CN111494634B

CN111494634B - Nucleic acid medicine for treating chronic pain

Info

Publication number: CN111494634B
Application number: CN202010491939.8A
Authority: CN
Inventors: 周诚; 朱涛; 阳垚鑫; 张东航; 欧梦婵
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-06-02
Filing date: 2020-06-02
Publication date: 2021-09-10
Anticipated expiration: 2040-06-02
Also published as: CN111494634A

Abstract

The invention discloses a nucleic acid medicine for treating chronic pain, and belongs to the field of analgesic medicines. The active component of the nucleic acid medicament is siRNA or shRNA for inhibiting NALCN expression, and the siRNA or shRNA is combined with a specific liposome, a cationic polymer micelle or an adeno-associated virus vector, so that the nucleic acid medicament can effectively treat neuropathic pain and inflammatory pain, and has long duration of medicament effect. The medicine of the invention is expected to replace the existing analgesic medicine and has good application prospect.

Description

Nucleic acid medicine for treating chronic pain

Technical Field

The invention belongs to the field of analgesic drugs.

Background

Pain is a protective reflex that allows the body to escape harmful stimuli. Pain that is inappropriately amplified or prolonged, or that develops below the stimulus that normally causes pain, even in the absence of an external stimulus, is referred to as pathological pain. Pain is a common accompanying symptom of many diseases. Pain can be classified into acute pain and chronic pain according to the time course and nature of the pain. Acute pain generally disappears as the primary disease heals, usually less than 3 months. If acute pain is not effectively controlled, chronic pain can be developed in a delayed way, and the time course is generally more than 3 months. Chronic pain is also a disease in itself and one of the most major health-threatening diseases in humans. It is statistical that chronic pain affects about 30% of the population, placing a severe burden on patients, families and society. Neuropathic pain and inflammatory pain are two major types of chronic pain.

Neuropathic pain is a particular type of chronic pain that is caused by damage or dysfunction of the nervous system. In addition to direct damage to the nervous system, neuropathic pain can be caused by tumors, diabetes, viral infections, and the like. It is statistical that neuropathic pain affects approximately 7-10% of the world population. At present, neuropathic pain is treated mainly by oral medication. The clinically used drugs mainly include anticonvulsants (such as gabapentin), tricyclic antidepressants (such as amitriptyline), opioids, and the like. However, the existing drugs have poor treatment effect on neuropathic pain, and the use of opioid drugs can cause problems of potential addiction, drug abuse and the like. As a result, patients with neuropathic pain are often distressed. Meanwhile, because of lasting pain symptoms, patients suffering from neuropathic pain are often accompanied by problems of anxiety, depression, sleep disorder and the like, so that the treatment difficulty of the neuropathic pain is further increased, and the daily life and social functions of the patients are seriously affected. The underlying reason why the therapeutic status of neuropathic pain is unsatisfactory is that the exact molecular mechanism by which it occurs is not fully understood.

Chronic inflammatory pain (i.e., inflammatory pain) is another major type of chronic pain. Inflammatory pain is primarily associated with injury and inflammation of peripheral tissues. Previous studies have shown that oxidative stress and neuroinflammation are the major mechanisms of chronic inflammatory pain. Chronic inflammatory pain is involved in the progression of many diseases. Similar to neuropathic pain patients, chronic inflammatory pain patients have the problems of sleep disorder, anxiety and the like besides the lasting pain experience, the work and the life of the patients are seriously influenced, and huge burden is brought to the society. At present, the inflammatory pain is mainly oral drugs, and the clinical common drugs comprise non-steroidal anti-inflammatory drugs, steroids, opioids and the like, but the general treatment status is not satisfactory, and the side effects are obvious.

In order to overcome the defects of the existing analgesic drugs, people continuously explore and try novel analgesic drugs, but find suitable substitutes for treating chronic pain. Such as: the endogenous cannabinoid analog 2-AG (2-arachidonic acid glycerol) can play an analgesic role in various animal models, such as acute pain, inflammatory pain and neuropathic pain models, and research on the action mechanism of the endogenous cannabinoid analog 2-AG can indicate that the participation of the 2-AG in analgesia possibly involves multiple aspects of calcium ion channels, glutamic acid, r-aminobutyric acid and the like, but research indicates that the analgesic effective time of the 2-AG is less than 1 hour (research on the analgesic mechanism of the endocannabinoid ligand 2-AG at the spinal cord level of rats, fourth university of military medicine, 2014) and is not enough to treat chronic pain. The gastrodine is one of main active ingredients in Chinese herbal medicine 'gastrodia elata', can clinically relieve trigeminal neuralgia, migraine, diabetic neuralgia, vascular headache and the like, and researches show that single intrathecal injection of 10mM gastrodine to a rat inflammatory pain model can approximately maintain the analgesic effect for 6 hours, and the analgesic mechanism of the gastrodine can inhibit the release of a pre-synaptic neurotransmitter so as to play an inhibiting role in enhancing the excitability of postsynaptic neurons (the analgesic effect and the synaptic mechanism of the gastrodine in spinal cord dorsal horn research, the fourth university of military medical science 2015).

NALCN (Sodium leak channel non-selective protein, Unit part: Q8IZF0) is a relatively new background cation current leakage channel discovered in more than ten years, and is mainly permeable to Sodium ions in the resting state. No studies have been found to study the relationship between NALCN ion channels and chronic pain.

RNA interference technology (RNAi) is a revolutionary advance in gene research, and the discovery of mechanisms for specifically silencing target genes has greatly advanced the development of gene regulatory technologies, particularly in small interfering RNA (sirna) therapies. siRNA is a double stranded RNA of about 20-25 nucleotides in length. siRNA is an important tool for studying gene function and is now a potential therapeutic approach for many diseases. In animal models, siRNA has been shown to be useful for treating diseases. In 2018, the FDA approved the first siRNA drug, pacifiran, indicating that siRNA therapy is formally entering the clinic. The biggest difficulty of siRNA treatment is not how to design siRNA, but to prepare suitable carriers to deliver siRNA to target area safely and efficiently.

The shRNA consists of two short inverted repeats separated by a stem-loop (loop) sequence to form a hairpin structure. shRNA can enter cells by cloning into an expression vector, and then plays a role in RNA interference by generating siRNA through enzyme digestion, and is a nucleic acid commonly used for RNAi. Adeno-associated viruses (AAV) are a non-pathogenic single-stranded linear DNA-deficient virus. AAV cannot replicate independently, and can replicate only in the presence of helper viruses (e.g., adenovirus, herpes simplex virus, etc.). AAV vector is a vector for artificial transgene generated by gene modification of naturally occurring AAV.

Disclosure of Invention

The invention aims to solve the problems that: provides a nucleic acid medicament for treating chronic pain and application of an NALCN inhibitor in preparing a medicament for treating chronic pain.

The term "NALCN inhibitor" refers to: specifically recognizing NALCN gene or NALCN protein, and inhibiting NALCN gene expression or inhibiting NALCN protein from functioning.

The technical scheme of the invention is as follows:

a medicament for the treatment of chronic pain, the active ingredient of which is a NALCN inhibitor.

As in the aforementioned drugs, the active ingredient of the drug is siRNA or shRNA that inhibits the expression of NALCN.

The siRNA takes liposome or cationic polymer micelle as a carrier, and the carrier is fixed with polypeptide targeting DRG (Dorsalrootganglia, dorsal root ganglion); preferably, the DRG-targeting polypeptide sequence is shown in any one of SEQ ID NO. 13-15.

The preparation method of the liposome comprises the following steps:

1) connecting the DRG-targeted polypeptide with PEG-DSPE to obtain the DRG-targeted polypeptide-PEG-DSPE;

2) dissolving DOTAP, cholesterol, soybean lecithin, DSPE-mPEG2000 and targeted DRG polypeptide-PEG-DSPE together in chloroform at a molar ratio of 8-12: 30-40: 35-45: 8-12: 3-7, and performing rotary reduced pressure evaporation to remove the chloroform to obtain a lipid film;

3) washing the lipid film with 5% glucose solution to obtain liposome stock solution;

4) sequentially passing the obtained liposome stock solution through polycarbonate membranes of 500nm and 100nm for 10 cycles respectively to perform extrusion operation;

preferably, the molar ratio of DOTAP, DOPE, cholesterol, mPEG-DSPE and the targeting DRG polypeptide-PEG-DSPE in step 2) is 10:35:40:10: 5.

The preparation method of the cationic polymer micelle comprises the following steps:

1) connecting the polypeptide targeting dorsal root ganglion with PEG-PCL to obtain targeting DRG polypeptide-PEG-PCL;

2) dissolving PEG-PCL with the molar ratio of 4-16: 1-2, targeting DRG polypeptide-PEG-PCL and PEI-PCL in tetrahydrofuran, and injecting into deionized water under a stirring state;

3) dialyzing at room temperature to obtain;

preferably, the molar ratio in step 2) is 8: 1.

As for the medicine, the siRNA sequence is shown in SEQ ID NO. 1.

The shRNA sequence comprises a sequence shown as SEQ ID NO. 16; preferably, the shRNA is obtained by heating and denaturing DNA single-strands with sequences shown in SEQ ID NO.27 and 28, and then cooling and annealing.

As the medicine, the shRNA takes the recombinant virus as a vector; preferably, the recombinant virus is a recombinant adeno-associated virus.

Use of a NALCN inhibitor for the manufacture of a medicament for the treatment of chronic pain.

For use as aforesaid, the chronic pain is neuropathic pain or inflammatory pain.

As previously described, the NALCN inhibitor is an siRNA or shRNA that inhibits the expression of NALCN.

The siRNA uses liposome or cationic polymer micelle as a carrier, and the carrier is fixed with polypeptide targeting DRG; preferably, the polypeptide sequence of the targeted dorsal root ganglion is shown in any one of SEQ ID NO. 13-15.

The liposome is prepared by the following method according to the application:

3) dialyzing at room temperature to obtain;

preferably, the molar ratio in step 2) is 8: 1.

As for the application, the siRNA sequence is shown in SEQ ID NO. 1.

As for the application, the shRNA sequence comprises a sequence shown in SEQ ID NO. 16; preferably, the shRNA is obtained by heating and denaturing DNA single-strands with sequences shown in SEQ ID NO.27 and 28, and then cooling and annealing.

As for the application, the shRNA takes a recombinant virus as a vector; preferably, the recombinant virus is a recombinant adeno-associated virus.

Chronic pain is often refractory, and the underlying cause is that the pain mechanism is very complex and is not completely understood by people.

The inventor creatively takes NALCN as a target to prepare a series of medicaments, and can effectively treat chronic pain. Compared with the existing medicine for treating chronic pain, the medicine of the invention has better effect and longer drug effect, does not influence the sensory function of animals (including human) in physiological state, is safe and reliable, is a specific medicine for treating chronic pain by means of a brand new mechanism, and is expected to replace the existing medicine for treating chronic pain.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1: fluorescence in DRG neurons (NALCN-siRNA carrying AlexaFluor 488 fluorescent dye) was detected following NALCN-siRNA DRG injection.

FIG. 2: fluorescence in dorsal horn of spinal cord (NALCN-siRNA carries AlexaFluor 488 fluorescent dye) was detected following intrathecal injection of NALCN-siRNA.

FIG. 3: fluorescence in DRG (NALCN-siRNA carrying AlexaFluor 488 fluorescent dye) was detected after NALCN-siRNA tail vein injection.

FIG. 4: and after AAV-NALCN-shRNA DRG injection, detecting the expression of green fluorescent protein in DRG neurons.

FIG. 5: and after the AAV-NALCN-shRNA is injected in the sheath, detecting the expression of the green fluorescent protein in the dorsal horn of the spinal cord.

FIG. 6: and after AAV-NALCN-shRNA tail intravenous injection, detecting the expression of the green fluorescent protein in the DRG.

FIG. 7: effect of DRG injection of NALCN-siRNA on CCI-induced mechanical and thermal pain. Effect of drg injection of NALCN-siRNA on CCI-induced mechanical pain (n ═ 6). Effect of drg injection of NALCN-siRNA on CCI-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi control.

FIG. 8: effect of intrathecal injection of NALCN-siRNA on CCI induced mechanical and thermal pain. a. Effect of intrathecal injection of NALCN-siRNA on CCI-induced mechanical pain (n ═ 6). b. Effect of intrathecal injection of NALCN-siRNA on CCI-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi + control.

FIG. 9: effect of intravenous NALCN-siRNA on CCI-induced mechanical and thermal pain. a. Effect of intravenous NALCN-siRNA on CCI-induced mechanical pain (n ═ 6). b. Effect of intravenous NALCN-siRNA on CCI-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi control.

FIG. 10: effects of DRG injection of AAV-NALCN-shRNA on CCI-induced mechanical and thermal pain. Effect of drg injection of AAV-NALCN-shRNA on CCI-induced mechanical pain (n ═ 6). Effect of drg injection of AAV-NALCN-shRNA on CCI-induced thermalgia (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi + control.

FIG. 11: effect of intrathecal injection of AAV-NALCN-shRNA on CCI-induced mechanical and thermal pain. a. Effect of intrathecal injection of AAV-NALCN-shRNA on CCI-induced mechanical pain (n ═ 6). b. Effect of intrathecal injection of AAV-NALCN-shRNA on CCI-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi + control.

FIG. 12: effect of intravenous injection of AAV-NALCN-shRNA on CCI-induced mechanical and thermal pain. a. Effect of intravenous injection of AAV-NALCN-shRNA on CCI-induced mechanical pain (n ═ 6). b. Effect of intravenous injection of AAV-NALCN-shRNA on CCI-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CCI-conttra: CCI control side; CCI-ipsi: CCI model side. P < 0.05 compared to CCI-ipsi + control.

FIG. 13: effect of DRG injection of NALCN-siRNA on CFA-induced mechanical and thermal pain. Effect of drg injection of NALCN-siRNA on CFA-induced mechanical pain (n ═ 6). Effect of drg injection of NALCN-siRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsi + control.

FIG. 14: effect of intrathecal injection of NALCN-siRNA on CFA-induced mechanical and thermal pain. a. Effect of intrathecal injection of NALCN-siRNA on CFA-induced mechanical pain (n ═ 6). b. Effect of intrathecal injection of NALCN-siRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsi + control.

FIG. 15: effect of intravenous NALCN-siRNA on CFA-induced mechanical and thermal pain. a. Effect of intravenous NALCN-siRNA on CFA-induced mechanical pain (n ═ 6). b. Effect of intravenous NALCN-siRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsi + control.

FIG. 16: effects of DRG injection of AAV-NALCN-shRNA on CFA-induced mechanical and thermal pain. Effect of drg injection of AAV-NALCN-shRNA on CFA-induced mechanical pain (n ═ 6). Effect of drg injection of AAV-NALCN-shRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsicntrol.

FIG. 17: effect of intrathecal injection of AAV-NALCN-shRNA on CFA-induced mechanical and thermal pain. a. Effect of intrathecal injection of AAV-NALCN-shRNA on CFA-induced mechanical pain (n ═ 6). b. Effect of intrathecal injection of AAV-NALCN-shRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsicntrol.

FIG. 18: effect of intravenous injection of AAV-NALCN-shRNA on CFA-induced mechanical and thermal pain. a. Effect of intravenous injection of AAV-NALCN-shRNA on CFA-induced mechanical pain (n ═ 6). b. Effect of intravenous injection of AAV-NALCN-shRNA on CFA-induced thermal pain (n ═ 6). Data are represented by mean +/-standard error; CFA-conttra: CFA control side; CFA-ipsi: CFA model side. P < 0.05 compared to CFA-ipsicntrol.

FIG. 19: effect of intravenous NALCN-siRNA on heart. a. Effect of intravenous NALCN-siRNA on cardiac left ventricular ejection fraction (n ═ 6). b. Effect of intravenous NALCN-siRNA on cardiac NALCN expression (n ═ 6). Data are represented by mean +/-standard error; control: before control-siRNA injection in the control group; control 2: after the control group is injected with control-siRNA; siRNA 1: before NALCN-siRNA injection in experimental groups; siRNA 2: experimental groups were injected with NALCN-siRNA. n.s.: there were no statistical differences.

FIG. 20: effect of intravenous injection of AAV-NALCN-shRNA on heart. a. Effect of intravenous injection of AAV-NALCN-shRNA on cardiac left ventricular ejection fraction (n ═ 6). b. Effect of intravenous injection of AAV-NALCN-shRNA on cardiac NALCN expression (n ═ 6). Data are represented by mean +/-standard error; control 1: before the control group is injected with control-shRNA; control 2: after the control group is injected with control-shRNA; siRNA 1: before AAV-NALCN-shRNA is injected into an experimental group; siRNA 2: after AAV-NALCN-shRNA is injected into the experimental group. n.s.: there were no statistical differences.

FIG. 21: effect of NALCN-siRNA transfection of rat DRG neurons in vitro. Effect of NALCN-siRNA on expression of NALCN in DRG neurons (n ═ 6). Effect of nalcn-siRNA on DRG neuron RMP (n ═ 8). Data are represented by mean +/-standard error; RMP: resting membrane potential; p < 0.05.

FIG. 22: AAV-NALCN-shRNA transfection of rat DRG neurons in vitro. Effect of aav-NALCN-shRNA on DRG neuronal NALCN expression (n ═ 6). Effect of aav-NALCN-shRNA on DRG neuron RMP (n ═ 8). Data are represented by mean +/-standard error; RMP: resting membrane potential; p < 0.05.

Detailed Description

Example 1 design, Synthesis and screening of siRNA sequences

By querying mRNA information of rat NALCN gene (NM — 153630.1) in GeneBank database, 9 siRNA sequences against rat NALCN gene were designed:

through experimental screening, the best one with the sequence as follows is determined: sense strand: 5'-CGAGUAUAUUCACAGUCUAUG-3' (SEQ ID NO. 1); antisense strand: 5'-UAGACUGUGAAUAUACUCGUG-3' (SEQ ID NO. 10). A control sequence, a sense strand: 5'-CAGGUUAAUCUAACGUUCAGU-3' (SEQ ID NO. 11); antisense strand: 5'-UGACAUGUAUUAAUCCGUC-3' (SEQ ID NO. 12). The siRNA was synthesized and then AlexaFluor 488-labeled at its 3' end for observation under a fluorescent microscope.

It should be noted that the substitution of the base U in the aforementioned sequences SEQ ID NO. 1-12 with the base T is a conventional equivalent substitution in the art.

Example 2 Synthesis, purification and characterization of Targeted DRG polypeptide-PEG-DSPE

The targeting DRG polypeptide-PEG-DSPE is a polymer with polypeptide, wherein the amino acid sequence of the polypeptide is SPGARAF (SEQ ID NO. 13). The specific synthesis method comprises the following steps:

1) synthesis, purification and characterization of targeting DRG polypeptide-Cys

0.52g (degree of substitution 0.8mmol/g) of MBHA resin (4-toluenehydroamine resin) was weighed into a peptide connecting bottle, the resin was swelled with DMF, and after twenty minutes, Boc-Cys (Acm) activating solution (activated with HBTU in DMF and DIEA) was added, followed by shaking. After the reaction was completed, the reaction solution was taken out, and the resin was washed with DMF. The reaction was stirred by adding about twice the resin volume of TFA, withdrawing TFA, and then adding TFA once to remove the Boc protecting group. The DRG polypeptide amino acid Sequence (SPGARAF) is then targeted in the above described manner followed by the remaining amino acids and finally Boc-cys (mbzl). After the reaction, the resin was washed and TFA deprotected as described above. The resin was washed successively with DMF, DCM/MeOH and dried in vacuo. Putting the resin into a polypeptide cutting tube, adding a proper amount of P-cresol, introducing HF, and stirring in an ice bath for reaction for 1 hour. After the reaction is finished, the HF in the tube is removed by decompression, the residual liquid is precipitated by a proper amount of ethyl acetate, the precipitate is obtained by filtration, and the precipitate is washed by ethyl acetate for 3 times. The precipitate was again dissolved with TFA and filtered to give a filtrate. Precipitating the filtrate in glacial ethyl ether, filtering by using a sand core funnel, discarding the filtrate, redissolving the precipitate by using water, and freeze-drying to obtain a pure target DRG polypeptide-Cys product, and characterizing the pure target DRG polypeptide-Cys product by using HPLC and Ms.

2) Synthesis, purification and characterization of DRG targeting polypeptide (amino acid sequence SPGARAF) -PEG-DSPE

And (3) dissolving the target DRG polypeptide-Cys obtained in the step in a phosphate buffer (pH 7.4), wherein the amino acid sequence of the DRG polypeptide is SPGARAF. Dissolving MAL-PEG-DSPE (maleimide-polyethylene glycol-distearoyl phosphatidyl ethanolamine) in DMF, mixing the two, performing magnetic stirring reaction, performing TLC thin layer chromatography) to monitor the reaction, stopping the reaction after the MAL-PEG-DSPE completely reacts, and removing excessive target DRG polypeptide-Cys and DMF by dialysis (with molecular weight cut-off of 5.0 kDa). And (5) freeze-drying to obtain the target DRG polypeptide-PEG-DSPE.

Abbreviation:

cys: cysteine

DMF: dimethyl formamide

Boc: tert-butyloxycarbonyl radical

TFA: trifluoroacetic acid

HBTU: tetramethylurea hexafluorophosphate ester

Mbzl: methyl benzyl radical

DCM: methylene dichloride

HF: hydrofluoric acid

Example 3 preparation of Targeted liposomes for siRNA

The method comprises the following steps:

1) weighing DOTAP, DOPE, cholesterol, mPEG-DSPE and targeting DRG polypeptide-PEG-DSPE at a molar ratio of 10:45:30:10:5 in a flask, wherein the amino acid sequence of the DRG polypeptide is SPGARAF. Dissolving completely with chloroform, and rotary evaporating at 40 deg.C under reduced pressure to remove chloroform to form uniform lipid film.

2) Measuring a certain volume of 5% glucose solution, placing the solution into a rotary evaporation bottle for hydration, and shaking the bottle body to make the lipid film hydrated and fall off to obtain a liposome stock solution.

3) And (3) sequentially passing the obtained liposome stock solution through 10 cycles of polycarbonate membranes of 500nm and 100nm respectively to perform extrusion operation, thus obtaining blank liposome suspension.

4) Mixing the blank liposome suspension with the siRNA solution, and standing the mixed solution at room temperature for 30min to obtain the siRNA-loaded targeted liposome preparation.

5) The siRNA-loaded targeted liposome formulation was subjected to particle size determination and potential determination using a particle size analyzer (Malvern Zetasizer NanoZS90) and found to have an average particle size of 157.62nm and a potential of +21.2 mV.

Abbreviation:

DOTAP: (2, 3-dioleoyl-propyl) trimethylammonium chloride

DOPE: dioleoyl phosphatidylethanolamine

DSPE: distearoylphosphatidylethanolamine

DSEP-mPEG 200: polyethylene glycol 2000 modified distearoyl phosphatidyl ethanolamine

PEI: polyethylene imine

PCL: polycaprolactone esters

PLGA: poly (glycolide-lactide)

PEG: polyethylene glycol

PLA: polylactic acid

Examples 4-7 preparation of siRNA-loaded Targeted liposomes

The method comprises the following steps:

1) the adjuvants in the amount prescribed in Table 1 were weighed in a flask, dissolved completely with chloroform, and evaporated under reduced pressure at 40 ℃ to remove chloroform, thereby forming a uniform lipid film.

3) And (3) sequentially passing the obtained liposome stock solution through 10 cycles of polycarbonate membranes of 500nm and 100nm respectively to perform extrusion operation, thus obtaining blank cationic liposome suspension.

4) Mixing the blank cationic liposome suspension with the siRNA solution, and standing the mixed solution at room temperature for 30min to obtain the siRNA-loaded cationic liposome preparation.

TABLE 1 Liposome prescription amounts

Remarks 1: wherein the DRG polypeptide amino acid sequence is SPGARAF.

Example 8 Synthesis, purification and characterization of Targeted DRG polypeptide-PEG-PCL

The method comprises the following steps:

1) synthesis, purification and characterization of target DRG polypeptide (amino acid sequence DGPWRKM, [ SEQ ID NO.14]) -Cys

Weighing MBHA resin (0.8 g of 4-toluenehydroamine resin (with the substitution degree of 0.8mmol/g) into a peptide connecting bottle, swelling the resin with DMF, adding Boc-Cys (Acm) activating solution (activated by DMF solution of HBTM and DIEA) after twenty minutes, shaking for reaction, after the reaction is finished, pumping out the reaction solution, washing the resin with DMF, adding TFA with about twice the volume of the resin, stirring for reaction, pumping out TFA, adding TFA once, performing the same operation, removing Boc protecting groups, connecting the rest amino acids in sequence by the above method targeting DRG polypeptide amino acid sequence (DGPWRKM), finally connecting Boc-Cys (Mbzl), after the reaction is finished, washing the resin and TFA by the above method, removing protecting groups, washing the resin with DMF, DCM/MeOH in sequence, drying in vacuum, putting the resin into a polypeptide cutting tube, adding a proper amount of P-cresol, then introducing HF, stirring for 1 hour in ice bath, pumping out HF in the tube after the reaction is finished, the residue was precipitated with a suitable amount of glacial ethyl ether, filtered to give a precipitate and the precipitate was washed with glacial ethyl ether 3 times. The precipitate was again dissolved with TFA and filtered to give a filtrate. Precipitating the filtrate in glacial ethyl ether, filtering by using a sand core funnel, discarding the filtrate, redissolving the precipitate by using water, and freeze-drying to obtain a pure target DRG polypeptide-Cys product, and characterizing the target DRG polypeptide-Cys product by using HPLC and MS.

2) Synthesis, purification and characterization of DRG targeting polypeptide-PEG-PCL

And (3) dissolving the target DRG polypeptide-Cys obtained in the step in a PBS solution (pH 7.0), wherein the amino acid sequence of the DRG polypeptide is DGPWRKM. Dissolving MAL-PEG-PCL (maleimide-polyethylene glycol-polycaprolactone) in DMF, mixing the two, performing magnetic stirring reaction, performing TLC thin layer chromatography) to monitor the reaction, stopping the reaction after the Mal-PEG-PLGA reaction is completed, and removing excessive target DRG polypeptide-Cys and DMF by dialysis (the molecular weight cut-off is 3.5 kDa). And (5) freeze-drying to obtain the target DRG polypeptide-PEG-PCL.

EXAMPLE 9 preparation of siRNA-loaded cationic Polymer formulations

The method comprises the following steps:

1) PEG-PCL with the molar ratio of 8: 1, targeting DRG polypeptide-PEG-PCL (same as example 8) and PEI-PCL are weighed and dissolved in tetrahydrofuran, wherein the amino acid sequence of the DRG polypeptide is DGPWRKM. This solution was injected into deionized water with stirring.

2) And (3) placing the solution obtained in the step 1 into a dialysis bag, and dialyzing in deionized water for 24 hours at room temperature to obtain the blank polymer micelle suspension.

3) And mixing the blank polymer micelle suspension and siRNA solution by 1ml respectively, and standing the mixed solution at room temperature for 30min to obtain the siRNA-loaded cationic polymer preparation.

4) The siRNA-loaded cationic polymer formulation was subjected to particle size determination and potential determination using a particle size analyzer (Malverm Zetasizer NanoZS90) and found to have an average particle size of 97.31nm and a potential of +15.1 mV.

Examples 10-13 preparation of siRNA-loaded cationic Polymer formulations

The method comprises the following steps:

1) the amount of the adjuvant specified in Table 2 was weighed out and dissolved in tetrahydrofuran, and the solution was injected into deionized water with stirring.

TABLE 2 cationic polymer formulation carrying siRNA

Remarks 1: wherein the DRG polypeptide amino acid sequence is FGQKASS (SEQ ID NO. 15).

Example 14 design, Synthesis and screening of shRNA sequences

The mRNA information of the rat NALCN gene is inquired through a GeneBank database, 11 shRNAs aiming at the rat NALCN gene are designed according to shRNA design principles, and the sense strand sequences are as follows:

the sequence shown in SEQ ID NO.16 is found to be optimal through experiments, and the sequence of the sense strand is obtained by adding a sticky end to the upstream and downstream of the sequence: 5' -

CCGGGCTGACATACTCTGGATTAATTTCAAGAGAATTAATCCAGAGTATGTCAGCTTTTTTGGTACC-3' (SEQ ID NO.27, underlined is SEQ ID NO.16, wherein the double line is a loop structure); based on the sense strand sequence, the antisense strand was obtained as: 5'-AATTGGTACCAAAAAGCTGACATACTCTGGATTAATTCTCTTGAAATTAATCCAGAGTATGTCAGC-3' (SEQ ID NO. 28); meanwhile, an irrelevant control shRNA is designed, and the sense strand of the irrelevant control shRNA is as follows: 5'-CCGGGTTGCCATCCGCTGTATTCATTTCAAGAGAATGAATACAGCGGATGGCAACTTTTTTGGTACC-3' (SEQ ID NO. 29); the antisense strand is: 5'-AATTGGTACCAAAAAGTTGACATACTCTGGATTAATTCTCTTGAAATTAATCCAGAGTATGTCAGC-3' (SEQ ID NO. 30).

It is noted that the substitution of base T to base U in SEQ ID NO. 16-30 is a routine equivalent in the art.

The shRNA double-stranded template is synthesized by the sense strand and the antisense strand according to the following method:

1) mu.L of sense strand (100. mu.M) and 5. mu.L of antisense strand (100. mu.M) DNA were mixed, 10. mu.L of 5 XannexingBufferfDNAOligs were added, and then 30. mu.L of double distilled water was added.

2) Annealing was performed on a PCR apparatus according to the following procedure

After annealing, the shRNA double-stranded template with the concentration of 10 mu M is obtained, and the concentration is diluted to 200nM for the ligation reaction.

Example 15 preparation of shRNA recombinant AAV (adeno-associated Virus)

The method comprises the following steps:

1) the vector paov. syn. gfp was linearized by digestion with Esp 3I: mu.g of pAOV. SYN. GFP vector, 5. mu.L of LEsp3I endonuclease and 10. mu.L of 2 XBuffer Tango were added with double distilled water to 100. mu.L and mixed, reacted at 37 ℃ for 1 hour, and subjected to agarose electrophoresis, and the linear vector fragment was recovered using AgaroseGel DNA Purification Kit Ver2.0 and diluted to a concentration of 50 ng/. mu.L.

2) mu.L of linearized pAOV. SYN. GFP vector, 1. mu.L shRNA template (100nM), 1. mu.L LT4DNA ligase (5 weissM/. mu.L), 2. mu.L of 10 XT 4 ligation buffer and 15. mu.L of double distilled water were mixed well and reacted at 22 ℃ for 1h to form a ligation product. mu.L of the ligation product was used to transform competent cells of E.coli Top10, and the cells were then spread evenly on LB medium plate containing Ampicillin (50. mu.g/ml), and the medium plate was inverted and cultured in an incubator at 37 ℃ for 16 hours. 5 colonies were picked from each plate and inoculated into LB medium containing Ampicillin (50. mu.g/ml), and cultured at 37 ℃ for 16 hours. Then extracting the plasmid by an alkaline lysis method, carrying out single enzyme digestion identification on the obtained plasmid by SmaI, and preparing the recombinant plasmid after sequencing identification.

3) The pAAV-RC capsid gene was modified using the AdEasy system to insert a peptide having the amino acid sequence SPGARAF between the 542 th and 543 th amino acids (BspEI site) of the HI loop of the resulting capsid fibrin, which peptide has DRG targeting effect.

4) The recombinant plasmid prepared above was ligated with pHelper (carrying adenovirus-derived gene) and pAAV-RC (carrying AAV-derived complex)Capsid gene) were transfected into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging), and the complex was mixed by gentle shaking of the plates. At 37 ℃ in 5% CO₂Overnight in a saturated humidity incubator. 24h after transfection, 10% serum DMEM medium (10ml) was replaced at 37 ℃ in 5% CO₂Culturing in a saturated humidity incubator, collecting and concentrating culture solution supernatant after transfection for 48 hours, and adding 10ml of fresh culture solution for continuous culture; and collecting and concentrating the supernatant of the culture solution again after transfection for 72H to obtain AAV virus particles (pAAV2-H1-shRNA (NALCN) -CAG-eGFP) containing the target shRNA sequence and having the DRG targeting effect.

5) Purifying the virus supernatant of step (5). Most of the cellular proteins and residual CsCl ions were removed by two CsCl density gradient centrifuges and 1 ultrafiltration.

6) The titer of AAV viral particles (pAAV2-H1-shRNA (NALCN) -CAG-eGFP) containing the shRNA sequence of interest was measured by the quantitative PCR method.

7) The AAV virus particle pAAV2-H1-shRNA (NALCN) -CAG-eGFP can be used for transfecting rat cells in vitro or injecting rat tissues in vivo to achieve the purposes of inhibiting NALCN gene expression and treating chronic pain.

Example 16 infection Effect of NALCN-siRNADRG injection

Adult male SPFSD rats were randomly divided into an experimental group, into which DRG was injected 2 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) described in example 4, and a control group, into which DRG was injected an equivalent amount of a control sequence. After 3 days, DRG was taken out and the infection effect was observed under a fluorescence microscope.

The specific method comprises the following steps:

DRG injection

The rats are anesthetized by sevoflurane and then placed in a prone position, the abdomen is padded up, and the waist and the back are arched. After skin preparation and disinfection, a 3-4 cm incision is made on the left side of the midline of the back by 0.5 cm, and the midpoint of the incision is flush with the highest point of the iliac crest. The fascia was cut open, the paraspinal muscles were bluntly separated, and the L4-L6 cones were exposed using a distractor. The rat was then changed to the right position, and the muscle, fascia, etc. on the L4-6 cone were removed, exposing the L4/5 and L5/6 intervertebral foramen. The membranous tissue overlying the foramen was gently dissected, exposing the exit of the spinal foramen. Rongeurs were used to enlarge the intervertebral foramen and remove the plate bone around the foramen, exposing L4 and L5 DRG. Then, DRG microinjection was performed using a 5 μ L microinjector (a glass electrode and a silicone grease seal interface were used for the microinjector) and a stereotaxic apparatus. When the tip of the glass electrode enters the DRG for about 100-. Then the muscle and the skin are sutured layer by layer. Stopping the anesthetic, placing on a heat preservation blanket, and returning to a cage for independent breeding after the righting reflex is recovered.

And (3) fluorescent microscope detection:

after rats were perfused with 4% paraformaldehyde heart, DRG was taken and dehydrated with 30% sucrose, followed by DRG cryosectioning and DRG infection was observed under a fluorescent microscope.

As shown in figure 1, AlexaFluor 488 fluorescence was observed under fluorescence microscopy, indicating that NALCN-siRNA DRG injection could efficiently infect DRG neurons.

Example 17 infection Effect of NALCN-siRNA intrathecal injection

Adult male SPFSD rats were randomly divided into an experimental group, which was intrathecally injected with 10 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) described in example 4, and a control group, which was intrathecally injected with an equal amount of a control sequence. Spinal cord sections were taken 3 days later and observed for infection effects under a fluorescence microscope.

The specific method comprises the following steps:

intrathecal injection

The rat is taken to lie on the stomach under the shallow anesthesia of sevoflurane, the abdomen is padded up, the waist and the back are arched, the skin is prepared and disinfected, the left hand is used for probing and the hip nodule is detected, and the horizontal position of the rat is the L5-6 spinous process gap of the rat. The left thumb and middle finger are placed on both sides of the spinous process space of rat L5-6, and the skin is tightened outwards. The needle is positioned by the forefinger, the 20 mu L microsyringe is held by the right hand and vertically inserted into the space above the vertebral column to pass through the intervertebral space, if the needle touches the sclerotin, the needle tip inclines towards the head side to continue to advance slowly, the side swing suddenly appearing at the tail of a mouse or the twitching suddenly appearing at the hind leg is taken as the successful mark of needle insertion, 10 mu L of medicine is injected, the tail flick action usually appears when the medicine is injected, the medicine injection time is about 5 seconds, and the needle is pulled out after the slight stop for 5 seconds.

As shown in fig. 2, spinal cord dorsal horn expresses green fluorescent protein, indicating that intrathecal injection of NALCN-siRNA can effectively infect spinal cord dorsal horn neurons.

Example 18 infection Effect of NALCN-siRNA intravenous injection

Adult male SPFSD rats were randomly divided into an experimental group and a control group, and the tail vein of the experimental group was injected with 80 μ g (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) described in example 1, and the control group was injected with an equal amount of the control sequence intravenously, and after 3 days, DRG was taken to observe the infection effect under a fluorescence microscope.

As shown in fig. 3, DRG neurons expressed green fluorescent protein, indicating that NALCN-siRNA intrathecal injection could effectively infect DRG neurons.

Example 19 infectious Effect of pAAV2-HI-shRNA (NALCN) -CAG-eGFP (AAV-NALCN-shRNA) DRG injection

Adult male SPFSD rats were randomly divided into experimental and control groups, and the experimental group DRG was injected with 2. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/ml), control group was injected intrathecally with an equal amount of AAV virus containing control sequences. After 1 month, DRG was taken and the effect of infection was observed under a fluorescent microscope.

As shown in FIG. 4, DRG neurons expressed green fluorescent protein, indicating that AAV-NALCN-shRNADRG injection could effectively infect DRG neurons.

Example 20 Effect of infection by intrathecal injection of AAV-NALCN-shRNA

Adult male SPFSD rats were randomly divided into experimental and control groups, and the experimental group was intrathecally injected with 10. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/ml), control group was injected intrathecally with an equal amount of AAV virus containing control sequences. Spinal cord sections were taken 1 month later and the effect of infection was observed under a fluorescence microscope.

As shown in FIG. 5, spinal cord dorsal horn expresses green fluorescent protein, indicating that AAV-NALCN-shRNA intrathecal injection can effectively infect spinal cord dorsal horn neurons.

Example 21 Effect of AAV-NALCN-shRNA infection by intravenous injection

Adult male SPFSD rats were randomly divided into experimental groups and control groups, and the experimental groups were injected caudal vein with 10. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/ml), control group was injected intravenously with an equal amount of AAV virus containing control sequences. After 1 month, DRG was taken and the effect of infection was observed under a fluorescent microscope.

As shown in FIG. 6, DRG neurons expressed green fluorescent protein, indicating that AAV-NALCN-shRNA intravenous injection can effectively infect DRG neurons.

Example 22 Effect of NALCN-siRNA DRG injection on neuropathic pain induced by Chronic sciatic nerve compression model (CCI)

Adult male SPFSD rats were randomly divided into an experimental group, to which DRG was injected 2 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared by the method described in example 4, for a total of 1 injection, and a control group, to which DRG was injected an equal amount of a control sequence. After measuring the pain thresholds of basic mechanical pain and thermal pain, CCI modeling was performed on the left hind limb, and the pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days with the right hind limb as a control.

The specific method comprises the following steps:

CCI mold making

After adult rats are anesthetized with sevoflurane, the right lateral decubitus is taken, the skin between the greater trochanter of femur and the ischial tuberosity is prepared, the skin is cut after disinfection, the incision is about 2cm, muscles are separated in a blunt manner layer by layer, the sciatic nerve trunk is exposed, four knots are tied by using 4-0 chromium catgut, the distance between the knots is 1mm, and the knotting force is preferably slight twitching of the left lower limb. The muscle and skin are sutured layer by layer. The right side is a control, exposing only the sciatic nerve trunk without ligation.

Mechanical pain threshold determination

Three days before pain threshold measurement, rats were placed on a 0.6cm × 0.6cm metal net daily in a room with constant temperature, humidity and light, and covered with a 25cm × 25cm × 15cm transparent plastic box with ventilation holes, and acclimatized for 2 h. On the day of measurement, after acclimation for 1h and after the rats were calmed, the mechanical pain threshold was measured using Von-frey. Von-frey ciliary pressure is 0.008g, 0.02g, 0.16g, 0.4g, 0.6g, 1g, 1.4g, 2g, 4g, 6g, 8g, 10g and 15 g. The rat was vertically stimulated to the sole of the foot with Von-frey cilia using the up-down method with a force appropriate for cilia to flex, a stimulation time course of 2 seconds, a sudden foot lift of the rat, a positive foot lift when licking the foot and removing the cilia. If positive, using the small primary cilia; if negative, the large primary cilia are used. The number of grams of cilia with three positive reactions was taken as the absolute threshold of the mechanical pain threshold.

Hot threshold determination

Three days before pain threshold measurement, rats were placed daily on a clear glass plate in a room with constant temperature, humidity and light, covered with a 25cm × 15cm clear plastic box with air holes, and acclimated for 2 h. On the measurement day, the device is adapted for 1h, after the rat is quiet, the infrared ray bolometer is used for irradiating the vola of the rat through a transparent glass plate, the temperature is set to be 55 ℃, and in order to avoid scalding, the longest time interval is set to be 15 seconds. The thermal radiometer automatically times when the rat suddenly lifts the foot. The measurements were performed once at 5min intervals, and the average value was taken as the thermal pain threshold for three measurements.

As a result:

as a result, as shown in fig. 7, in the control group, the CCI model side significantly decreased the mechanical pain and thermal pain thresholds from the first day after CCI, as compared with the control side and the basal pain threshold, at least for 14 days; compared with the control group model side, the pain threshold of the experimental group model side is obviously improved in the first four days after CCI, which shows that the DRG injected NALCN-siRNA can obviously improve the mechanical pain and thermal pain caused by CCI, and the drug effect of single injection lasts for 4 days.

Example 23 Effect of intrathecal injection of NALCN-siRNA on CCI-induced neuropathic pain

Adult male SPFSD rats were randomly divided into an experimental group, which was injected intrathecally with 10 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared as described in example 4, for a total of 1 injection, and a control group, which was injected intrathecally with an equal amount of the control sequence. After measuring the pain thresholds of basic mechanical pain and thermal pain, CCI modeling was performed on the left hind limb, and the pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days with the right hind limb as a control.

As shown in FIG. 8, similar to DRG injection, intrathecal NALCN-siRNA injection significantly improved mechanical and thermal pain caused by CCI, with a single injection of efficacy lasting up to 4 days.

Example 24 Effect of NALCN-siRNA intravenous injection on CCI-induced neuropathic pain

Adult male SPFSD rats were randomly divided into an experimental group, which was injected with 80 μ g (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared as described in example 4 in the tail vein for a total of 1 injection, and a control group, which was injected with an equal amount of the control sequence in the vein. After measuring the pain thresholds of basic mechanical pain and thermal pain, CCI modeling was performed on the left hind limb, and the pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days with the right hind limb as a control.

As shown in FIG. 9, similar to DRG injections, NALCN-siRNA intravenous injections significantly improved mechanical and thermal pain caused by CCI, with a single injection of efficacy lasting as long as 4 days.

The results of examples 22-24 show that NALCN-siRNA can significantly improve mechanical and thermal pain caused by CCI whether by DRG injection, intrathecal injection or intravenous injection, and the drug effect of a single injection can last for up to 4 days.

Example 25 Effect of AAV-NALCN-shRNADRG injection on neuropathic pain caused by CCI

Adult male SPFSD rats were randomly divided into experimental and control groups, and the experimental group DRG injected 2. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA prepared as described in example 15¹³TU/ml), for a total of 1 injection, control DRG was injected with an equal amount of AAV virus containing control sequences. After 1 month, the basal pain threshold was measured, then CCI modeling was performed on the left hind limb, and the pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days with the right hind limb as a control.

As a result, as shown in fig. 10, in the control group, the CCI model side significantly decreased the mechanical pain and thermal pain thresholds from the first day after CCI as compared with the control side and the basal pain threshold for at least 14 days; compared with the control group model side, the lateral pain threshold of the experimental group model is not obviously changed, which shows that the AAV-shRNA can obviously inhibit mechanical pain and thermal pain caused by CCI.

Example 26 Effect of intrathecal injection of AAV-NALCN-shRNA on CCI-induced neuropathic pain

Adult male SPFSD rats were randomly divided into experimental groups and control groups, and the experimental groups were intrathecally injected with 10. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA prepared as described in example 15¹³TU/ml), 1 injection in total, and control group injected intrathecally with an equal amount of AAV virus containing control sequences. Measuring the basal pain threshold after 1 month, andthe left hind limb was subjected to CCI modeling, and the right hind limb was used as a control, and pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days.

The results are shown in FIG. 11, similar to DRG injection, the intrathecal injection of AAV-NALCN-shRNA significantly inhibited the mechanical and thermal pain induced by CCI with a pain threshold comparable to that of the control group.

Example 27 Effect of intravenous injection of AAV-NALCN-shRNA on CCI-induced neuropathic pain

Adult male SPFSD rats were randomly divided into experimental and control groups, and 50. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA prepared as described in example 15 was administered into caudal vein of experimental group¹³TU/ml), 1 injection in total, and control group was injected intravenously with an equal amount of AAV virus containing control sequences. After 1 month, the basal pain threshold was measured, then CCI modeling was performed on the left hind limb, and the pain threshold (mechanical pain + thermal pain) was continuously measured for 14 days with the right hind limb as a control.

The results are shown in FIG. 12, similar to DRG injection, AAV-NALCN-shRNA intravenous injection can significantly suppress mechanical pain and thermal pain caused by CCI with pain threshold comparable to control group.

The results of examples 25-27 show that AAV-NALCN-shRNA can significantly inhibit mechanical pain and thermal pain caused by CCI whether by DRG injection, intrathecal injection or intravenous injection, the drug effect of single injection can last for at least 14 days, and the pain threshold is equivalent to that of the control group.

Example 28 Effect of NALCN-siRNADRG injection on Chronic inflammatory pain model (CFA)

Adult male SPFSD rats were randomly divided into an experimental group, to which DRG was injected 2 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared by the method described in example 4, for a total of 1 injection, and a control group, to which DRG was injected an equal amount of a control sequence. After measuring the pain thresholds of basal mechanical pain and thermal pain, 100 μ L of Complete Freund's Adjuvant (CFA) was injected subcutaneously into the left sole of a rat, and 100 μ L of physiological saline was injected subcutaneously into the right sole of the rat as a control, and the pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

As a result, as shown in fig. 13, in the control group, the CFA model side significantly decreased the mechanical and thermal pain thresholds 2h after CFA, as compared to the control side and the basal pain threshold, lasting at least 7 days; compared with the control group model side, the pain threshold of the experimental group model side after CFA is obviously improved after 2h, 6h, 1 day and 3 days. Shows that early mechanical pain and thermal pain caused by CFA can be obviously improved by DRG injection NALCN-siRNA.

Example 29 Effect of intrathecal injection of NALCN-siRNA on CFA inflammatory pain model

Adult male SPFSD rats were randomly divided into an experimental group, which was injected intrathecally with 10 μ L (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared as described in example 4, for a total of 1 injection, and a control group, which was injected intrathecally with an equal amount of the control sequence. After measuring the pain thresholds of basal mechanical pain and thermal pain, 100 μ L of Complete Freund's Adjuvant (CFA) was injected subcutaneously into the left sole of a rat, and 100 μ L of physiological saline was injected subcutaneously into the right sole of the rat as a control, and the pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

The results are shown in FIG. 14, similar to DRG injection, the intrathecal injection of NALCN-siRNA significantly improved CFA-induced early onset mechanical and thermal pain.

Example 30 Effect of intravenous injection of NALCN-siRNA on CFA inflammatory pain model

Adult male SPFSD rats were randomly divided into an experimental group, which was intravenously injected with 80 μ g (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) prepared by the method described in example 4, a total of 1 injection, and a control group, which was intravenously injected with an equal amount of the control sequence. After measuring the pain thresholds of basal mechanical pain and thermal pain, 100 μ L of Complete Freund's Adjuvant (CFA) was injected subcutaneously into the left sole of a rat, and 100 μ L of physiological saline was injected subcutaneously into the right sole of the rat as a control, and the pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

The results are shown in FIG. 15, similar to DRG injection, NALCN-siRNA intravenous injection can significantly improve CFA induced early mechanical and thermal pain.

Examples 28-30 show that NALCN-siRNA significantly ameliorates early mechanical and thermal pain caused by CFA, whether by DRG injection, intrathecal injection or intravenous injection.

Example 31 Effect of AAV-NALCN-shRNA DRG injection on CFA inflammatory pain model

Male adultThe SPFSD rats were randomly divided into experimental and control groups, and the experimental group DRG injected 2. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/ml), 1 injection in total, and control group injected intrathecally with an equal amount of AAV virus containing control sequences. The basal pain threshold was measured 1 month later, and then 100 μ L Complete Freund's Adjuvant (CFA) was subcutaneously injected into the left sole of the rat, and 100 μ L normal saline was subcutaneously injected into the right sole of the rat as a control, and pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

The results are shown in FIG. 16, and AAV-NALCN-shRNA DRG injection can significantly improve mechanical pain and thermal pain caused by CFA.

Example 32 Effect of intrathecal injection of AAV-NALCN-shRNA on CFA inflammatory pain model

Adult male SPFSD rats were randomly divided into experimental and control groups, and the experimental group was intrathecally injected with 10. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/m1), for a total of 1 injection, the control group was injected intrathecally with an equal amount of AAV virus containing control sequences. The basal pain threshold was measured 1 month later, and then 100 μ L Complete Freund's Adjuvant (CFA) was subcutaneously injected into the left sole of the rat, and 100 μ L normal saline was subcutaneously injected into the right sole of the rat as a control, and pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

The results are shown in FIG. 17, where intrathecal injection of AAV-NALCN-shRNA reverses the pain thresholds of mechanical and thermal pain caused by CFA.

Example 33 Effect of intravenous injection of AAV-NALCN-shRNA on CFA inflammatory pain model

Adult male SPFSD rats were randomly divided into experimental and control groups, and the experimental group was administered by caudal vein injection of 50. mu.L (1X 10) of AAV virus (AAV-NALCN-shRNA) expressing shRNA of example 15¹³TU/ml), 1 injection in total, and control group was injected intravenously with an equal amount of AAV virus containing control sequences. The basal pain threshold was measured 1 month later, and then 100 μ L Complete Freund's Adjuvant (CFA) was subcutaneously injected into the left sole of the rat, and 100 μ L normal saline was subcutaneously injected into the right sole of the rat as a control, and pain thresholds (mechanical pain + thermal pain) were measured 2h, 6h, 1 day, 3 days, 5 days, and 7 days after CFA.

The results are shown in FIG. 18, similar to DRG injection, AAV-NALCN-shRNA intravenous injection improved mechanical and thermal pain caused by CFA.

Examples 31-33 show that AAV-NALCN-shRNA can significantly improve mechanical and thermal pain caused by CFA, whether DRG injection, intrathecal injection or intravenous injection.

It can also be seen from the results of examples 23-33 that the pain perception threshold of the group not modeled with chronic pain (neuropathic pain or inflammatory pain) was consistent with that of the blank control (neither modeling with chronic pain nor the formulation of the invention) after injection of the formulation of the invention, indicating that: the drug of the invention has only an influence on the perception of pain in chronic pain patients and not on the perception of pain in healthy persons (i.e. in physiological conditions), which was previously unexpected.

Example 34 Effect of NALCN-siRNA intravenous injection on cardiac function and NALCN expression

Adult male SPFSD rats were randomly divided into an experimental group and a control group, and after cardiac ultrasonication was measured, the experimental group was intravenously injected with 80 μ g (1 μ g/μ L) of the siRNA preparation (NALCN-siRNA) described in example 1 for a total of 1 injection, and the control group was intravenously injected with an equal amount of the control sequence. Three days later cardiac function was reviewed and changes in NALCN expression were measured using RT-PCR methods.

The results are shown in fig. 19, the NALCN-siRNA intravenous injection had no significant effect on cardiac NALCN expression and function.

Example 35 Effect of intravenous injection of AAV-NALCN-shRNA on cardiac function and NALCN expression

Adult male SPFSD rats were randomly divided into an experimental group and a control group, and after cardiac ultrasonography was performed, 50. mu.L (1X 10) of AAV (AAV-NALCN-shRNA) expressing the shRNA of example 2 was injected into the tail vein of the experimental group¹³TU/ml), 1 injection in total, and control group was injected intravenously with an equal amount of AAV virus containing control sequences. Cardiac function was reviewed after 1 month and changes in NALCN expression were measured using RT-PCR.

The results are shown in FIG. 20, and the AAV-NALCN-shRNA intravenous injection has no obvious influence on the cardiac NALCN expression and function.

Example 36 Effect of NALCN-siRNA transfection of rat DRG neurons in vitro

Rat DRG cells were acutely isolated, cultured, and NALCN-siRNA or control sequence transfected 48h prior to measurement of NALCN expression and neuronal excitability.

The specific method comprises the following steps:

1) acute isolation of DRG neurons

After the rats died in the dislocation of cervical vertebrae, the lumbar spine was quickly removed, the spinal canal was cut open along the median, the DRG on both sides of L4-L6 was removed, placed in a petri dish containing low temperature Hanks' solution, the DRG was cut into pieces using microdissection scissors, and then the DRG pieces were transferred to 10mL of buffer containing collagenase (typeIA, 1mg/mL, Sigma) and trypsin (0.5mg/mL, Sigma) and incubated at 37 ℃ for 30 min. Then, the DRG tissue was washed 5 times, transferred to a buffer containing DNase (0.2mg/mL, Sigma), and individual neurons were obtained by pipetting the DRG tissue through a smooth glass pipette, transferring the separated neurons to a glass coverslip, and after adhering the cells to the wall at 37 ℃ for 2 hours, the cells were cultured by adding a culture medium.

2) Cell culture and transfection

Adherent cells were cultured in a medium containing fetal bovine serum (10%), incubated at 37 ℃ with 5% CO₂The cell culture box is used for culturing, the DRG cells in the logarithmic phase are inoculated into a 6-well plate for culturing, and siRNA transfection is carried out when the fusion degree of the DRG cells reaches 60-70%. mu.L of siRNA preparation (20. mu. mol/L) prepared as described in example 4 or control sequence was mixed with 200. mu.L DMEM medium, added to cell culture wells of 6-well plate, transfected for 48h, and cells were collected for subsequent experiments.

3) RMP recording:

the incubated DRG neurons were transferred to perfusion cells, spinal cord sections were fixed with wire mesh and aCSF was perfused continuously at room temperature at 2 mL/min. Under a microscope, a glass electrode (5-6M omega) which is pre-filled with electrode internal liquid and is given a certain positive pressure is placed on the surface of a neuron, appropriate negative pressure is given to achieve high-resistance sealing, after 3-5 minutes of stabilization, negative pressure is continuously applied to rupture a membrane to form a whole cell mode, a current clamp mode is used, and the voltage when I is 0 is the RMP.

The results are shown in fig. 21, NALCN-siRNA significantly reduced NALCN expression in DRG neurons and reduced neuronal excitability compared to the control sequence.

Example 37 Effect of AAV-NALCN-shRNA transfection of rat DRG neurons in vitro

Rat DRG cells were acutely isolated, cultured, and NALCN expression and neuronal excitability were measured 72h after transfection of AAV-NALCN-shRNA or control sequences.

The results are shown in FIG. 22, where AAV-NALCN-shRNA significantly reduced NALCN expression in DRG neurons and reduced neuronal excitability compared to the control sequence.

The inventors also performed in vivo experiments demonstrating that NALCN expression in neurons and reduced neuronal excitability can be reduced by DRG, intrathecal and intravenous NALCN-siRNA or AAV-NALCN-shRNA.

In conclusion, the medicine for effectively treating chronic pain is prepared by taking NALCN as a target point, is a specific medicine for treating chronic pain by means of a brand-new mechanism, does not influence the sensory function of animals (including human) in a physiological state, is safe and reliable, and is expected to replace the existing medicine for treating chronic pain.

SEQUENCE LISTING

<110> Sichuan university Hospital in western China

<120> nucleic acid medicine for treating chronic pain

<130> GYKH1094-2020P019765CC20JS012

<160> 30

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> RNA

<213> Artificial sequence

<400> 1

cgaguauauu cacagucuau g 21

<210> 2

<211> 21

<212> RNA

<213> Artificial sequence

<400> 2

ccugaguugu cauuaucaau u 21

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<400> 3

gaggaaaguu guucgagaac u 21

<210> 4

<211> 21

<212> RNA

<213> Artificial sequence

<400> 4

cugcagagau gauagcaaag a 21

<210> 5

<211> 21

<212> RNA

<213> Artificial sequence

<400> 5

acuugugacu auuagauaau a 21

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence

<400> 6

agaacuugau gaagaucuaa a 21

<210> 7

<211> 21

<212> RNA

<213> Artificial sequence

<400> 7

gguauauaac aaaccuguag g 21

<210> 8

<211> 21

<212> RNA

<213> Artificial sequence

<400> 8

cauguauucu gucuguguaa g 21

<210> 9

<211> 22

<212> RNA

<213> Artificial sequence

<400> 9

gcgaagauac caacgccaau ua 22

<210> 10

<211> 21

<212> RNA

<213> Artificial sequence

<400> 10

uagacuguga auauacucgu g 21

<210> 11

<211> 21

<212> RNA

<213> Artificial sequence

<400> 11

cagguuaauc uaacguucag u 21

<210> 12

<211> 19

<212> RNA

<213> Artificial sequence

<400> 12

ugacauguau uaauccguc 19

<210> 13

<211> 7

<212> PRT

<213> Artificial sequence

<400> 13

Ser Pro Gly Ala Arg Ala Phe

1 5

<210> 14

<211> 7

<212> PRT

<213> Artificial sequence

<400> 14

Asp Gly Pro Trp Arg Lys Met

1 5

<210> 15

<211> 7

<212> PRT

<213> Artificial sequence

<400> 15

Phe Gly Gln Lys Ala Ser Ser

1 5

<210> 16

<211> 51

<212> PRT

<213> Artificial sequence

<400> 16

Gly Cys Thr Gly Ala Cys Ala Thr Ala Cys Thr Cys Thr Gly Gly Ala

1 5 10 15

Thr Thr Ala Ala Thr Thr Thr Cys Ala Ala Gly Ala Gly Ala Ala Thr

20 25 30

Thr Ala Ala Thr Cys Cys Ala Gly Ala Gly Thr Ala Thr Gly Thr Cys

35 40 45

Ala Gly Cys

50

<210> 17

<211> 51

<212> DNA

<213> Artificial sequence

<400> 17

ggtggcgtca tggacatatt tttcaagaga aaatatgtcc atgacgccac c 51

<210> 18

<211> 51

<212> DNA

<213> Artificial sequence

<400> 18

gcctaagacc tcttcggata tttcaagaga atatccgaag aggtcttagg c 51

<210> 19

<211> 51

<212> DNA

<213> Artificial sequence

<400> 19

gccacaaatg aggaaagttg tttcaagaga acaactttcc tcatttgtgg c 51

<210> 20

<211> 51

<212> DNA

<213> Artificial sequence

<400> 20

gctttggtgt tcagctcttt gttcaagaga caaagagctg aacaccaaag c 51

<210> 21

<211> 51

<212> DNA

<213> Artificial sequence

<400> 21

gcaaatcctc gtaactttaa cttcaagaga gttaaagtta cgaggatttg c 51

<210> 22

<211> 51

<212> DNA

<213> Artificial sequence

<400> 22

ggtgacgtct cttggtgttg tttcaagaga acaacaccaa gagacgtcac c 51

<210> 23

<211> 51

<212> DNA

<213> Artificial sequence

<400> 23

gcatgtacaa gagcttcttt attcaagaga taaagaagct cttgtacatg c 51

<210> 24

<211> 51

<212> DNA

<213> Artificial sequence

<400> 24

gcaacagact gtggcaatta tttcaagaga ataattgcca cagtctgttg c 51

<210> 25

<211> 51

<212> DNA

<213> Artificial sequence

<400> 25

gcagctggag tacaccatag attcaagaga tctatggtgt actccagctg c 51

<210> 26

<211> 51

<212> DNA

<213> Artificial sequence

<400> 26

aagatcgcac agcctcttca tttcaagaga atgaagaggc tgtgcgatct t 51

<210> 27

<211> 67

<212> DNA

<213> Artificial sequence

<400> 27

ccgggctgac atactctgga ttaatttcaa gagaattaat ccagagtatg tcagcttttt 60

tggtacc 67

<210> 28

<211> 66

<212> DNA

<213> Artificial sequence

<400> 28

aattggtacc aaaaagctga catactctgg attaattctc ttgaaattaa tccagagtat 60

gtcagc 66

<210> 29

<211> 67

<212> DNA

<213> Artificial sequence

<400> 29

ccgggttgcc atccgctgta ttcatttcaa gagaatgaat acagcggatg gcaacttttt 60

tggtacc 67

<210> 30

<211> 66

<212> DNA

<213> Artificial sequence

<400> 30

aattggtacc aaaaagttga catactctgg attaattctc ttgaaattaa tccagagtat 60

gtcagc 66

Claims

1. A medicament for treating chronic pain, characterized by:

the active component of the medicine is siRNA or shRNA for inhibiting NALCN expression;

the siRNA sequence is shown as SEQ ID NO. 1;

the shRNA sequence is shown as the sequence of SEQ ID NO. 16;

the siRNA takes a liposome as a carrier, and the carrier is fixed with a polypeptide targeting DRG of dorsal root ganglia;

the preparation method of the liposome comprises the following steps:

2) dissolving DOTAP, DOPE, cholesterol, mPEG-DSPE and the targeting DRG polypeptide-PEG-DSPE obtained in the step 1) into chloroform together in a molar ratio of 10:45:30:10:5, and performing rotary reduced pressure evaporation to remove the chloroform to obtain a lipid film;

3) washing the lipid film obtained in the step 2) with 5% glucose solution to obtain a liposome stock solution;

the shRNA takes a recombinant virus as a vector, and the recombinant virus carries a DRG-targeted polypeptide;

the polypeptide sequence of the target DRG is shown in any one of SEQ ID NO. 13-15.

2. The medicament of claim 1, wherein: the shRNA is obtained by heating and denaturing DNA single chains with sequences shown as SEQ ID NO.27 and 28, and then cooling and annealing.

3. The medicament of claim 1, wherein: the recombinant virus is a recombinant adeno-associated virus.

Use of an NALCN inhibitor for the manufacture of a medicament for the treatment of chronic pain;

the chronic pain is neuropathic pain or inflammatory pain;

the NALCN inhibitor is siRNA or shRNA for inhibiting the expression of NALCN;

the siRNA sequence is shown as SEQ ID NO. 1;

the shRNA sequence is shown as the sequence of SEQ ID NO. 16;

the siRNA takes liposome or cationic polymer micelle as a carrier, and the carrier is fixed with DRG-targeted polypeptide;

5. Use according to claim 4, characterized in that: the preparation method of the liposome comprises the following steps:

2) dissolving DOTAP, cholesterol, soybean lecithin, DSPE-mPEG2000 and the targeted DRG polypeptide-PEG-DSPE obtained in the step 1) into chloroform together according to the molar ratio of 8-12: 30-40: 35-45: 8-12: 3-7, and performing rotary reduced pressure evaporation to remove the chloroform to obtain a lipid film;

4) and (3) sequentially passing the obtained liposome stock solution through 10 cycles of polycarbonate membranes of 500nm and 100nm respectively to perform extrusion operation, thus obtaining the liposome.

6. Use according to claim 5, characterized in that:

the step 2) is as follows: dissolving DOTAP, DOPE, cholesterol, mPEG-DSPE and the targeting DRG polypeptide-PEG-DSPE obtained in the step 1) in chloroform at a molar ratio of 10:35:40:10:5, and performing rotary reduced pressure evaporation to remove the chloroform to obtain the lipid film.

7. Use according to claim 4, characterized in that: the preparation method of the cationic polymer micelle comprises the following steps:

1) connecting the polypeptide of the targeted dorsal root ganglion DRG with PEG-PCL to obtain targeted DRG polypeptide-PEG-PCL;

2) and (3) mixing the raw materials in a molar ratio of 4-16: 1-2: 1-2 of PEG-PCL, dissolving the targeting DRG polypeptide-PEG-PCL and the PEI-PCL obtained in the step 1) in tetrahydrofuran, and injecting into deionized water under a stirring state;

3) dialyzing at room temperature to obtain the final product.

8. Use according to claim 7, characterized in that:

the molar ratio in step 2) is 8: 1: 1.

9. use according to claim 4, characterized in that: the shRNA is obtained by heating and denaturing DNA single chains with sequences shown as SEQ ID NO.27 and 28, and then cooling and annealing.

10. Use according to claim 4, characterized in that: the recombinant virus is a recombinant adeno-associated virus.