CN110714028B - Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension - Google Patents
Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension Download PDFInfo
- Publication number
- CN110714028B CN110714028B CN201911066809.3A CN201911066809A CN110714028B CN 110714028 B CN110714028 B CN 110714028B CN 201911066809 A CN201911066809 A CN 201911066809A CN 110714028 B CN110714028 B CN 110714028B
- Authority
- CN
- China
- Prior art keywords
- ang
- hypoxia
- expression vector
- pulmonary
- hypoxic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
- A61K38/085—Angiotensins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/14—Angiotensins: Related peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Abstract
The invention discloses an expression vector for controllably up-regulating Ang- (1-7) targeting prevention and treatment of hypoxic pulmonary hypertension. The invention constructs an Ang- (1-7) expression vector driven by HRE enhanced and Tie2 promoter, which is specifically positioned in vascular endothelial cells through a Tie2 promoter, and simultaneously, the HRE is specifically activated by using HIF-1 alpha only expressed in hypoxic pulmonary vascular endothelial cells, thereby up-regulating the expression of Ang- (1-7). The invention discovers that the constructed expression vector not only has targeting property, but also can controllably and effectively up-regulate the expression of Ang- (1-7) in hypoxic pulmonary microvascular endothelial cells according to the degree of hypoxia so as to further regulate and control pulmonary artery smooth muscle cells, realize the controllability of hypoxia and the targeted inhibition of pulmonary artery contraction and the structural reconstruction of reversal pulmonary artery, and provide effective means and strategies for preventing and treating diseases such as hypoxic pulmonary hypertension and the like.
Description
Technical Field
The invention relates to the field of treating hypoxic pulmonary hypertension by applying a gene recombination technology, in particular to a construction method of an HRE (high resolution factor) enhanced Tie2 promoter-driven Angiotensin- (1-7) [ Angiotensin- (1-7) and Ang- (1-7) ] expression vector.
Background
Hypoxic Pulmonary Hypertension (HPH) is a common morbidity link in a variety of respiratory diseases, chronic plateau disease, and various diseases associated with hypoxemia. Hypoxic pulmonary vasoconstriction caused by hypoxia is one of important physiological reactions of the body, and has important significance in maintaining the ventilation/blood flow ratio around hypoxic alveoli, reducing functional shunting and improving the blood oxygen saturation. But chronic, extensive hypoxic pulmonary vasoconstriction can lead to pulmonary vascular structure remodeling. The reconstruction of the pulmonary vascular structure is a key factor for causing the continuous increase of the pulmonary artery pressure and promoting the occurrence and development of the pulmonary heart disease. Therefore, specific relaxation of pulmonary artery, inhibition or reversal of pulmonary revascularization is the main target for prevention and treatment of hypoxic pulmonary hypertension and its complications.
Studies have shown that the renin-angiotensin (RAS) system in the lung is involved in the development of hypoxic pulmonary hypertension. In hypoxic pulmonary hypertension, angiotensin ii (angii), a major effector protein of RAS, not only strongly constricts pulmonary vessels, but also significantly promotes proliferation and hypertrophy of Pulmonary Artery Smooth Muscle Cells (PASMCs), which is one of important factors causing continuous increase of pulmonary vascular resistance. Other members of the RAS, such as renin, angiotensinogen, etc., are also involved in the development of HPH in various ways. Therefore, under hypoxic pulmonary hypertension, dysfunction of the RAS in the lungs may be one of the important causes of hypoxic pulmonary vasoconstriction and structural remodeling. Recently, Ang- (1-7), a new member of RAS, is a heptapeptide with cardiovascular protection effect, and can remarkably resist the vasoconstriction and proliferation promotion effects of AngII, thereby playing roles in relaxing blood vessels, promoting urination, lowering blood pressure and inhibiting cell proliferation. Therefore, the increase of Ang- (1-7) expression in pulmonary circulation is beneficial to improving the functional disorder of RAS in the lung, inhibiting the constriction of hypoxic pulmonary vessels and reversing the reconstruction of pulmonary vessel structures, thereby playing a role in effectively preventing and treating hypoxic pulmonary hypertension.
However, the conventional administration route lacks specificity, resulting in side effects of lowering systemic circulation blood pressure. Moreover, long-term single expansion of pulmonary vessels can also lead to venous blood adulteration and aggravation of hypoxemia. How to make Ang- (1-7) specifically locate in pulmonary blood vessel only, and the pulmonary blood vessel expression is increased only in hypoxia, and can also realize controllable regulation according to the degree of hypoxia, it is the key and key to prevent and cure hypoxic pulmonary hypertension.
Chinese patent CN101532027 (published: 2009, 9, 16) discloses an hypoxia inducible eukaryotic gene expression vector and application thereof, wherein the hypoxia inducible gene expression vector is constructed by transforming pcDNA3.1 and replacing an enhancer of the hypoxia inducible gene expression vector with the enhancer of the hypoxia inducible gene expression vector; in order to detect the function of an hypoxia inducible gene expression vector, cDNA of hVEGF165 is inserted into the vector, a hypoxia inducible eukaryotic gene expression vector p6HRE-hVEGF165 containing hVEGF165 is constructed, the vector is transferred into BHK cells, the BHK cells expressing hVEGF are cultured in a hypoxia environment, the content of hVEGF in culture supernatant is detected by an ELISA method, and the result proves that the expression quantity of hVEGF after hypoxia induction is increased; the p6HRE-hVEGF165 is used for gene therapy of rabbit limb ischemic diseases, can effectively promote the formation of new blood vessels and collateral circulation of the affected limb, and enables the tibial arterial pressure of the affected limb to recover.
But the pulmonary circulation vessels have significantly different properties from the systemic circulation vessels of the above patents. The pulmonary vessels contract hypoxia during short-term hypoxia so as to maintain the ventilation/blood flow ratio around hypoxic alveoli, reduce functional shunting and improve the blood oxygen saturation; long-term hypoxia causes excessive secretion of vasoactive substances such as endothelin, 5-hydroxytryptamine blood vessels, endothelial growth factor (VEGF) and the like, and further participates in pulmonary vessel reconstruction, aggravates the degree of ischemia and hypoxia of lungs, and is the pathophysiological characteristic of causing hypoxic pulmonary hypertension. The systemic circulation blood vessel is obviously dilated under the condition of hypoxia, and the blood flow is increased to relieve the symptoms of ischemia and hypoxia. Hypoxic pulmonary arterial hypertension (HPH) therefore requires more precise expression regulation to be given depending on the degree of hypoxia.
Disclosure of Invention
The invention aims to provide an expression vector for controllably up-regulating Ang- (1-7) targeting prevention and treatment of hypoxic pulmonary hypertension.
In order to achieve the purpose, the invention adopts the following technical scheme:
an Ang- (1-7) recombinant expression vector (HTSFCAng (1-7)) comprises a hypoxia response element, a promoter, a Signal Peptide (Signal Peptide) sequence and an Ang- (1-7) coding sequence, wherein the hypoxia response element is selected from HRE sequences, and the promoter is used for enabling the expression of Ang- (1-7) to have vascular endothelial cell specificity while exerting HRE effect.
Preferably, the repeated arrangement frequency of the HRE sequence is 1-100.
Preferably, the promoter is selected from Tie2 gene promoters.
Preferably, the expression vector specifically comprises a 6 XHRE sequence, a Tie2 gene promoter sequence, a signal peptide, an hIgG1Fc fusion marker sequence and an Ang- (1-7) coding sequence which are sequentially arranged.
Preferably, the expression vector is constructed on an adeno-associated viral vector backbone or a eukaryotic expression vector backbone.
The construction method of the expression vector comprises the following steps: synthesizing a 6 XHRE sequence, a Tie2 gene promoter sequence, a signal peptide sequence, a hIgG1Fc fusion marker sequence and an Ang- (1-7) coding sequence; each of the synthesized sequences was cloned into an expression vector backbone (e.g., pAAV-MCS), and the resulting recombinant plasmid was named HRE-Tie2-FC-Ang- (1-7) (HTSFCAng (1-7) for short). The recombinant plasmid without the Ang- (1-7) coding sequence was designated HRE-Tie2-FC (HTSFC for short) as a control plasmid.
The use of the above expression vector (HTSFCAng (1-7)) for the preparation of a medicament for the prevention and/or treatment of hypoxic pulmonary hypertension and/or complications thereof.
Preferably, the expression vector has cell targeting, normoxia (21% O)2Concentration) was allowed to specifically highly express Ang- (1-7) only in transfected lung microvascular endothelial cells (PMVECs).
Preferably, the expressionThe carrier has low oxygen (oxygen concentration less than 21%, i.e. oxygen deficiency) controllability, and low oxygen (10%, 5% and 1% O) at different concentrations2) Under stimulation, the content of Ang- (1-7) in the supernatant of the transfected PMVECs is obviously increased, and the increasing rate of the content is increased along with the reduction of the oxygen concentration.
Preferably, the expression vector has the effect of inhibiting the proliferation of the PASMCs, for example, PMVECs are transfected into HTSFCAng (1-7) and then administered with hypoxia stimulation with 10% oxygen concentration, and the supernatant of PMVECs cells collected after being cultured for 24 hours is the PMVECs hypoxia condition culture solution containing the expression vector HTSFCAng (1-7), and the PMVECs hypoxia condition culture solution has obvious inhibition effect on the proliferation of hypoxia-induced Pulmonary Artery Smooth Muscle Cells (PASMCs).
Preferably, the expression vector can inhibit the contraction of the hypoxic pulmonary arteriole at the organ level, for example, the hypoxic culture solution of PMVECs containing the expression vector HTSFCAng (1-7) can relieve the contraction response of rat pulmonary arteriole ring under the influence of hypoxia, and relax the pulmonary arteriole ring, and the relaxation effect can be blocked by a Mas receptor blocker A-779.
Preferably, the HTSFCAng (1-7) expression vector packaged as the adeno-associated virus can reduce the right ventricular pressure of rats, relieve the hypertrophy degree of the right ventricle, inhibit the structural change of pulmonary arterioles and improve the structural reconstruction of pulmonary arteries after being applied to hypoxic pulmonary hypertension rats in a nasal drip mode at a time, and the virus enables Ang- (1-7) to be expressed in lung tissues only and has tissue specificity after entering the bodies of the rats.
The use of the above expression vector (HTSFCAng (1-7)) in the preparation of a medicament for preventing and/or treating a series of diseases associated with hypoxia and/or ischemia, such as diabetic gangrene, deep vein thrombosis, ischemic heart disease, etc.
The invention has the beneficial effects that:
the specificity of the promoter driving expression positioned in vascular endothelial cells, the hypoxia conditional expression of HRE and the characteristics of vasodilation and anti-proliferation of Ang- (1-7) are utilized to construct the Ang- (1-7) expression vector driven by the HRE enhanced and Tie2 gene promoter, so that the Ang- (1-7) can be expressed in hypoxic PMVECs in a targeted, controllable and effective manner, and further PASMCs are regulated and controlled to inhibit the contraction and structural reconstruction of pulmonary arteries, the effect of preventing and treating hypoxic pulmonary hypertension is achieved, a new strategy and an important experimental basis are provided for researching gene therapy of hypoxic pulmonary hypertension and complications thereof, and the application prospect is good.
Furthermore, the invention improves the tissue specificity of expression by using the Tie2 gene promoter (Tie2 promoter), solves the side effect of reducing the systemic circulation blood pressure caused by the existing eukaryotic expression vector promoter, and avoids the problems of long-term single reduction of venous blood doping caused by pulmonary vascular pressure and aggravation of hypoxemia of patients. Meanwhile, expression controllability and accuracy are improved.
Furthermore, the invention ensures the full combination with the subsequent sequence in the case of hypoxia by optimizing the determined HRE sequence repetition times, and improves the controllability and the accuracy of expression.
Furthermore, experiments prove that the recombinant plasmid HTSFCAng (1-7) can be highly expressed in hypoxic pulmonary artery endothelial cells, so that pulmonary artery smooth muscle cells are regulated and controlled, and the hypoxia controllability and the targeted inhibition of the contraction of the pulmonary artery and the reversal of the structural reconstruction of the pulmonary artery are realized. The recombinant plasmid is also suitable for a series of diseases related to hypoxia or/and ischemia, such as diabetic gangrene, deep venous thrombosis, ischemic heart disease and the like.
Drawings
FIG. 1 is a schematic diagram of the structure of recombinant plasmid HTSFCAng (1-7) and a control plasmid.
FIG. 2 shows the restriction enzyme identification result of recombinant plasmid HTSFCAng (1-7); lane M is marker, lane 1 is HTSFCAng (1-7).
FIG. 3 shows the restriction enzyme identification result of the control plasmid HTSFC; lane M is marker, lanes 1, 2 are HTSFC.
FIG. 4 shows normal oxygen (21% O)2) Influence on Ang- (1-7) content in cell supernatant after different types of cells are transfected with HTSFCAng (1-7) under the condition; p (III)<0.05vs.untransduced PMVECs cells,n＝5。
FIG. 5 shows the recombinant plasmid HTSFCAng (1-7) vs. normoxia (21% O)2) And varying degrees of hypoxia (10%, 5% and 1% O)2) On stimulated PMVECsInfluence of the Ang- (1-7) content in the serum; p (III)<0.05vs.untransduced PMVECs cells,n＝5。
FIG. 6 shows the recombinant plasmid HTSFCAng (1-7) vs. normoxia (21% O)2) And varying degrees of hypoxia (10%, 5% and 1% O)2) Influence of the increase rate of Ang- (1-7) content in stimulated PMVECs supernatant; p (III)<Normoxia + transformed HTSFCAng (1-7) group, n ═ 5,% P<0.05vs. 10% Hypoxia + transformed HTSFCAng (1-7), n-5.
FIG. 7 is a graph of the hypoxic conditioned medium of PMVECs with HTSFCAng (1-7) versus normoxic (21% O)2) And varying degrees of hypoxia (10%, 5% and 1% O)2) Effects of changes in proliferation of stimulated PASMCs; wherein: (A) is normoxia (21% O)2) And varying degrees of hypoxia (10%, 5% and 1% O)2) Influence of the stimulation on the proliferation of the PASMCs, P<Normoxia group, n ═ 5; (B) is normoxia (21% O)2) Effect of hypoxia conditioned media of PMVECs containing HTSFCAng (1-7) on proliferation changes of PASMCs under the conditions; (C) is a mixture of varying degrees of hypoxia (10%, 5% and 1% O)2) Effect of hypoxic culture of PMVECs with HTSFCAng (1-7) on proliferation of PASMCs<0.05vs. Untranduced group, n ═ 5; (D) effect of different concentrations of hypoxic conditioned culture of PMVECs containing HTSFCAng (1-7) on proliferation changes of PASMCs under 10% hypoxic conditions<Use of 0.05vs. Untranduced group, n ═ 5.
FIG. 8 is a graph of the effect of PMVECs hypoxic conditioned medium containing HTSFCAng (1-7) and A779 on hypoxia-induced changes in pulmonary arteriole ring tone; wherein: (A) schematic diagram of the change of tension of pulmonary arteriole ring under hypoxic condition; (B) effects of hypoxia-conditioned cultures of PMVECs containing HTSFCAng (1-7) on hypoxia-induced changes in pulmonary arteriole ring tone; (C) effects of hypoxia conditioned cultures of PMVECs containing HTSFCAng (1-7) and A779 on hypoxia-induced changes in pulmonary arteriole ring tone; (D) effect of hypoxia-induced changes in pulmonary arteriole ring tension in PMVECs hypoxic conditioned media containing HTSFC (control conditioned media); (E) (ii) effects of culture broth under hypoxic conditions of PMVECs containing HTSFC and a779 on hypoxia-induced changes in pulmonary arteriole ring tone; (F) as a statistical result of Maximum relaxation (Maximum relaxation); (G) statistics for delayed sustained contraction (Phase II vasoconstriction); p <0.05 and # P < 0.05.
FIG. 9 shows the result of agarose gel electrophoresis of the PCR product; lane M is marker, lane 1 is AAV-HTSFC (541bp), and lane 2 is HTSFCAng (1-7) (562 bp).
FIG. 10 shows the result of AAV-HTSFCAng (1-7) in improving the pulmonary artery remodeling process in hypoxic pulmonary hypertension rats; wherein: (A) is the effect of AAV-HTSFCAng (1-7) on mean cardiac arterial pressure (mCAP) in rats; (B) the influence of AAV-HTSFCAng (1-7) on the Right Ventricular Pressure (RVSP) of rats, and the influence of AAV-HTSFCAng (1-7) on the Right Ventricular hypertrophy index [ RV/(LV + S) ]; (D) the effect of AAV-HTSFCAng (1-7) on lung histology of rats; (E) the effect of AAV-HTSFCAng (1-7) on the area ratio (WA%) of pulmonary arterioles in rats; (F) the effect of AAV-HTSFCAng (1-7) on the ratio of pulmonary arteriole diameters (WT%) in rats; p <0.05, n-8.
FIG. 11 shows the result of increasing the content of Ang- (1-7) in lung homogenate of rats with hypoxic pulmonary artery elevation by AAV-HTSFCAng (1-7); p <0.05vs. hypoxia group, n ═ 8.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples.
Firstly, construction, identification and sequencing verification of recombinant plasmid HRE-Tie2-FC-Ang- (1-7)
The 6 XHRE sequence (rat HRE: 5' GACTCCACAGTGCATACGTGGGCTTCC ACAGGTCGTCTC3') and the promoter of Tie gene (Tyrosine kinase with Id EGF homology domains) (Mus mululus receptor type Tie2 gene,5' -cloning region, access number AF022456.1, location: AF022456.1: 1-223, Tie2 promoter for short) were synthesized from the whole gene. Meanwhile, a signal peptide and a hIgG1Fc fusion tag (SPFC:5'ATGAAACATCTGTGGTTCTTCCTTCTCCTGGTGGCAGCTC CCAGATGGGTCCTGTCC3', the signal peptide and the fusion tag are fused in a sequence with two corresponding functions) and a rat Ang- (1-7) coding sequence (5'GACCGGGTGTACATACACCCC3'), and the sequences are cloned to pUC57 (Shenzhen Bainwei)Biotechnology Co., Ltd.) to obtain a template plasmid pUC57-HRE-Tie2-FC-Ang- (1-7); then using Amp+Carrying out MluI and BamHI double enzyme digestion on the pAAV-MCS vector plasmid (Shenzhen Baien vitamin science and technology Limited) and a template plasmid pUC57-HRE-Tie2-FC-Ang- (1-7), connecting, transforming and shaking the recovered pAAV-MCS vector plasmid large fragment and a recombinant target gene (HRE-Tie2-FC-Ang- (1-7) containing Ang- (1-7), wherein Tie2 represents a Tie2 promoter, and FC represents SPFC) overnight, screening bacteria positive clones, and extracting plasmids in bacteria. The expression of Ang- (1-7) in the recombinant target gene fragment is controlled by HRE and Tie2 promoters, and meanwhile, the secretion of Ang- (1-7) in PMVECs is realized by using a signal peptide and an hIgG1Fc fusion marker and cut off at the marker site, so that the recombinant plasmid is named as the recombinant target gene HRE-Tie2-FC-Ang- (1-7) (HTS FCAng (1-7) for short). The recombinant plasmid without the Ang- (1-7) coding sequence was designated HRE-Tie2-FC (HTSFC for short) as a control plasmid, and the expression vector structure is shown in FIG. 1.
The recombinant plasmid HTSFCAng (1-7) and the control plasmid HTSFC are subjected to double enzyme digestion identification by MluI and BamHI, and agarose gel electrophoresis is carried out to obtain target gene bands of 562bp and 541bp respectively (figure 2 and figure 3). And respectively recovering the plasmid pAAV-MCS enzyme digestion large fragment and the recombinant target gene, and carrying out sequencing verification, wherein the result is completely the same as the original sequence, and the recombinant plasmid HTSFCAng (1-7) and the reference plasmid HTSFC are successfully synthesized.
Second, cell experiment
1. Primary culture and characterization of rat pulmonary microvascular endothelial cells (PMVECs) and rat Pulmonary Artery Smooth Muscle Cells (PASMCs)
Primary PMVECs were cultured according to the modified tissue block method. The method comprises the following specific steps: anesthetizing and killing rat (purchased from fourth department of military medical university animal center), rapidly taking out lung tissue, taking out lung tissue block at outer edge of lung in superclean bench, rinsing lung tissue block for several times with precooled serum-free DMEM culture solution, and shearing into pieces with volume of about 1mm3The tissue blocks are uniformly planted in culture flasks. Add about 2ml DMEM medium containing 20% FBS, 90U/ml heparin sodium, 100U/ml penicillin and 100U/ml streptomycin, place the flask upright for 1h and turn over the flask, let the medium slowly submerge, cover the tissue mass.The culture was continued for 24h, and then the medium was changed to aspirate the blood cells. And (4) observing the forms of the ECs, and removing the mixed cells by adopting differential digestion and differential adherence. And (4) carrying out passage after the bottom cell is basically confluent in a monolayer. PMVECs were identified by immunohistochemical staining with factor VIII.
And (3) culturing the primary PASMCs by adopting a tissue block adherence method. The method comprises the following specific steps: anesthetizing and killing rat, quickly taking out lung tissue, quickly separating main pulmonary artery and second and third pulmonary arteries in a superclean bench, rinsing with precooled serum-free DMEM culture solution, stripping adventitia, destroying intima, and cutting into 1mm pieces3The tissue pieces of the size were evenly planted in culture flasks. Adding 2ml DMEM culture solution containing 15% fetal calf serum, vertically placing the culture bottle for 2-4h, turning over the bottle, and slowly immersing the culture solution to cover the tissue block. And (5) continuously culturing for 24h, changing the culture solution, and observing the growth condition of the PASMCs under a microscope. The presence of elongated fusiform PASMCs climbing around the tissue mass was observed around about 7-10 d. And (4) when the PASMCs grow to 80 percent of fusion, carrying out passage, detecting the expression of the anti-alpha-SM-actin in the PASMCs by an immunohistochemical method, and identifying the PASMCs.
2. Normal oxygen (21% O)2) Detecting the content of Ang- (1-7) in cell supernatant by transient transfection of different types of cells under the condition
50. mu.l of each of the bacterial solutions containing the recombinant plasmid HTSFCAng (1-7) and the control plasmid HTSFC was added to the culture broth containing Amp+The OD600 was determined to be about 0.4 to 0.6 in a sterile Erlenmeyer flask with LB medium, shaking overnight at 37 ℃ at 250 rpm. Plasmids were extracted according to kit instructions, OD values were determined, quantitated, and stored at-20 ℃ until use.
The A549, 293 and NIH-3T3 cells (purchased from ATCC in USA) were recovered and cultured in DMEM containing 10% FBS. 2-3 passages of PASMCs, PMVECs, A549, 293 and NIH-3T3 cells were used. Press 105The culture was continued by inoculating the culture medium into 6-well plates at a concentration of one ml/ml. Cells were transfected as long as 80%. Each cell was transfected (transfer) with recombinant plasmid HTSFCAng (1-7) and control plasmid HTSFC (specific procedure: plasmid 4. mu.g, 8. mu.l Lipofectamine)TM2000 transfection reagents and 5ml serum-free medium were mixed well, added to 6-well plates), and 3 replicate wells were made. The transfection procedure was strictly performed according to Invitrogen company Lipofectamine TM2000 transfection reagent instructions. And collecting cell supernatants 12h after transfection, detecting the content of Ang- (1-7) in the supernatants of different types of cells by using an ELISA method, and calculating the concentration of Ang- (1-7) in the supernatants of the cells to be detected by strictly operating according to the instructions of an ELISA kit.
The results of the above experiments were: under the condition of normal oxygen (21% O)2Concentration) cell supernatants of A549 cells, 293 cells, pulmonary artery microvascular endothelial cells (PMVECs) and Pulmonary Artery Smooth Muscle Cells (PASMCs) all contained expressed Ang- (1-7), while the cell supernatant of fibroblasts (NIH-3T3) contained less Ang- (1-7). The four cells were cultured under normoxic conditions (21% O)2Concentration) of Ang- (1-7) in cell supernatants after transfection of recombinant plasmid HTSFCAng (1-7), the increase in Ang- (1-7) was not significant in cells of A549, 293, NIH-3T3 and PASMCs, but was significantly increased in PMVECs (FIG. 4). After transfection of the control plasmid, the content of Ang- (1-7) in the supernatant of each cell type was not significantly affected. The experimental result shows that the recombinant plasmid HTSFCAng (1-7) is specifically and highly expressed only in the transfected PMVECs and has cell targeting property.
3. PMVECs were transfected with recombinant plasmid HTSFCAng (1-7) and control plasmid HTSFC, respectively, and then given different hypoxia (10%, 5%, and 1% O)2) Detecting the content of Ang- (1-7) in cell supernatant after stimulation
Selecting PMVECs cultured in 3 rd-4 th generation according to the ratio of 105The cells were inoculated into 6-well plates at a concentration of one ml and transfected until the cells reached 80% (specific procedure: plasmid 4. mu.g, 8. mu.l Lipofectamine)TM2000 transfection reagents and 5ml serum-free medium were mixed well and added to 6 well plates), recombinant plasmid HTSFCAng (1-7) and control plasmid HTSFC were transfected separately and 5 replicate wells were made. Immediately after transfection, PMVECs were placed in a three-atmosphere incubator and given normoxic (21% O)2) And different concentrations of hypoxia (10%, 5% and 1% O)2) Stimulating and continuing to culture for 24 h. Collecting cell supernatant, and detecting the content change of Ang- (1-7) in the PMVECs supernatant by ELISA method.
The results of the above experiments were: the content of Ang- (1-7) in the supernatant of PMVECs cells in the case of untransfected plasmid gradually decreased with decreasing oxygen concentration. After transfection of the recombinant plasmid HTSFCAng (1-7), respectively, the content of Ang- (1-7) in the supernatant of PMVECs increased significantly (FIG. 5), and the rate of increase of the content of Ang- (1-7) increased with decreasing oxygen concentration (FIG. 6). After transfection of control plasmids, the content of Ang- (1-7) in PMVECs supernatant was not significantly affected. Therefore, the recombinant plasmid HTSFCAng (1-7) has hypoxia controllability at the cellular level.
4. Preparation of hypoxic conditioned PMVECs culture Medium, addition to PASMCs for Normal oxygen (21% O)2) And different concentrations of hypoxia (10%, 5% and 1% O)2) Proliferative changes in PASMCs following stimulation
PMVECs in accordance with 105The plasmid was inoculated into a 6-well plate at a concentration of one ml and cultured, and transfection was carried out after 80% growth (specific procedure: plasmid 4. mu.g, 8. mu.l Lipofectamine)TM2000 transfection reagents and 5ml serum free medium were mixed well, added to 6 well plates), transfected recombinant plasmid HTSFCAng (1-7) and 5 replicate wells were made. Immediately putting the PMVECs into a three-air culture incubator after transfection, giving 10% hypoxia stimulation, continuously culturing for 24h, and immediately collecting supernatant of the PMVECs, namely the PMVECs hypoxia condition culture solution. The PMVECs hypoxia culture solution is prepared at present and cannot be frozen to prevent Ang- (1-7) degradation. After the control plasmid HTSFC transfects PMVECs, the control plasmid HTSFC is also stimulated by 10 percent of hypoxia, and the supernatant is immediately collected after the continuous culture for 24 hours, namely the control condition culture solution.
Collecting growth-promoting PASMCs at 5 × 103Each well was inoculated into a 96-well plate, and DMEM medium containing 10% FBS was added. And when the cells grow to be full of 60%, replacing serum-free DMEM culture solution to culture for 24 hours to synchronize. The newly prepared PMVECs hypoxic condition culture solution containing recombinant plasmid HTSFCAng (1-7) or the control condition culture solution containing control plasmid HTSFC is mixed with DMEM culture solution containing 10% FBS according to different proportions and then added into the holes, and the mixing proportion of the PMVECs hypoxic condition culture solution or the control condition culture solution is 0%, 25%, 50% and 75%:
(ii) 0% of groups: adding 200 mu L of 10% FBS DMEM culture solution and 0 mu L of PMVECs hypoxia culture solution/control condition culture solution into each well;
② 25 percent of culture solution group under low-oxygen condition of PMVECs/culture solution group under control condition: adding 150 mu L of 10% FBS DMEM culture solution and 50 mu L of PMVECs hypoxia culture solution or control condition culture solution into each well;
③ 50% of culture medium group under PMVECs hypoxic condition/culture medium group under control condition: adding 100 mu L of 10% FBS DMEM culture solution and 100 mu L of PMVECs hypoxia culture solution or control condition culture solution into each well;
fourthly, the culture solution group under 75 percent PMVECs hypoxia condition/the culture solution group under control condition: adding 50 mu L of 10% FBS DMEM culture solution and 150 mu L of PMVECs hypoxia culture solution or control condition culture solution into each well;
the PASMCs containing the PMVECs hypoxic conditioned medium/control conditioned medium were then placed in different oxygen concentrations (21%, 10%, 5%, and 1% O)2) The culture was continued with 5 replicates per oxygen concentration. Adding MTT (5mg/mL) for further incubation for 4h, then adding 150 μ l of DMSO solution into each well, shaking for 5min, measuring the absorbance OD value of each well at 490nm wavelength on a full-automatic enzyme standard instrument, taking 3 measurement results from each well, and calculating the average value.
The results of the above experiments were: pulmonary Artery Smooth Muscle Cells (PASMCs) in normoxia (21% O)2) And different concentrations of hypoxic stimuli (10%, 5% and 1% O)2) After 48 hours of culture, there was a variable degree of proliferation of the PASMCs with decreasing oxygen concentration, suggesting that hypoxia induced proliferation of the PASMCs (fig. 7A). PMVECs are transfected with recombinant plasmid HTSFCAng (1-7), and after being stimulated by hypoxia with 10% oxygen concentration for 24 hours, collected PMVECs cell supernatant is PMVECs hypoxia condition culture solution. Fresh PMVECs hypoxic conditioned Medium was immediately added to the PASMCs, followed by hypoxic conditions at various concentrations (normoxic 21%, 10%, 5% and 1% O)2) Proliferation changes of the PASMCs were detected after 48 hours of continued culture. Hypoxic conditioned medium of PMVECs containing HTSFCAng (1-7) versus normoxic (21% O)2) Proliferation of the PASMCs cultured under the conditions was not significantly affected (fig. 7B). But under different concentrations of hypoxic conditions (10%, 5% and 1% O)2) The PMVECs hypoxic condition culture medium containing HTSFCAng (1-7) has obvious inhibition effect on hypoxia-induced proliferation of the PASMCs (figure 7C), and the inhibition effect is dose-dependent, and the PMVECs hypoxic condition culture medium added according to the proportion of 25 percent can obviously inhibit the hypoxia-induced proliferation of the PASMCs (figure 7D). PMVECs were transfected into the control plasmid HTSFC,after 24h of hypoxia stimulation with 10% oxygen concentration, the collected PMVECs cell supernatant is the control conditioned medium. The control conditioned medium had no effect on inhibiting proliferation of the PASMCs as described above.
The cell experiment results show that the recombinant plasmid HTSFCAng (1-7) can only increase the expression of Ang- (1-7) in PMVECs according to the degree of hypoxia, and the PMVECs hypoxia condition culture solution containing the HTSFCAng (1-7) can reduce the proliferation of the PASMCs in a dose-dependent mode, and has cell-level targeting property, hypoxia controllability and effectiveness.
Second, in vitro vascular ring experiment
1. Preparation of hypoxic conditioned Medium for PMVECs
3-4 generation PMVECs in good use status, as indicated by 106Inoculation at a concentration of 25 cm/ml2The culture was continued in disposable sterile plastic culture flasks (total liquid volume of PMVECs per flask was 5 ml). When the cells grow to 80%, the recombinant plasmid HTSFCAng (1-7) is transfected, 10% hypoxia stimulation is given to the PMVECs after transfection, and 5ml of PMVECs cell supernatant, namely the PMVECs hypoxia culture solution, is collected immediately after 24 hours of culture. The PMVECs hypoxia culture solution is prepared at present and cannot be frozen to prevent Ang- (1-7) degradation. Control plasmid HRE-TIE2-FC was similarly subjected to 10% hypoxic stimulation following transfection of PMVECs, and the supernatant, control conditioned medium, was harvested immediately after 24h of incubation.
2. Preparation of three-stage isolated pulmonary artery ring for rat
Separating the pulmonary artery of a rat, comprising the following specific steps: anesthetizing rat, killing rat by exsanguinating abdominal aorta, immediately dissecting sternum, rapidly taking out trachea, lung tissue, and Kreb's solution (containing 95% O by continuous introduction of liquid)2+5％CO2Mixed gas), rinsing blood, separating pulmonary artery blood vessels along the pulmonary artery main stem in the lung direction under a dissecting microscope, taking down the third stage blood vessels (the diameter is about 1-1.5mm) of the pulmonary artery, cutting into blood vessel rings with the length of about 3mm, and placing the blood vessel rings in Kreb's liquid which is pre-cooled and saturated for standby. 2 metal filaments are inserted into the vascular ring lumen and scraped back and forth to remove vascular endothelium, and the rat three-level pulmonary arteriolar ring without endothelium is prepared.
Detecting the activity of the separated arteriole ring, which comprises the following steps: under a dissecting microscope, 2 metal filaments were inserted into the lumen of the vascular ring, and then the vascular ring was suspended in a 37 ℃ constant temperature bath containing Kreb's solution (5ml) and continuously passed with 95% O2+5％CO2To maintain a constant oxygen state in the bath. The other end of the hook for hanging the blood vessel ring is connected with a Power Lab biological signal acquisition system through a tension transducer, and the tension change condition of the blood vessel ring is recorded. The fine balance measures the weight of the vascular ring to set the base tension of the vascular ring. Based on the pre-experimental results and the weight of the vascular ring, the base tension was set to 750 mg. The isolated pulmonary vascular ring was equilibrated in Kreb's for 1h with 1 exchange of fluid every 15 min. The tonicity changes were observed with 1. mu. mol/L Phenylephrine (PE) preshrinking the vascular ring. The blood vessel ring with the rise amplitude of the blood vessel tension after PE preshrinking being less than 300mg is not enough in activity and is discarded.
3. Hypoxic stimulation of isolated pulmonary artery vascular rings
After the vasoactivity detection is finished, selecting a de-endothelial vascular ring with good vasoactivity, and continuously balancing the vascular ring in Kreb's for 1h, and changing the solution for 1 time every 15 min. Then 1 mu mol/L PE pre-contracted vascular ring is added into a 5ml bath tank, and when the tension of the vascular ring rises to a plateau stage, the gas in the bath tank is changed to 95% N2+5％CO2The hypoxic environment was created for about 2h and the change in tension of the vascular ring under hypoxic conditions was recorded.
The results of the above experiments were: the pulmonary arteriole ring undergoes biphasic contraction under the action of hypoxia and phenylephrine (PE, 1. mu. mol/L) (FIG. 8A), i.e., hypoxia induces an initial transient contraction of the pulmonary arteriole ring followed by a transient relaxation (Maximum relaxation) and finally a delayed sustained contraction (Phase II vasoconstriction).
Effect of PMVECs hypoxic conditioned Medium/control conditioned Medium on hypoxia-induced pulmonary arteriole vascular Ring
Adding freshly prepared PMVECs hypoxia culture solution 3.5ml and Kreb's solution 1.5ml, or control culture solution 3.5ml and Kreb's solution 1.5ml into bath, pre-incubating for 20min, pre-contracting blood vessel ring with PE of 1 μmol/L, and increasing blood vessel ring tension toAfter the plateau period, 95% N was immediately turned on2+5％CO2Approximately 2h, changes in the tension of the vascular ring under PMVECs hypoxic medium/control medium and hypoxic conditions were recorded.
The results of the above experiments were: fresh PMVECs hypoxic conditioned medium containing HTSFCAng (1-7) was immediately added to the vessel bath to pre-incubate the pulmonary arteriole ring for 20 minutes, followed by administration of hypoxia and 1. mu. mol/L PE stimulation, during the observation period, with the disappearance of the initial transient contraction of the hypoxia-induced pulmonary arteriole ring, a marked increase in the amplitude of maximal relaxation (Maximum) and a marked decrease in the amplitude of delayed sustained contraction (Phase II vasoconstriction), reversal of the vessel to relaxation, and biphasic relaxation (Phase II vasoconstriction) indicating that the vessel ring is relaxed and has diminished contractility (FIG. 8B, F, G). PMVECs control conditioned medium containing HTSFCs had no effect as described above.
Effect of A-779 and PMVECs hypoxic conditioned Medium/control conditioned Medium on hypoxia-induced pulmonary arteriole vascular Ring
Adding Mas receptor antagonist A-779(1 μmol/L), freshly prepared PMVECs hypoxia condition culture solution 3.5ml and Kreb's solution 1.5ml, or A-779(1 μmol/L), control condition culture solution 3.5ml and Kreb's solution 1.5ml, pre-incubating for 20min, pre-contracting blood vessel ring with PE of 1 μmol/L, and immediately introducing 95% N after the tension of blood vessel ring rises to plateau2+5％CO2For about 2h, the change in tension of the vascular ring under hypoxic conditions of A-779, PMVECs hypoxic medium/control medium and hypoxic conditions was recorded.
The results of the above experiments were: under the conditions that culture solution under A-779 and PMVECs hypoxia condition is pre-incubated at the same time, and then a blood vessel ring is pre-contracted by 1 mu mol/L PE and stimulated by hypoxia, the hypoxia-induced pulmonary arteriole ring is seen to start to instantaneously contract and disappear in an observation period, although the Maximum relaxation (Maximum relaxation) amplitude is increased, compared with the situation that A-779 is not added, the relaxation amplitude is relatively reduced; then the blood vessel ring has lasting contraction (Phase II vasoconstriction), and the contraction amplitude is obviously increased compared with that without A-779; biphasic relaxation (Phase II vasodialation) disappeared, and the vascular ring appeared less diastolic and more systolic (fig. 8C, F, G). PMVECs control conditioned medium containing HTSFCs had no effect as described above (FIG. 8D, E, F, G).
The experimental results of the isolated vascular ring experiments (respectively detecting the tension change of the pulmonary arteriole ring under the conditions of hypoxia, addition of PMVECs hypoxia culture solution containing HTSFCAng (1-7), addition of Mas receptor antagonist A-779(1 mu mol/L) and the like) show that the fresh PMVECs hypoxia culture solution containing HTSFCAng (1-7) can relieve the contraction reaction of the pulmonary arteriole ring caused by hypoxia, inhibit oxygen to reduce the contraction of the hypoactive pulmonary arteriole, and relax the pulmonary arteriole ring, and the effect can be blocked by the Mas receptor blocker A-779.
Third, in vivo animal experiment
1. AAV-HRE-TIE2-FC-Ang- (1-7) construction, collection and virus titer determination of adeno-associated virus
Recovering the frozen 293AAV cells (Shenzhen Baien vitamin science and technology Co., Ltd.), culturing with DMEM culture solution containing 10% FBS, inoculating into 10cm culture dish, adjusting the number of 293AAV cells to about 1-5 × 106On the other hand, the cells were cultured continuously to reach a cell length of 80% or more. And (3) replacing the liquid for 2h before transfection, then carrying out plasmid DNA transfection on 293AAV cells according to the specification of an HET transfection kit of Shenzhen Bainwei company, and replacing the liquid after continuously culturing the transfected 293AAV cells for 4-6 h. After 12-18h of transfection, the culture medium in the petri dish was aspirated off by a pipette, and 10ml of fresh complete culture medium containing 1% of double antibody was added to continue the culture. Culturing for 48 hr, collecting cell mixture, placing into a centrifuge tube, repeatedly freezing and thawing in water bath at-80 deg.C and 37 deg.C for 3 times, centrifuging at 3000rpm for 10min, collecting supernatant, concentrating, purifying, and storing at-80 deg.C.
Designing Real time PCR primers:
hGHpolyA Forward：5'-CAAGCGATTCTCCTGCCTCA-3'
hGHpolyA Reverse：5'-ACGCCTGTAATCCCAGCAAT-3'
according to the experimental requirements, 20ul of AAV-HTSFCAng (1-7) and AAV-HTSF concentrated virus liquid to be detected are respectively taken and respectively made into 103、104、105、106、107Diluting, constructing a Realtime PCR reaction system, and carrying outAnd (4) calculating the copy number in the AAV sample according to the Ct value determined by the PCR reaction.
2. Characterization of adeno-associated virus AAV-HTSFCAng (1-7)/AAV-HTSFC
Extraction of viral genomic DNA: 293 cells are cultured until more than 80 percent of cells are fused, and 200 mu l of AAV-HTSFCAng (1-7) or AAV-HTSFC virus frozen stock solution is respectively added for further culture for 36 h. When the cells were rounded but not yet rinsed, the medium was pipetted out and the cells were rinsed once with PBS. Mu.l of cell lysate (containing 0.6% SDS, 10mM EDTA and 100. mu.g/ml proteinase K) was added to each flask, incubated at 56 ℃ for 1h, followed by addition of 200. mu.l of 5M NaCl to each flask, mixed well, placed on ice for 1h, and the cells were collected and centrifuged at 12000rpm for 10min at 4 ℃. The supernatant was aspirated, an equal volume of a mixture of phenol, chloroform and isoamyl alcohol (mixed at a ratio of 25:24: 1) was added, centrifugation was carried out at 12000rpm for 15min, the supernatant was collected, and 1/9 volumes of 3M NaAc and 2 volumes of absolute ethanol were added, and the mixture was left at-20 ℃ for 30 min. Then, the mixture was centrifuged at 12000rpm for 15min, the supernatant was discarded, and water was removed by vacuum suction. Then 1ml of 70% ethanol is added for resuspension, centrifugation is carried out at 10000rpm for 10min, and the supernatant is discarded. The EP tube was placed at room temperature for 10min to dry the water, 40ul of deionized water was then added to dissolve the extracted DNA, and the DNA was stored at-20 ℃.
And (3) PCR identification: and (3) constructing a PCR reaction system, carrying out PCR reaction, respectively taking 5mL of PCR products to carry out 1% agarose gel electrophoresis, and checking the PCR result.
According to the above experiment, 293AAV cells were transfected with the recombinant plasmid HTSFCAng (1-7) and the control plasmid HTSFCAng (1-7), respectively, and cell mixtures were collected, centrifuged, packaged into adeno-associated viruses, and the virus titer was determined. Extracting virus genome DNA to perform Real-time PCR, respectively taking PCR products to perform 1% agarose gel electrophoresis, and performing virus identification. The results of PCR product identification are shown in FIG. 9, and the adeno-associated virus titers are shown in Table 1. The results show that the virus packaging is successful, the virus titer is better, and the virus packaging can be used in animals.
TABLE 1 titer of AAV viruses
3. Duplicating rat hypoxic pulmonary hypertension model, experimental grouping and detecting various indexes
SD rats were randomly divided into 4 groups of 8 animals each:
set of Normoxia (Normoxia): rats were placed in normoxic environment for 28 days.
② hypoxic group (Hypoxia): rats were placed in a hypoxic chamber with 10% oxygen for 8h each day for 28 days in a continuous fashion to replicate the hypoxic pulmonary hypertension model in rats.
③ hypoxic + AAV-HTSFCAng (1-7) group: rats were placed in a hypoxic chamber with 10% oxygen concentration for 8h each day, and were instilled once at 15d in a nasal drip mode with AAV-HTSFCAng (1-7), and hypoxia was continued to 28 d.
(iv) hypoxia + AAV-HTSFC group: rats were placed in a hypoxic chamber with 10% oxygen concentration for 8h each day, and adeno-associated virus AAV-HTSFC was instilled in a nasal drip manner at 15d, and hypoxia was continued to 28 d.
When a rat drips a nose, the rat is fixed in a supine position after anesthesia, the head is lifted, a liquid transfer device is used for sucking a specific amount of recombinant adeno-associated virus, the recombinant adeno-associated virus is slowly dripped into the nostril of the rat, and the mouth is ensured to be closed when the rat drips the nose, so that the liquid suction is ensured. The virus amount per rat is about 3X 1011μ g/ml. After the nose drops, the rat is naturally woken up, the state of the rat is observed, and the hypoxia treatment is continued for the patient with good state.
Rats in normoxic group were placed in animal chamber and raised under natural conditions (atmospheric pressure of about 718mm Hg, pO in the Western region)2150.6mmHg, oxygen concentration about 21%); the hypoxic rats were placed in a hypoxic chamber (cabin pressure 380mm Hg, pO)2Reduced to 79.6mmHg, equivalent to an oxygen content of 5540 meters at altitude, with an oxygen concentration reduction of about 10%) for 28 days per day; deodorizing in a low-pressure low-oxygen chamber with soda lime and desiccant to absorb CO2. After 28 days, the relevant indexes of pulmonary hypertension of rats in each group are detected.
Detection of hemodynamic index: anaesthetizing and fixing the rat, making an incision in the middle of the neck, separating and ligating the distal ends of the left common carotid artery and the right external jugular vein, clamping the proximal end of the blood vessel, cutting a small opening between the two by using an ophthalmic scissors, respectively inserting a polyethylene catheter filled with 0.5% heparin solution into the left common carotid artery and the right external jugular vein, leaving one end of the catheter in the blood vessel, knotting and fixing the catheter, connecting the other end of the catheter with a pressure transducer, and recording the average left common carotid artery pressure (mCAP) and the right ventricular systolic pressure peak value (RVSP) of the rat.
Measurement of the right ventricular hypertrophy index RV/(LV + S). times.100%: the rat sternum is cut open to expose the heart; the tissue and blood vessels surrounding the heart, as well as the left and right atria, atrial appendage, etc., are removed, the pulmonary artery cone is found, and the Right Ventricle (RV) is cut down the pulmonary artery cone and weighed. The remaining tissue was also weighed, i.e., the weight of the left ventricle and the ventricular septum (LV + S). The right ventricular hypertrophy index [ RV/(LV + S). times.100% ] was calculated from the measurement values to reflect the degree of right ventricular hypertrophy.
ELISA method for detecting Ang- (1-7) content: cutting a small piece of tissue from the rest heart and lung tissues, as well as liver, lung, kidney and other tissue specimens, from each tissue at a uniform position, accurately weighing 100mg of tissue, placing into an EP tube, adding 1ml of normal saline, grinding with a hand-held homogenizer, and preparing tissue homogenate. The EP tube was then centrifuged at 4500rpm at 4 ℃ for 10min and the supernatant was aspirated. Detecting the content of Ang- (1-7) in homogenates of heart, liver, lung and kidney tissues according to the ELISA kit specification.
Preparation of lung tissue paraffin section and HE staining: the materials are taken along the transverse section of the pulmonary portal, tissue blocks of about 1cm multiplied by 2cm of the upper right lung lobes of the rats are cut and placed in an embedding frame, the embedding frame and the embedding frame are placed in 10% neutral formaldehyde buffer solution for fixation for 24 hours, and then the embedding frame is taken out and placed in 70% ethanol solution. Then dehydrated, embedded, and made into paraffin blocks. And slicing the paraffin blocks, performing HE staining after dewaxing to water, and detecting the change of the pulmonary arterioles.
Lung tissue section image analysis: observing the HE stained section under a microscope, selecting small pulmonary arteries with the outer diameter of less than 50-100 μm, collecting and analyzing blood vessel images by using image analysis software, respectively measuring the inner diameter, the outer diameter, the wall thickness and the blood vessel area of the blood vessel, and respectively calculating two indexes reflecting the thickening of the blood vessel wall according to the measured values, namely WT% (the wall thickness/the outer diameter multiplied by 100%) and WA% (the wall area/the total area multiplied by 100%).
The results of the above experiments were: after replicating 4-week hypoxic pulmonary hypertension rat model and applying adeno-associated virus AAV-HTSFCAng (1-7) or control virus AAV-HTSFC to rats in a nasal drip manner at 2 weeks and continuing hypoxia to 4 weeks, the results showed that hypoxia at 4 weeks significantly increased the right ventricular systolic pressure peak (RVSP) of rats (FIG. 10B), reflecting the index of right heart hypertrophy [ RV/(LV + S) ]% significantly increased (FIG. 10C), and the pulmonary arteriolar smooth muscle layer of rats at 4 weeks hypoxic became significantly narrowed lumen (FIG. 10D), representing the index of pulmonary arteriolar thickening, WT% both significantly increased (FIG. 10E, F). The rats given AAV-HTSFCAng (1-7) with adeno-associated virus (AAV-HTSFCAng) showed significant reductions in RVSP, [ RV/(LV + S) ]%, WA% and WT% (FIG. 10B, C, E, F), and significant changes in pulmonary small vessel morphology, slight thickening of arteriolar muscle layers, and insignificant luminal narrowing (FIG. 10D). This section of experiment fully demonstrates that AAV-HTSFCAng (1-7) has significant therapeutic effects on hypoxic pulmonary hypertension rats, reduces right ventricular pressure, reduces right ventricular hypertrophy, inhibits structural changes of pulmonary small vessels, and AAV-HTSFCAng (1-7) has no significant effect on mean left common carotid artery pressure (mCAP) of rats (FIG. 10A). Rats given control virus AAV-HTSFC showed no such expression.
In addition, the content of Ang- (1-7) in the heart, liver, lung, kidney and other tissues of the rat is detected by an ELISA method, the result shows that the content of Ang- (1-7) in the lung tissue can be reduced by hypoxia for 4 weeks, after the AAV-HTSFCAng (1-7) is administered, the content of Ang- (1-7) is only obviously increased in the lung tissue, and the change is not obvious in other tissues (figure 11), which suggests that the expression of Ang- (1-7) is only increased in the lung tissue after the AAV-HTSFCAng (1-7) enters the rat body, and the tissue specificity is certain. Rats given control virus AAV-HTSFC showed no such expression.
The above results of in vivo animal experiments indicate that AAV-HTSFCAng (1-7) improves the progression of hypoxic pulmonary hypertension at the animal level.
In conclusion, the invention utilizes the gene recombination technology, combines the characteristics of angiocathexis and anti-proliferation of Ang- (1-7), the expression of Tie2 gene has the specificity of vascular endothelial cells, the expression of Hypoxia Response Element (HRE) is regulated by HIF-1 alpha (Hypoxia-inducer factor-1 alpha, HIF-1 alpha) during Hypoxia, and the like, constructs an Ang- (1-7) expression vector driven by the Tie2 promoter with HRE enhancement, so that Ang- (1-7) is highly expressed in the hypoxic pulmonary artery endothelial cells, and the pulmonary artery smooth muscle cells are further regulated and controlled through paracrine action, thereby realizing the Hypoxia controllability, targeted inhibition of the contraction of the pulmonary artery and structural reconstruction of reversed pulmonary artery, provides a new means and a new strategy for preventing and treating hypoxic pulmonary hypertension, and also provides ideas and strategies for preventing and treating a series of diseases related to hypoxia or/and ischemia, such as diabetic gangrene, deep venous thrombosis, ischemic heart disease and the like.
<110> the fourth military medical university of the Chinese people liberation army
<120> expression vector for controllably up-regulating Ang- (1-7) targeting prevention and treatment of hypoxic pulmonary hypertension
<160> 5
<210>1
<211>39
<212> DNA
<213> Artificial Synthesis
<400> 1
gactccacag tgcatacgtg ggcttccaca ggtcgtctc 39
<210>2
<211>57
<212> DNA
<213> Artificial Synthesis
<400> 2
atgaaacatc tgtggttctt ccttctcctg gtggcagctc ccagatgggt cctgtcc 57
<210>3
<211>21
<212> DNA
<213> Artificial Synthesis
<400> 3
gaccgggtgt acatacaccc c 21
<210>4
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 4
caagcgattc tcctgcctca 20
<210>5
<211>20
<212> DNA
<213> Artificial Synthesis
<400> 5
Claims (7)
1. An Ang- (1-7) recombinant expression vector, characterized in that: comprises a hypoxia response element, a promoter, a signal peptide sequence and an Ang- (1-7) coding sequence, wherein the hypoxia response element is selected from HRE sequences, and the promoter has the specificity of vascular endothelial cells;
the expression vector specifically comprises a 6 XHRE sequence, a Tie2 gene promoter sequence, a signal peptide, a hIgG1Fc fusion marker sequence and an Ang- (1-7) coding sequence which are sequentially arranged.
2. A method of constructing the expression vector of claim 1, wherein: the method comprises the following steps:
synthesizing an HRE sequence, a promoter sequence, a signal peptide sequence and an Ang- (1-7) coding sequence; the individual sequences synthesized were cloned into an expression vector backbone.
3. Use of the expression vector of claim 1 for the preparation of a medicament for the prevention and/or treatment of hypoxic pulmonary hypertension and its complications.
4. Use according to claim 3, characterized in that: the expression vector has cell targeting property, hypoxia controllability and effectiveness of inhibiting proliferation of pulmonary artery smooth muscle cells, wherein the targeting property shows that Ang- (1-7) is specifically and highly expressed in pulmonary microvascular endothelial cells after the expression vector is transfected, the controllability shows that the increase rate of the expression of Ang- (1-7) is increased along with the reduction of oxygen concentration, and the effectiveness shows that the effectiveness has an inhibiting effect on the proliferation of the pulmonary artery smooth muscle cells induced by hypoxia.
5. Use according to claim 4, characterized in that: the drug is selected from a lung microvascular endothelial cell culture solution containing the expression vector or adeno-associated virus packaged with the expression vector.
6. Use according to claim 4, characterized in that: the medicine adopts a nasal administration mode.
7. Use of an expression vector according to claim 1 for the preparation of a medicament for the prevention and/or treatment of hypoxia and/or ischemia related diseases, characterized in that: the disease is selected from one or more of diabetic gangrene, deep vein thrombosis and ischemic heart disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911066809.3A CN110714028B (en) | 2019-11-04 | 2019-11-04 | Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911066809.3A CN110714028B (en) | 2019-11-04 | 2019-11-04 | Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110714028A CN110714028A (en) | 2020-01-21 |
| CN110714028B true CN110714028B (en) | 2021-08-31 |
Family
ID=69214725
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911066809.3A Active CN110714028B (en) | 2019-11-04 | 2019-11-04 | Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110714028B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101117637A (en) * | 2006-07-31 | 2008-02-06 | 中国人民解放军军事医学科学院毒物药物研究所 | Strict hypoxia targeting carrier and uses thereof |
| CN101443049A (en) * | 2006-02-23 | 2009-05-27 | 脉管生物生长有限公司 | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| CN101532027A (en) * | 2007-12-14 | 2009-09-16 | 首都医科大学 | Hypoxia inducible eukaryotic gene expression vector and application thereof |
| KR20100017114A (en) * | 2007-04-30 | 2010-02-16 | 바스큘라 바이오제닉스 리미티드 | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| EP2301586A1 (en) * | 2004-11-14 | 2011-03-30 | Vascular Biogenics Ltd. | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| CN102532265A (en) * | 2011-12-29 | 2012-07-04 | 中国人民解放军第四军医大学 | Gramicidin, isomer thereof and application thereof |
| CN103314107A (en) * | 2010-10-08 | 2013-09-18 | 汉阳大学校产学协力团 | Gene delivery system having enhanced tumor-specific expression, and recombinant gene expression regulating sequence |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11512326B2 (en) * | 2009-05-26 | 2022-11-29 | University Of Florida Research Foundation, Incorporated | Small angiotensin peptide expression system in mammalian cells |
-
2019
- 2019-11-04 CN CN201911066809.3A patent/CN110714028B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2301586A1 (en) * | 2004-11-14 | 2011-03-30 | Vascular Biogenics Ltd. | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| CN101443049A (en) * | 2006-02-23 | 2009-05-27 | 脉管生物生长有限公司 | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| CN101117637A (en) * | 2006-07-31 | 2008-02-06 | 中国人民解放军军事医学科学院毒物药物研究所 | Strict hypoxia targeting carrier and uses thereof |
| KR20100017114A (en) * | 2007-04-30 | 2010-02-16 | 바스큘라 바이오제닉스 리미티드 | Promoters exhibiting endothelial cell specificity and methods of using same for regulation of angiogenesis |
| CN101532027A (en) * | 2007-12-14 | 2009-09-16 | 首都医科大学 | Hypoxia inducible eukaryotic gene expression vector and application thereof |
| CN103314107A (en) * | 2010-10-08 | 2013-09-18 | 汉阳大学校产学协力团 | Gene delivery system having enhanced tumor-specific expression, and recombinant gene expression regulating sequence |
| CN102532265A (en) * | 2011-12-29 | 2012-07-04 | 中国人民解放军第四军医大学 | Gramicidin, isomer thereof and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Ang-(1-7)与肺高压状态下肺血管平滑肌细胞的增生;陈丽星;《中国组织工程研究与临床康复》;20110312;第15卷(第11期);第1998-2001页 * |
| Angiotensin-(1-7) Reverses Angiogenic Dysfunction In Corpus Cavernosum By Acting On The Microvasculature And Bone Marrow-Derived Cells In Diabetes;Neha Singh等;《J Sex Med.》;20140930;第11卷(第9期);第2153-2163页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110714028A (en) | 2020-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fujio et al. | Stromal cell-derived factor-1 enhances distraction osteogenesis-mediated skeletal tissue regeneration through the recruitment of endothelial precursors | |
| CN113278591B (en) | Cardiac targeting genetic engineering exosome and preparation method and application thereof | |
| CN110714028B (en) | Controllable up-regulation Ang- (1-7) targeting expression vector for preventing and treating hypoxic pulmonary hypertension | |
| CN111494634B (en) | Nucleic acid medicine for treating chronic pain | |
| CN108187029B (en) | Application of member 4 of immunoglobulin-like receptor subfamily B of leucocyte in preparing medicament for preventing, relieving and/or treating myocardial hypertrophy | |
| CN110755450B (en) | Application of extracellular vesicles derived from mesenchymal stem cells in treatment of subarachnoid hemorrhage | |
| CN105457015A (en) | Medical uses of recombinant CREG protein in inhibition of vascular remodeling in hypertension | |
| EP4275703A1 (en) | Use of pd1 inhibitor in preparation of cardiac fibroblast transdifferentiation inhibitor | |
| CN110437311A (en) | A kind of polypeptide and its application | |
| CN110885856B (en) | Expression vector for controllably up-regulating ACE2 targeting prevention and treatment of hypoxic pulmonary hypertension | |
| CN115369077A (en) | MEFLC cell strain, and construction method and application thereof | |
| CN114432332A (en) | Application of circUTRN in preparation of medicine for treating heart failure, recombinant vector and medicine for treating heart failure | |
| CN108904782A (en) | CTRP3 is used to prepare the application of prophylactic treatment myocardial hypertrophy drug | |
| CN112043721B (en) | Application of miR-132-5p in preparation of nerve regeneration medicine or material | |
| CN108721314A (en) | Compound EPZ5676 and its related inhibitors are preparing the purposes in preventing pulmonary fibrosis disease drug | |
| CN115137740B (en) | Application of miRNA-497b or miRNA-5106 in preparation of medicines for treating ischemic myocardium | |
| CN109971786B (en) | Nucleopore protein Nup54, vector thereof and application of recombinant adenovirus | |
| CN108379555A (en) | Applications of the FGF21 in the drug for preparing hypertension and/or angiosis damage that treatment is caused by angiotensinⅡ | |
| Qi et al. | Application of hNGFβ-modified adipose-derived stem cells in treating cavernous nerve injury-induced erectile dysfunction in rat models | |
| CN116790612B (en) | Peroxisome germinal protein 3 for promoting myocardial regeneration and repair and application thereof | |
| CN114588264B (en) | Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia reperfusion injury drugs | |
| CN114517209B (en) | Circular RNA circTTC3 over-expression adeno-associated virus vector, adeno-associated virus and application thereof | |
| CN113577285B (en) | Application of SLC25A26 in preparation of medicine for inhibiting myocardial hypertrophy | |
| CN111840327B (en) | Mesenchymal stem cell preparation for treating diabetic foot and application thereof | |
| Sheng et al. | Mechanisms of IL-6 mediated early inflammation in cardiac regeneration of neonatal mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |