en) Nucleic acid medicine for treating chronic pain
CN114517209B (en) Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof
CN113234811A (en) Application of CircRNA000338 and medicine thereof
CN102242080A (en) Method for treating or diagnosing heart failure or tendency of heart failure or improving functions of myocardial cells by miR-24 (MicroRNA-24)
CN114432332B (en) Application of circUTRN in preparation of heart failure treatment medicine, recombinant vector and heart failure treatment medicine
CN109234381A (en) Application of the miR-2682-5p as kidney fibrosis marker
CN101444629B (en) Non-injection gene therapy medicine and medicine box thereof
CN112294835A (en) Application of LncRNA-266 in preparation of drug for inducing differentiation of brown adipocytes
CN115137740B (en) Application of miRNA-497b or miRNA-5106 in preparation of medicines for treating ischemic myocardium
CN114588264B (en) Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia reperfusion injury drugs
CN116790612B (en) Peroxisome germinal protein 3 for promoting myocardial regeneration and repair and application thereof
CN111840327B (en) Mesenchymal stem cell preparation for treating diabetic foot and application thereof
CN114058591B (en) Recombinant mesenchymal stem cell and application thereof
CN117210392B (en) Application of LncRNA in preparation of medicine for preventing and treating myocardial infarction
CN114432453B (en) Application of CLEC4D knocking-down or inhibiting reagent in preparation of myocardial ischemia-reperfusion injury medicine
CN111821420B (en) Application of CAND1 in preparation of drugs for inhibiting myocardial cell hypertrophy, heart failure and myocardial fibrosis
CN109971786B (en) Nucleopore protein Nup54, vector thereof and application of recombinant adenovirus
US20220403384A1 (en) Engineered circular rna circmir-29b and use thereof in preparation of medicine for treating muscle atrophy
CN111184736A (en) Application of inhibiting HMBOX1 gene expression
CN118286434A (en) Use of YTHDF inhibitor in preparation of medicine for preventing and treating pathological myocardial hypertrophy and ventricular remodeling

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant