CN109971786B

CN109971786B - Nucleopore protein Nup54, vector thereof and application of recombinant adenovirus

Info

Publication number: CN109971786B
Application number: CN201910317752.3A
Authority: CN
Inventors: 陈义汉; 徐亮; 唐秋雨; 石蕊; 管溢
Original assignee: Shanghai East Hospital Tongji University Affiliated East Hospital
Current assignee: Shanghai East Hospital Tongji University Affiliated East Hospital
Priority date: 2019-04-19
Filing date: 2019-04-19
Publication date: 2022-09-23
Anticipated expiration: 2039-04-19
Also published as: CN109971786A

Abstract

The invention provides application of nucleoporin Nup54 in preparing a medicament for treating myocardial injury or acute myocardial infarction. The invention also provides a vector containing the gene for coding the nucleopore protein Nup 54. Also provides a recombinant adenovirus vector containing a gene coding the nucleopore protein Nup 54. Also provided is an adenovirus comprising a gene encoding nucleopore protein Nup 54. Also provides the application of the vector, the recombinant adenovirus vector and the adenovirus in preparing medicaments for treating myocardial injury or acute myocardial infarction. Experiments show that the nuclear porin Nup54 gene transduction can maintain the cardiac function by regulating the nuclear plasma transport of the Serca2a protein after myocardial infarction, relieve the cardiac damage caused by myocardial ischemia and protect the cardiac function in the early stage of myocardial infarction.

Description

Nucleopore protein Nup54 and its carrier and application of recombinant adenovirus

Technical Field

The invention belongs to the field of biotechnology and medicine, and relates to nucleoporin Nup54, in particular to nucleoporin Nup54 and a vector thereof and application of recombinant adenovirus.

Background

Acute Myocardial Infarction (MI) is a serious type of cardiovascular disease, and is a secondary thrombosis on the basis of coronary artery lesion, which causes rapid reduction or interruption of coronary artery blood supply, and causes acute necrosis of partial myocardial cells caused by corresponding myocardial severe and persistent ischemia. Myocardial contractility is extremely weakened after myocardial infarction, cardiac output is remarkably reduced, and the myocardial contractility is a common cause of myocardial infarction death. The early opening of infarction-related arteries and the maintenance of the cardiac function of a patient are the key to improving the prognosis of the patient, but the current treatment of acute myocardial infarction has the following problems: 1) the contact time from self-illness to first medical treatment is too long; 2) no thrombolysis condition is provided in a short time; 3) the condition of percutaneous coronary artery interventional therapy is not available within a short time; 4) has contraindications of thrombolysis or interventional therapy. Therefore, emergency treatment after acute myocardial infarction is of urgent and great significance.

Gene expression, cell growth and division in eukaryotic cells all depend on mass transport and information communication of continuous macromolecules between the nucleus and cytoplasm, and this transport process is accomplished by Nuclear Pore Complexes (NPCs). NPCs consist of approximately 30 different nucleoporins (Nups) that are embedded in the nuclear envelope to form a channel connecting the inside and outside of the nuclear envelope. The primary function of the nuclear pore complex is to transport substances between the nuclear plasma, and also to participate in or directly regulate various important cellular processes such as transcription, replication, DNA damage and repair, cellular mitosis, genomic stability, cellular senescence and death.

Nucleoporin Nup54(Gene ID:53371) is located in the central channel of the nucleopore complex, contains FG repeat domain and alpha-helix domain, has strict control on the entrance and exit of macromolecular substances, constitutes a selective permeation barrier, and is necessary for the effective transportation of mRNA and protein. By intervening nucleoporin, nuclear plasma transport of important functional gene mRNA is regulated, which is beneficial to mobilizing mRNA stock in a short time and promoting protein translation of the mRNA, thereby playing a role in protecting cardiac muscle.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides nucleopore protein Nup54 and a vector thereof as well as the application of recombinant adenovirus, and the nucleopore protein Nup54 and the vector thereof as well as the application of the recombinant adenovirus aim to solve the technical problem of poor effect of the drug for treating myocardial injury or acute myocardial infarction in the prior art.

The invention provides application of nucleoporin Nup54 in preparing a medicament for treating myocardial injury or acute myocardial infarction, wherein the amino acid sequence of nucleoporin Nup54 is shown as SEQ ID NO. 1.

The invention also provides a vector which contains a gene for coding the nucleopore protein Nup54, and the base sequence of the vector is shown as SEQ ID NO. 2.

The invention also provides a recombinant adenovirus vector which contains a gene for coding nucleopore protein Nup54, and the base sequence of the recombinant adenovirus vector is shown as SEQ ID NO. 2.

Preferably, the recombinant adenovirus vector is a recombinant adenovirus vector pDC316-mCMV-Nup54-EGFP obtained by inserting a Nup54 protein coding gene into a pDC316-mCMV-EGFP vector.

The invention also provides an adenovirus which contains a gene for coding nucleopore protein Nup54, and the base sequence of the adenovirus is shown in SEQ ID NO. 2.

Preferably, the adenovirus is obtained by inserting a Nup54 protein coding gene into a pDC316-mCMV-EGFP vector and transfecting cells with the obtained recombinant adenovirus vector pDC316-mCMV-Nup 54-EGFP.

The invention also provides application of the carrier in preparing a medicament for treating myocardial injury or acute myocardial infarction.

The invention also provides application of the recombinant adenovirus vector in preparing a medicament for treating myocardial injury or acute myocardial infarction.

The invention also provides application of the adenovirus in preparing a medicament for treating myocardial injury or acute myocardial infarction.

The invention screens a nucleopore protein Nup54, and provides a method for improving cardiac function by myocardial injection after acute myocardial infarction of adenovirus containing the nucleopore protein Nup54 gene.

The Nup54 protein provided by the invention has the following functions of 1), 2) or 3):

1) regulating protein expression of Serca2a (Sarcoplasmic/endoplasmic reticulum calcum ATPase 2a) in cardiomyocytes;

2) regulating nuclear plasma transport of mRNA in cardiomyocytes;

3) improving cardiac function after myocardial infarction.

The above-described regulation of protein expression of Serca2a in cardiomyocytes according to the present invention was performed in Neonatal Rat Ventricular Myocytes (NRVMs); the regulation of protein expression of Serca2a in the myocardial cells is embodied by 1), 2) or 3) as follows:

1) interference and overexpression of Nup54 in NRVMs, Western testing of the effect of Nup54 on the Serca2a protein: the results show that Nup54 is able to regulate the expression of the Serca2a protein.

2) Interference and overexpression of Nup54 in NRVMs, PCR testing the effect of Nup54 on mature and non-mature mRNA of Serca2 a: nup54 was found to have no significant effect on the expression of mature and non-mature mRNA of Serca2 a.

3) Over-expression of Nup54 in NRVMs, luciferase assay examined the effect of Nup54 on the Serca2a promoter: the results show that neither interference nor overexpression of Nup54 has a significant effect on the activity of the Serca2a promoter.

The nuclear plasma transport of mRNA in the myocardial cells is regulated and controlled in NRVMs; the regulation of the nuclear plasma transport of mRNA in the myocardial cells is embodied by 1), 2) or 3) as follows:

1) after Nup54 was overexpressed in NRVMs, nuclear/plasma mRNA was isolated and the content of Serca2a mRNA in the nucleus/plasma was examined by PCR, respectively, and it was found that Nup54 selectively regulates protein expression of Serca2a in cardiomyocytes by affecting the nuclear plasma transport of Serca2a mRNA in a post-transcriptional regulated manner in cardiomyocytes, with the total amount of Serca2a mRNA remaining unchanged.

2) Over-expression of Nup54 in NRVMs, the region of co-immunoprecipitation of Serca2a mRNA with Nup54 protein was studied by RNA-binding protein immunoprecipitation (RIP) assay; the Nup54 protein was found to be able to interact with Serca2a mRNA.

3) A luciferase reporter plasmid of Serca2a mRNA was constructed, Nup54 was overexpressed in HEK293 cells, the region of Serca2a mRNA interacting with Nup54 protein was examined, and the 3' -untranslated region (UTR) region of Serca2a mRNA was found to interact with Nup54 protein.

The above-mentioned improvement of the cardiac function after myocardial infarction of the present invention is embodied specifically by the following 1) and 2):

1) nup54 was perturbed and overexpressed, respectively, in NRVMs, and calcium transients in cardiomyocytes were detected, and Nup54 was found to be able to modulate calcium transients in cardiomyocytes by targeting protein expression that modulates Serca2 a.

2) A mouse acute myocardial infarction model is established, Nup54 adenovirus is injected into the heart in situ, the heart function condition is detected by cardiac ultrasonic, and the Nup54 adenovirus is injected into the myocardium after the myocardial infarction to maintain and improve the heart function.

In the application, the neonatal rat cardiac muscle cell is a cardiac muscle cell of an isolated heart.

In the above application, the regulation of protein expression of Serca2a in cardiomyocytes is achieved by regulating nuclear plasma transport of Serca2a mRNA in cardiomyocytes.

In particular, the myocardial protection effect of Nup54 was tested under myocardial ischemia or myocardial infarction conditions. The present inventors have found that the cardioprotective effect of Nup54 is achieved by mediating nuclear plasmatic transport of the Serca2a mRNA.

Experiments of the invention demonstrate that over-expression of Nup54 in NRVMs can increase protein expression of Serca2a, while interference of Nup54 reduces protein expression thereof. The specific regulation of Nup54 on Serca2a in cardiomyocytes was achieved by affecting the nuclear plasma transport of Serca2a mRNA by the interaction of the 3' -UTR part of Serca2a mRNA with Nup54 protein. Nup54 in NRVMs can affect Ca2+ recovery capacity of cardiomyocyte sarcoplasmic reticulum by modulating the protein of Serca2 a. Nup54 adenovirus is injected into the heart in situ after the acute myocardial infarction of the mouse, so that the worsening of the cardiac function can be partially resisted, and the Nup54 is a novel protein with a myocardial protection effect, and a novel treatment strategy is provided for the clinical aspect.

Compared with the prior art, the invention has remarkable technical progress. The invention provides an application of nucleoporin Nup54 adenovirus in treating myocardial infarction of mammals. Experimental research results show that the nuclear porin Nup54 gene transduction can maintain the cardiac function by regulating and controlling nuclear plasma transport of Serca2a mRNA after the myocardial infarction of mammals, relieve cardiac damage caused by myocardial ischemia, and protect the cardiac function of mammals at the early stage of the myocardial infarction. Nucleoporin Nup54 can be used as a target for intervention of myocardial injury.

Drawings

Figure 1 shows adenovirus-mediated Nup54 overexpression in NRVMs. Wherein, figure A, Nup54 adenovirus vector construction mode diagram; panel B, protein detection of Nup54 following overexpression of Nup54 adenovirus; figure C, results of fluorescent microscopy detecting Nup54 adenovirus overexpression. The over-expressed Nup54 was located in the nuclear pore at a scale bar of 100 um.

Figure 2 shows the effect of interfering Nup54 on the Serca2a protein in NRVMs. Wherein panel A is a Nup54 interference efficiency assay (mRNA level); panel B is Nup54 interference efficiency assay (protein level); panel C is the statistics of Nup54 protein quantitative analysis results of three interference experiments; panel D is the detection of major protein in cardiomyocytes following Nup54 interference; graph E is statistics of protein quantitative analysis results of the three interference experiments; denotes P <0.01, compared to Negative Control (NC) group.

Figure 3 shows the effect of over-expression of Nup54 on the Serca2a protein in NRVMs. Wherein, the picture A is the detection result of the main protein in the myocardial cells after Nup54 is over-expressed; panel B is statistics of protein quantitative analysis results of three overexpression experiments; p <0.01, compared to Control group Ad-GFP.

FIG. 4 shows a diagram of the gene structure of Serca2a and the detection of mature and non-mature mRNA by Serca2 a. Wherein, Panel A is a structural diagram of the Serca2a gene; panel B is the expression of Serca2a mRNA after interference with Nup 54; panel C is the expression of Serca2a mRNA after over-expression of Nup54, all statistically based on the results of three replicates; denotes P < 0.01.

Figure 5 shows the effect of Nup54 on Serca2a promoter activity in NRVMs. Wherein, the picture A is the structure of the dual-luciferase reporter plasmid of the Serca2a promoter; panel B and panel C are statistics of luciferase activity assays from triplicates after interference and overexpression of Nup54, respectively.

Figure 6 shows the effect of Nup54 on the nuclear plasma distribution of Serca2a mRNA in NRVMs. After over-expression of Nup 5432 h, the content of Serca2a mRNA in nucleus and cytoplasm of cardiomyocytes was examined using internal controls GAPDH (panel a) and β -actin (panel B), respectively, and the results showed that over-expression of Nup54 increased the content of Serca2a mRNA in cytoplasm.

Figure 7 shows the results of the interaction of Nup54 protein with Serca2a mRNA. Wherein panel a shows that co-immunoprecipitation of Nup54 can enrich for a fragment of Serca2a mRNA; panel B is the structure of the Serca2a mRNA luciferase reporter plasmid; panel C shows the results of the interaction of different fragments of Serca2a mRNA (5 '-UTR, coding sequence (CDS) and 3' -UTR) with Nup 54.

Figure 8 shows the effect of intervention Nup54 on calcium transients in NRVMs. Where panel A is a typical calcium transient recorded after Fura-2/AM staining following interference with Nup54 in cardiomyocytes, and panels B-D are statistics of calcium transients following interference with Nup54, including the maximum amplitude (panel B), the time taken for the diastolic cytoplasmic Ca2+ content to decrease by 50% (panel C), and the time taken for the cytoplasmic Ca2+ to peak (panel D). The sample size of each experimental group is NC group (n ═ 21), interference Nup54#1 group (n ═ 18) and #2 group (n ═ 19). Panel E shows the results of calcium transients in cardiomyocytes after Fura-2/AM staining following Nup54 overexpression, and panels F-H show statistics of calcium transients, including the maximum amplitude (panel F), the time taken for the cytoplasmic Ca2+ level to decrease by 50% (panel G), and the time taken for cytoplasmic Ca2+ to peak (panel H). Wherein the sample amount of each experimental group is Ad-GFP group (n ═ 13), Ad-Nup54 group (n ═ 19); denotes P < 0.01.

Figure 9 shows the results of the mouse cardiac ultrasound examination after the myocardial injection of Nup54 adenovirus. Wherein, the graph A is a typical echocardiogram; the graphs B-C show the statistics of Ejection Fraction (EF) and Fractional Shortening (FS), respectively. Wherein the sample amount of each experimental group is Basic group (n ═ 5), MI + Ad-GFP group (n ═ 10) and MI + Ad-Nup54 group (n ═ 11), and represents P < 0.05.

Figure 10 shows the results of cardiac function assays in mice following cardiac multipoint injection of Nup54 adenovirus. Wherein, the graph A is the left ventricular posterior wall thickness (LVPW), and the graph B is the statistical result of the Left Ventricular Inner Diameter (LVID).

Detailed Description

The technical solutions of the present invention are further described in the following with reference to the accompanying drawings and specific embodiments, but the scope of the present invention is not limited thereto.

Example 1 Generation of Nup54 adenovirus

1) Constructing an adenovirus vector containing a nucleoporin Nup54 sequence: pDC316-mCMV-Nup54-EGFP vector construction (see FIG. 1A for a model)

(1) Using cDNA of human Hela cells as a template, amplifying a Nup54 full-length sequence (shown as SEQ ID NO. 2), and connecting to an EcoR I enzyme digestion site of a pDC316-mCMV-EGFP carrier (Microbix Biosystems) by using a recombinant enzyme method; the primers used were as follows:

Forward：

cgtagaacgcagatcgaattcatggccttcaattttggggc (shown in SEQ ID NO. 3);

Reverse：

gcccttgctcaccatgaattcactaaagacaccacctctgatgtgg (shown in SEQ ID NO. 4);

(2) the vector pDC316-mCMV-EGFP was cleaved with EcoR I endonuclease in a 50uL reaction system at 37 ℃ and purified by running gel.

(3) Nup54 was ligated to vector pDC316-mCMV-EGFP using the homologous recombinase (Cloneexpress II One Step Cloning Kit, Vazyme) at 37 ℃ in a 20uL reaction system.

(4) The ligation products were transformed into DH 5. alpha. competent bacteria, plated on LB (Luria-Bertani) medium plate containing ampicillin uniformly, cultured at 37 ℃ for 12 hours, and then single colonies were picked for colony PCR: 20uL of reaction system, denaturation at 94 ℃, annealing at 58 ℃, extension at 72 ℃ and 30 cycles; identifying and sequencing positive clones; after the plasmid with successful sequencing is amplified, the plasmid is stored at the temperature of 20 ℃ below zero for later use.

2) Packaging of Nup54 adenovirus: and co-transfecting a target shuttle plasmid pDC316-mCMV-Nup54-EGFP and an adenovirus skeleton plasmid into HEK293 cells for recombination to obtain a virus Ad-Nup54, amplifying a large amount of virus, purifying, and detecting the titer and the target gene expression level for later use. The experimental procedure was as follows:

(1) and (3) virus packaging and identification:

inoculating cells into a 6-well plate one day before transfection, and controlling the density of the cells during transfection to be 80-90%;

② dissolving 4ug (framework plasmid: shuttle plasmid: 1) of the virus vector plasmid to be transfected into an Opti-MEM culture medium, the total volume is 100uL, and gently mixing;

dissolving the liposome transfection reagent in Opti-MEM culture medium with the volume of 100uL, and gently mixing;

mixing the diluted transfection reagent solution with the diluted plasmid solution to form a stable transfection complex;

adding the prepared DNA-transfection reagent complex into a cell culture plate to make the skeleton plasmid and shuttle plasmid enter cells;

sixthly, changing the liquid once every 2 days, generating virus plaques about 7-15 days, and collecting supernatant after complete lesions.

(2) And (3) performing large-scale amplification and purification of the virus:

culturing HEK293 cells of 4T 75 culture bottles until the monolayer is 90-100% confluent;

replacing the cell culture medium with a new growth culture medium, wherein each bottle contains 10mL of adenovirus, and adding the adenovirus into the culture;

③ after 24 hours, adding 10mL of growth medium into the culture bottle to ensure that the virus is continuously amplified for 24 hours;

when all cells float, gently shaking the culture flask for several times, and collecting all the culture medium (including cells) in a sterile tube;

fifthly, centrifuging for 5min at 1,000rpm to precipitate cells. The cell pellet was resuspended in 0.5mL of freshly prepared virus lysis buffer. Incubation at 37 ℃ for 30min, followed by complete release of adenovirus from the cells by three freeze/thaw cycles;

sixthly, centrifuging at 10,000 rpm for 10min, transferring the supernatant to another microfuge tube and discarding cell debris.

Seventhly, condensing the virus by using an Adenovirus condensing Kit (Adenoviral Purification Kit, VPK-5112, Cell Biolabs).

3) Virus titration assay:

day 0, the 293T cells with good growth status were digested and counted, and then diluted to 1X 10 ⁵ Per ml, added to a 96-well plate,100 uL/well (1X 10) ⁴ One cell) 6 wells were required for each virus. Placing at 37 ℃ with 5% CO ₂ The culture was carried out overnight in an incubator.

Day 1: a 10-fold gradient dilution was made in EP tubes with 6 dilutions in series. The dilution method is as follows: prepare 6 EP tubes of 1.5mL, add 90uL complete medium to each tube, add 10uL virus stock solution to the first tube, mix well, aspirate 10uL and add to the second tube and mix well. By analogy, the diluted virus and cells were then incubated overnight.

Day 2: the virus-carrying medium was aspirated and 100uL of complete medium was added to each well to facilitate cell growth.

Day 3: fluorescence was observed under a microscope. Fluorescence is now expressed primarily.

Day 4: the results were observed under a fluorescence microscope, and wells with the appropriate fluorescence ratio (between 10% and 30%) were counted and the titer was calculated. The calculation formula is as follows:

titer (TU/mL) cell number × percent fluorescence × 10 ³ Volume of virus stock solution (uL)

4) And (3) detecting the expression of the target gene:

(1) adenovirus infection of neonatal rat cardiomyocytes (NRVMs): the prepared cardiomyocytes were transfected at a multiplicity of infection (MOI) of 100, and the transfection efficiency was evaluated by observing fluorescence at 24, 36, 48, and 72 hours after 12 hours of fluid exchange. Finally, cells were collected at 36h for subsequent experiments.

(2) Fixing cells, and performing microscopic imaging:

preparing cells: the primary myocardial cells obtained by isolation need to be laid on a glass bottom cell culture plate which is incubated with Laminin (lamin) in advance (at least incubated at 37 ℃ for 2 h);

② taking out the treated cells from the incubator, discarding the culture medium, washing 3 times with Phosphate Buffer Saline (PBS);

③ adding 200uL of 4% Paraformaldehyde (PFA) (w/v) (24-hole plate) into each hole, standing at room temperature for 15min to fix the cells;

fourthly, discarding PFA, washing 3 times by PBS, and placing on a shaking bed for 5min each time;

staining cell nucleus with DAPI, diluting with PBS at a ratio of 1:1000, adding 100uL per well, staining at room temperature for 3min, discarding DAPI, washing with PBS for 2 times, each time for 5 min.

(3) Protein detection of viral expression

The virus was detected by Western Blot (WB) assay 36h after infecting cardiomyocytes with the virus. As shown in fig. 1B, a distinct band of Nup54 over-expressed protein appeared around 80kD (Nup54-GFP fusion protein, 54(Nup54) +28(GFP) ═ 82).

(4) And (3) observation by a fluorescence microscope: cells were fixed with 4% PFA, permeabilized with PBS containing 0.5% Triton X-100, nuclear stained with DAPI, photographed using a confocal laser microscope, and processed using LAS AF LITE and Photoshop software, and from immunofluorescence imaging results (FIG. 1C), it can be seen that adenovirus-mediated overexpression of Nup54 specifically localizes to the nuclear pores of cardiomyocytes.

Example 2 modulation of Serca2a by Nup54 in cardiomyocytes

1) Interference and overexpression of Nup54 in NRVMs, protein testing the effect of Nup54 on the Serca2a protein:

knockdown of Nup54 using different interference sequences, as shown in FIGS. 2A-C, two effective interference sequences #1 and #2 could be selected by PCR and WB detection 48h after NRVMs interference (Rat-Nup54# 1: 5'-GGTAGAATCATTGCATAAA-3', Rat-Nup54# 2: 5'-GAACCTTACAGGTCCTAAT-3'). After knocking down Nup54 in NRVMs with potent interference sequences, expression of Serca2a protein was found to be significantly reduced by WB assay (fig. 2D-E). In contrast, the expression level of the protein Serca2a was significantly increased after 36h of infection of cardiomyocytes with adenovirus Ad-GFP and Ad-Nup54 (FIG. 3).

2) Interference and overexpression of Nup54 in NRVMs, PCR testing the effect of Nup54 on mature and non-mature mRNA of Serca2 a:

after Nup54 is interfered in NRVMs, the expression level of mature mRNA and non-mature mRNA of Serca2a is not obviously changed through PCR detection; similarly, there was no significant change in the expression of Serca2a mRNA after Nup54 was overexpressed (fig. 4).

3) Over-expression of Nup54 in NRVMs, and luciferase assay to examine the effect of Nup54 on the activity of the Serca2a promoter:

to further confirm the effect of Nup54 on the transcription of Serca2a mRNA, we first interfered with or overexpressed Nup54 in cardiomyocytes, followed by transfection of the Serca2a promoter luciferase reporter plasmid, and examined the effect of Nup54 on Serca2a promoter activity. As shown in fig. 5, neither interference nor overexpression of Nup54 significantly affected the activity of the Serca2a promoter compared to the control group. Taken together, Nup54 regulates Serca2a not in the transcriptional phase.

Example 3 Nup54 Regulation of Nuclear plasmatic transport of Serca2a mRNA

1) Nuclear/plasma mRNA was isolated after overexpression of Nup54 in NRVMs, and PCR was performed to detect the amount of Serca2a mRNA in the nucleus/plasma, respectively:

to investigate the mechanism by which Nup54 regulates the expression of Serca2a protein, we overexpressed Ad-GFP and Ad-Nup54 in NRVMs, separated the nuclear and cytoplasmic fractions and extracted the mRNA of each fraction separately, and examined the expression of Serca2a mRNA by PCR. As shown in figure 6, overexpression of Nup54 significantly increased the content of the cytoplasmic fraction Serca2a mRNA in cardiomyocytes, whether calibrated with the internal reference GAPDH (figure 6A) or the internal reference β -actin (figure 6B). Since Nup54 did not affect the transcription of Serca2a, Nup54 promoted protein expression of Serca2a by enhancing nuclear plasma transport of Serca2a mRNA in a post-transcriptional regulated manner in cardiomyocytes with an unchanged total amount of Serca2a mRNA.

2) Over-expression of Nup54 in NRVMs, and determination of the region of interaction of Serca2a mRNA with Nup54 protein:

to further explain how Nup54 regulates nuclear plasmatic transport of Serca2a mRNA, we used a method of RNA-binding protein immunoprecipitation (RIP) to explore whether Serca2a mRNA could interact with Nup54 protein. Co-immunoprecipitation was performed with Ad-GFP and Ad-Nup54 treated cardiomyocytes using the GFP antibody (ab290, Abcam) using the Magna RIP Kit (17-700, Millipore), and each set of samples was simultaneously run using an IgG antibody homologous to the GFP antibody as a negative control. PCR detection of immunoprecipitated mRNA was performed to verify whether the Serca2a mRNA was enriched. The experimental results, as shown in figure 7A, over-expressed Nup54 was able to significantly enrich the cardiomyocytes for Serca2a mRNA compared to the GFP group, indicating that there was an interaction between Nup54 protein and Serca2a mRNA.

To analyze the critical regions of Nup54 interaction with Serca2a mRNA, we cloned the 5 '-UTR, CDS and 3' -UTR regions of Serca2a mRNA, inserted into the 5 'or 3' end of renilla luciferase of psiCheck2, respectively (fig. 7B). In HEK293 cells, the plasmids are respectively co-transformed with Nup54 overexpression plasmids, and cells are collected after 48h to detect luciferase activity, so that as shown in figure 7C, compared with a control group, the luciferase activity of only the Serca2a 3 '-UTR group is obviously improved, but the luciferase activity of the Serca2a 5' -UTR, CDS and Serca2b 3 '-UTR groups is not obviously changed, and the 3' -UTR region of the Serca2a mRNA is an important part involved in Nup54 nucleoplasm transportation regulation.

Example 4 modulation of calcium transients by Nup54 in cardiomyocytes

1) Detection of calcium transients in cardiomyocytes:

(1) preparing: 2mM Fura-2/AM (Life Technologies), 20% (w/v) Pluronic F-127(Life Technologies) was prepared, dissolved in DMSO, and formulated as a calcium bench top solution: NaCl 137, KCl 5.4, CaCl ₂ 2，MgSO ₄ 1, Glucose 10, HEPES 10(mmol/L), pH 7.35 with NaOH; the cell culture medium comprises 1mL of fetal calf serum, 0.5mL of double antibody, 40mL of DMEM high-sugar medium and 10mL of M199;

(2) adding 1uL of prepared Fura-2/AM and 1uL of Pluronic F-127 into each mL of culture medium to prepare working solution, heating to 37 ℃ in advance, removing the culture medium from cultured myocardial cells, adding the working solution, and placing in an incubator to incubate for 15min at 37 ℃ for dyeing;

(3) discarding the working solution, adding a cell culture medium for washing once, washing off the residual working solution, adding 2mL of the culture medium, and putting into a incubator for incubation at 37 ℃ for 15min to promote the combination of the dye and calcium ions;

(4) removing the culture medium, washing for 1 time by using the calcium table type liquid, washing out the culture medium remained on the cell surface, and adding 2mL of the calcium table type liquid;

(5) cardiomyocyte calcium transients were recorded using an IonOptix cell motility edge detection and intracellular ion imaging system, given 0.5Hz, 15V electrical stimulation, receiving absorbance at 380nm and 340nm, respectively (fig. 8A), and the data analyzed and processed using the system's own software.

2) Effect of Nup54 on cardiomyocyte calcium transients:

(1) following perturbation of Nup 5424 h in NRVMs, there was no significant change in calcium transient amplitude in cardiomyocytes in the Nup54 knockdown group compared to the NC group (fig. 8B), a significant increase in the time taken for 50% reduction in Ca2+ content in the diastolic cytoplasm (Ca2+ transition at 50% peak) (fig. 8C), and no significant change in the time course for the cytoplasmic Ca2+ content to peak (fig. 8D). These results indicate that the ability to recover Ca2+ during cardiomyocyte contraction is reduced due to the reduced content of Serca2a protein in the case of Nup54 knockdown.

(2) Calcium transients were detected 24h after overexpression of Ad-Nup54 in NRVMs (FIG. 8E). Compared to the Ad-GFP group, there was no significant change in calcium transient amplitude in cardiomyocytes following overexpression of Nup54 (fig. 8F), a significant decrease in the time taken for 50% reduction in the content of Ca2+ in the diastolic cytoplasm (fig. 8G), and no significant change in the time taken for the content of Ca2+ in the cytoplasm to peak (fig. 8H), indicating that the ability to recover Ca2+ during cardiomyocyte contraction was enhanced due to the increased content of Serca2a protein in the case of overexpression of Nup 54.

Our results indicate that Nup54 is able to influence calcium transients in cardiomyocytes by targeted modulation of protein expression by Serca2 a.

Example 5 myocardial protection after myocardial infarction by Nup54

1) Myocardial infarction surgery and adenovirus cardiac injection:

(1) preparing a C57BL/6 wild-type mouse, preparing for myocardial infarction operation when the mouse grows to 8-10 weeks old and has the weight of about 20-25g, starting a small animal gas anesthesia machine, putting the mouse into a chamber of the gas anesthesia machine, and using 4% isoflurane (mixed with 96% pure oxygen) to relax and coma the whole body of the mouse;

(2) taking out the mouse, fixing the mouse on a self-made mouse board, fixing the mouse board with adhesive tapes in a natural supine position, placing the nasal cavity in a mask of a gas anesthesia machine, shaving the neck and the left chest of the mouse, and wiping the mouse board with alcohol for disinfection; cutting the skin of the neck to expose trachea, and slightly pulling the tongue out of the oral cavity by using forceps to perform trachea intubation; connecting a breathing machine, wherein the tidal volume of the mouse is 6-8mL/kg, and the breathing frequency is 120 times/min; after successful intubation, the concentration of isoflurane is adjusted to 1.5 percent and the whole operation process is maintained;

(3) transferring the mouse to a constant temperature operating table, stretching to the right lateral decubitus position instead of 37 ℃, lifting the left forelimb, fixing with adhesive tape, wiping the skin of the left chest with alcohol, and transversely cutting along the connecting line of the armpit and the lower end of the sternum by about 1cm, wherein the position is between the 3 rd and 4 th ribs;

(4) separating pectoralis major muscle bluntly by using forceps, aiming at 3 and 4 intercostals, observing that the left lung swings along with breathing, separating the intercostal muscle bluntly at the position where the lung lobes swing, and opening the thoracic cavity;

(5) carefully tearing the pericardium with forceps to expose the heart, placing the sterilized cotton cut into small pieces, and gently shifting the left lung to one side through the cotton piece, so that the heart is exposed more clearly, and the swinging lung lobes are prevented from being accidentally injured in the operation process;

(6) observing under a microscope, a clear blood vessel is arranged below the left auricle, the anterior descending branch of the left coronary artery to be ligated is arranged below and accompanies the anterior descending branch of the left auricle, a micro needle holder is used for holding a 6-0 noninvasive suture needle to insert the needle at the position 2-3mm below the lower edge of the left auricle, the needle is taken out below the pulmonary artery cone to ligate the left anterior descending branch, the knotting strength is not too high, and the myocardial rupture is avoided;

(7) one of the signs of successful mold making of myocardial infarction is that the color of the myocardial tissue below the ligation part can be observed to be grey white after ligation, the mold making is successful after the ligation is observed for a moment without bleeding and the myocardial tissue is continuously grey white, the operation process of a Sham operation (Sham) group is the same, but the heart is not knotted after the heart is pricked;

(8) viral cardiac injection: 50uL of virus stock solution is sucked by an insulin needle, and is injected at multiple points below the ligature and at the edge of the myocardial infarction area, namely the junction of the gray heart and the red heart, wherein each point is about 10-15uL of virus.

(9) Taking out the sterilized cotton piece, slightly pressing the chest cavity of the mouse by hands to return the lung, simultaneously exhausting gas in the chest cavity as much as possible, and closing intercostal muscles by adopting a splayed suture mode;

(10) closing pectoralis major and skin layer by adopting a continuous suture mode, and disinfecting the wound of the skin by using iodophors;

(11) the breathing machine is closed for a short time after the operation is finished, whether the mouse can breathe automatically or not is observed, the tracheal cannula is pulled out to wait for waking after the mouse breathes stably, and the mouse is put back into the cage to be normally raised in the raising room after waking up and being capable of moving normally.

2) Mouse heart ultrasonic detection:

(1) skin preparation: removing hair from left chest to oxter part of mouse with depilatory cream;

(2) weighing and recording the weight of the mice, performing gas-induced anesthesia by using isoflurane in a ratio of 4% isoflurane and 96% pure oxygen, and then maintaining anesthesia by using a mask to give a mixed gas of 1.5% isoflurane and pure oxygen at a flow rate of 1L/min;

(3) the mouse adopts a supine position and is fixed on a small animal ultrasonic measuring plate with the constant temperature of 37 ℃ and maintains anesthesia;

(4) coating a proper amount of ultrasonic coupling agent on the chest wall of the mouse, placing an ultrasonic probe on the left chest wall, adjusting the position of the probe to enable a display to present a clear heart ultrasonic two-dimensional image, and recording and storing the image;

(5) removing the ultrasonic probe, cleaning the ultrasonic coupling agent on the chest wall of the mouse, removing gas for anesthesia, and putting the mouse back into the cage after the mouse is awakened;

(6) the ultrasound images and various parameters including cardiac Ejection Fraction (EF), shortening Fraction (FS), left ventricular posterior wall thickness (LVPW) and left ventricular diastolic internal diameter (LVID; d) are measured and statistically analyzed.

3) And (3) analyzing an experimental result:

on the basis of an acute myocardial infarction model of an adult C57BL/6 wild-type mouse (8-10 weeks old), Ad-GFP and Ad-Nup54 are respectively injected at multiple points at the edge part of the myocardial infarction region immediately after myocardial infarction operation is completed. The cardiac ultrasound examination of mice was performed 1 week after the operation, and the experimental results showed that the MI + Ad-Nup54 group showed a significant improvement in cardiac function as compared to the MI + Ad-GFP group, as evidenced by significant recovery of cardiac Ejection Fraction (EF) and Fractional Shortening (FS) (FIG. 9), while there was no significant difference between left ventricular posterior wall thickness (LVPW) and left ventricular diastolic inner diameter (LVID; d) (FIG. 10). Therefore, myocardial injection of Nup54 adenovirus after myocardial infarction can maintain and improve the systolic function of the heart.

Sequence listing

<110> Shanghai City eastern Hospital (Oriental Hospital affiliated with Tongji university)

<120> nucleopore protein Nup54, vector thereof and use of recombinant adenovirus

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 507

<212> PRT

<213> Intelligent (Homo sapiens)

<400> 1

Met Ala Phe Asn Phe Gly Ala Pro Ser Gly Thr Ser Gly Thr Ala Ala

1 5 10 15

Ala Thr Ala Ala Pro Ala Gly Gly Phe Gly Gly Phe Gly Thr Thr Ser

20 25 30

Thr Thr Ala Gly Ser Ala Phe Ser Phe Ser Ala Pro Thr Asn Thr Gly

35 40 45

Thr Thr Gly Leu Phe Gly Gly Thr Gln Asn Lys Gly Phe Gly Phe Gly

50 55 60

Thr Gly Phe Gly Thr Thr Thr Gly Thr Ser Thr Gly Leu Gly Thr Gly

65 70 75 80

Leu Gly Thr Gly Leu Gly Phe Gly Gly Phe Asn Thr Gln Gln Gln Gln

85 90 95

Gln Thr Thr Leu Gly Gly Leu Phe Ser Gln Pro Thr Gln Ala Pro Thr

100 105 110

Gln Ser Asn Gln Leu Ile Asn Thr Ala Ser Ala Leu Ser Ala Pro Thr

115 120 125

Leu Leu Gly Asp Glu Arg Asp Ala Ile Leu Ala Lys Trp Asn Gln Leu

130 135 140

Gln Ala Phe Trp Gly Thr Gly Lys Gly Tyr Phe Asn Asn Asn Ile Pro

145 150 155 160

Pro Val Glu Phe Thr Gln Glu Asn Pro Phe Cys Arg Phe Lys Ala Val

165 170 175

Gly Tyr Ser Cys Met Pro Ser Asn Lys Asp Glu Asp Gly Leu Val Val

180 185 190

Leu Val Phe Asn Lys Lys Glu Thr Glu Ile Arg Ser Gln Gln Gln Gln

195 200 205

Leu Val Glu Ser Leu His Lys Val Leu Gly Gly Asn Gln Thr Leu Thr

210 215 220

Val Asn Val Glu Gly Thr Lys Thr Leu Pro Asp Asp Gln Thr Glu Val

225 230 235 240

Val Ile Tyr Val Val Glu Arg Ser Pro Asn Gly Thr Ser Arg Arg Val

245 250 255

Pro Ala Thr Thr Leu Tyr Ala His Phe Glu Gln Ala Asn Ile Lys Thr

260 265 270

Gln Leu Gln Gln Leu Gly Val Thr Leu Ser Met Thr Arg Thr Glu Leu

275 280 285

Ser Pro Ala Gln Ile Lys Gln Leu Leu Gln Asn Pro Pro Ala Gly Val

290 295 300

Asp Pro Ile Ile Trp Glu Gln Ala Lys Val Asp Asn Pro Asp Ser Glu

305 310 315 320

Lys Leu Ile Pro Val Pro Met Val Gly Phe Lys Glu Leu Leu Arg Arg

325 330 335

Leu Lys Val Gln Asp Gln Met Thr Lys Gln His Gln Thr Arg Leu Asp

340 345 350

Ile Ile Ser Glu Asp Ile Ser Glu Leu Gln Lys Asn Gln Thr Thr Ser

355 360 365

Val Ala Lys Ile Ala Gln Tyr Lys Arg Lys Leu Met Asp Leu Ser His

370 375 380

Arg Thr Leu Gln Val Leu Ile Lys Gln Glu Ile Gln Arg Lys Ser Gly

385 390 395 400

Tyr Ala Ile Gln Ala Asp Glu Glu Gln Leu Arg Val Gln Leu Asp Thr

405 410 415

Ile Gln Gly Glu Leu Asn Ala Pro Thr Gln Phe Lys Gly Arg Leu Asn

420 425 430

Glu Leu Met Ser Gln Ile Arg Met Gln Asn His Phe Gly Ala Val Arg

435 440 445

Ser Glu Glu Arg Tyr Tyr Ile Asp Ala Asp Leu Leu Arg Glu Ile Lys

450 455 460

Gln His Leu Lys Gln Gln Gln Glu Gly Leu Ser His Leu Ile Ser Ile

465 470 475 480

Ile Lys Asp Asp Leu Glu Asp Ile Lys Leu Val Glu His Gly Leu Asn

485 490 495

Glu Thr Ile His Ile Arg Gly Gly Val Phe Ser

500 505

<210> 2

<211> 1524

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 2

atggccttca attttggggc tccctcgggc acctccggta ccgctgcagc caccgcggcc 60

cccgcgggtg ggtttggagg atttgggaca acatctacaa ctgcaggttc tgcattcagc 120

ttttctgccc caactaacac aggcactact ggactctttg gtggtactca gaacaaaggt 180

tttggatttg gtactggttt tggcacaaca acgggaacta gtactggttt aggtactggt 240

ttgggaactg gactgggatt tggaggattt aatacacagc agcagcagca aactacatta 300

ggtggtctct tcagtcagcc tacacaagct cctacccagt ccaaccagct gataaatact 360

gcgagtgctc tttctgctcc aacgctgttg ggagatgaga gagatgctat tttggcaaaa 420

tggaatcaac tgcaggcctt ttggggaaca ggaaaagggt atttcaacaa taatattccg 480

ccagtggaat tcacacaaga aaatcccttt tgccgattta aggcagtagg ttatagttgc 540

atgcccagta ataaagatga agatgggcta gtggttttag ttttcaacaa aaaagaaaca 600

gagattcgaa gccaacaaca acagttggta gaatcattgc ataaagtttt gggaggaaac 660

cagaccctta ctgtaaatgt agagggcact aaaacattgc cagatgatca gacagaagtt 720

gttatttatg ttgttgagcg ttcgccaaat ggtacttcaa gaagagttcc agctacaacg 780

ctatatgccc attttgaaca agccaatata aaaacacaat tgcagcaact tggtgtaacc 840

ctttctatga ctagaacaga actttctcct gcacagatca aacagctttt acagaatcct 900

cctgctggtg ttgatcctat tatctgggaa caggccaagg tagataaccc tgattctgaa 960

aagttaattc ctgtaccaat ggtgggtttt aaggaacttc tccgaagact gaaggttcaa 1020

gatcagatga ctaagcagca tcaaaccaga ttagatatca tatctgaaga tattagtgag 1080

ctacaaaaga atcaaactac atctgtagcc aaaattgcac aatacaagag gaaactcatg 1140

gatctttccc atagaacttt acaggtccta atcaaacagg aaattcaaag gaagagtggt 1200

tatgccattc aggctgatga agagcagttg cgagttcagc tggatacgat tcagggtgaa 1260

ctaaatgcac ctactcagtt caagggccga ctaaatgaat tgatgtctca aatcaggatg 1320

cagaatcatt ttggagcagt cagatctgaa gaaaggtatt acatagatgc agatctgtta 1380

cgagaaatca agcagcattt gaaacaacaa caggaaggcc ttagccattt gattagcatc 1440

attaaagacg atctagaaga tataaagctg gtcgaacatg gattgaatga aaccatccac 1500

atcagaggtg gtgtctttag ttga 1524

<210> 3

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgtagaacgc agatcgaatt catggccttc aattttgggg c 41

<210> 4

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcccttgctc accatgaatt cactaaagac accacctctg atgtgg 46

Claims

1. The application of nucleoporin Nup54 in preparing a medicament for treating acute myocardial infarction is disclosed, wherein the amino acid sequence of the nucleoporin Nup54 is shown as SEQ ID NO. 1.

2. The application of a vector containing a gene coding nucleoporin Nup54 in preparing a medicament for treating acute myocardial infarction is disclosed, wherein the sequence of the gene coding nucleoporin Nup54 is shown as SEQ ID NO. 2.

3. The application of the recombinant adenovirus vector containing the gene of the coding nucleoporin Nup54 in preparing the medicine for treating acute myocardial infarction is disclosed, wherein the sequence of the gene of the coding nucleoporin Nup54 is shown in SEQ ID NO. 2.

4. The application of the adenovirus containing the gene of the coding nucleoporin Nup54 in preparing the medicine for treating acute myocardial infarction is disclosed, wherein the sequence of the gene of the coding nucleoporin Nup54 is shown in SEQ ID NO. 2.