CN111187761A

CN111187761A - Fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application of fusion protein to promotion of myocardial regeneration

Info

Publication number: CN111187761A
Application number: CN202010006515.8A
Authority: CN
Inventors: 王连生; 王昊; 陈秉瑞; 单天凯; 范燚; 杜冲; 李亚飞; 郭雪江; 程毅伟; 沙家豪
Original assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Current assignee: Jiangsu Province Hospital First Affiliated Hospital With Nanjing Medical University
Priority date: 2020-01-03
Filing date: 2020-01-03
Publication date: 2020-05-22

Abstract

The invention discloses a fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application of the hydrogel in promoting myocardial regeneration, and belongs to the technical field of biomedicine. The fusion protein comprises an MNK2 protein kinase sequence and a membrane-penetrating peptide sequence, and can influence the processes of cell cycle, mitosis, DNA synthesis and the like of cardiac muscle cells by activating a key pathway of cardiac muscle regeneration after injection administration, reduce the area and fibrosis of myocardial infarction, promote the regeneration and repair of cardiac muscle after acute myocardial infarction and improve the recovery of cardiac function. Meanwhile, a three-dimensional network structure formed by the liquid state solidification of the small molecular hydrogel can provide mechanical supporting force for the ventricles and delay the ventricular reconstruction; the porous structure of the small molecular hydrogel is convenient for the growth of regenerative myocardial cells so as to promote myocardial repair.

Description

Fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application of fusion protein to promotion of myocardial regeneration

Technical Field

The invention relates to the technical field of biomedicine, in particular to a recombinant human MNK2 protein kinase product taking hydrogel as a carrier, a preparation method thereof and application thereof in promoting myocardial regeneration.

Background

Acute myocardial infarction, a disease seriously endangering human life, is one of the leading causes of death worldwide, and has been widely concerned. After an acute myocardial infarction occurs, the coronary artery related to the infarction should be opened as early as possible, fully and continuously, the myocardial dying due to ischemia is saved, and the heart function is protected, so that the main strategy for treating the acute myocardial infarction is provided at present. With the progress of medical technology, particularly the application of reperfusion means after myocardial infarction such as coronary artery bypass transplantation or percutaneous coronary artery interventional therapy and the like, the blood flow of an ischemic area can be quickly recovered, and dying cardiac muscle cells are saved, so that the death rate of the disease is reduced. However, these measures only improve the blood supply of the cardiac muscle, cannot regenerate necrotic myocardial cells, cannot increase the number of myocardial cells, and simultaneously, the damaged area is still repaired by fibrous scar tissue after the myocardial infarction occurs, so that the contractility of the cardiac muscle is reduced, and cardiac remodeling, cardiac dysfunction and even the occurrence of end-of-life heart failure events are caused in the long-term prognosis of the disease. Although the drug treatment can improve the cardiac function and delay the course of disease, the outcome of the disease cannot be changed at all, so that the effective regeneration of myocardial cells is realized, and the reduction of scar formation has important significance for reversing or delaying the progress of the disease after myocardial infarction, which is one of the great problems in the cardiovascular field at present.

For a long time, researchers have considered the myocardial cell depletion resulting from myocardial injury to be an irreversible process and thought that cardiomyocytes enter terminal differentiation and exit the cell cycle after birth. In recent years, more and more studies have found that mammalian cardiomyocytes do not completely withdraw from a mitotic event, but rather retain a very low percentage of the ability to self-divide and proliferate. Similarly, the finding that cardiomyocytes still maintain extremely weak self-proliferation renewal capacity in the adult heart brings hope for the research on the treatment of promoting the self-proliferation of residual cardiomyocytes in the infarct edge area to reduce the infarct area and improve the cardiac function after myocardial injury after the adult myocardial infarction, and the promotion of the endogenous cardiomyocyte proliferation is proved to be a method for promoting myocardial regeneration with application prospect.

MNK2 is a protein kinase that is directly activated by and phosphorylated by extracellular signal-regulated kinase (ERK) or p38 mitogen-activated protein (MAP) kinase. It phosphorylates the eukaryotic initiation factor 4E (eIF4E) and thus plays an important role in mRNA translation initiation, oncogenic transformation and malignant cell proliferation. In addition to eIF4E, the protein also interacts with von Hippel-Lindau tumor suppressor (VHL), loop box 1(Rbx1) and Cullin2(Cul 2).

By searching the prior art at home and abroad, no document report that MNK2 protein kinase promotes myocardial regeneration or treats cardiomyopathy exists at present.

Disclosure of Invention

Aiming at the current situation that the current myocardial repair drugs are few after acute myocardial infarction, the invention aims to provide a fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application thereof in promoting myocardial regeneration.

The inventor is dedicated to developing a medicament for promoting myocardial regeneration for a long time, and surprisingly, the research of the inventor finds and verifies that the activity of MNK2 kinase in the new myocardium is increased, the cell cycle is influenced, the processes of DNA synthesis, mitosis and the like are accelerated, the proliferation of myocardial cells is promoted, the regeneration and repair of the myocardium after acute myocardial infarction are further promoted, the area of myocardial infarction is reduced, and the recovery of cardiac function is improved.

In order to ensure that exogenous MNK2 smoothly enters cells to play a role, after the MNK2 protein kinase is modified, the inventor firstly provides a fusion protein of MNK2 protein kinase and cell-penetrating peptide, wherein the fusion protein comprises an MNK2 protein kinase sequence and a cell-penetrating peptide sequence, and the sequences of the fusion protein and the cell-penetrating peptide sequence are connected through connecting peptide.

Further preferably, the fusion protein of the MNK2 protein kinase and the cell-penetrating peptide is described as above, wherein the amino acid sequence of the MNK2 protein kinase is shown as SEQ ID NO: 1 is shown.

Further preferably, the fusion protein of the MNK2 protein kinase and the cell-penetrating peptide is selected from any one of the following: TAT, MPG Δ NLS, Stearyl-R8, Transportan, MPG, Pep-1.

Further preferably, the fusion protein of the MNK2 protein kinase and the cell-penetrating peptide has an amino acid sequence shown in SEQ ID NO: 2, and the nucleotide sequence is shown as SEQ ID NO: 3, respectively.

In order to make the locally injected recombinant human MNK2 protein kinase more efficiently, accurately and continuously act in the area around the acute myocardial infarction, the inventor utilizes biological tissue engineering materials to solve the problem, namely provides the recombinant human MNK2 protein kinase hydrogel for promoting myocardial regeneration.

Specifically, a gel-forming precursor molecule named dfeffkdfesyrgd (molecular weight 1612) is uniformly mixed with the above fusion protein in an aqueous phase to form an injectable hydrogel containing the fusion protein. The MNK2 fusion protein and the gel-forming precursor molecule prepolymer solution are mixed through a certain formula, then the mixture is injected into the edge of acute myocardial infarction, and the gel-forming precursor molecule undergoes liquid-solid phase transition at the body temperature, so that the hydrogel wraps the MNK2 fusion protein and is slowly released along with the degradation of the hydrogel. The injectable hydrogel as described above, wherein the mass ratio of the fusion protein to the gel-forming precursor molecule is 1: (1.8-2.2).

The invention provides a preparation method of an injectable hydrogel containing a fusion protein of MNK2 protein kinase and cell-penetrating peptide, which comprises the following steps:

(1) preparing a solution A: weighing the gel-forming precursor molecule powder, fully dissolving the gel-forming precursor molecule powder with double distilled water at room temperature, filtering and sterilizing, adjusting the pH to 7.3-7.5 with sterile sodium bicarbonate, and fixing the volume according to the gel-forming precursor molecule concentration of 18-22mg/mL to obtain solution A for later use;

(2) preparing a solution B: taking a solution containing the fusion protein, adding sterile PBS (phosphate buffer solution) to enable the concentration of the protein solution to be 9-11mg/mL, and obtaining a solution B for later use;

(3) preparing a hydrogel: and (3) mixing the solution A obtained in the step (1) with the solution B obtained in the step (2) at room temperature, and slowly blowing, beating and uniformly mixing to obtain the injectable hydrogel.

The third aspect of the invention provides the application of the fusion protein of the MNK2 protein kinase and the cell-penetrating peptide in preparing the medicine for treating the cardiomyopathy. The cardiomyopathy is one or more of acute myocardial infarction, ventricular remodeling after myocardial infarction, old myocardial infarction, coronary atherosclerosis, myocardial ischemia injury, myocardial ischemia or arrhythmia caused by infarction. The medicament is administered by intracoronary injection or direct myocardial injection.

Compared with the prior art, the fusion protein hydrogel of the MNK2 protein kinase and the cell-penetrating peptide has the following advantages and progresses:

(1) the MNK2 protein kinase promotes the myocardial repair function: after the hydrogel containing the fusion protein is injected to the edge of acute myocardial infarction by an injector, the hydrogel is fully attached to the surface of a myocardial infarction wound, liquid-solid phase transformation of the gel occurs at body temperature, and MNK2 can be wrapped in the small molecular hydrogel to form protection and support. In the part of the cardiac muscle, MNK2 can be slowly released along with the degradation of small molecular hydrogel, and then MNK2 protein kinase enters the cardiac muscle cells under the mediation of the cell-penetrating peptide connected with the MNK2 protein kinase, and plays the roles of promoting the regeneration and repair of the cardiac muscle, reducing the infarct area, inhibiting the cardiac remodeling and improving the cardiac function by acting on a key path of the proliferation of the cardiac muscle cells.

(2) The unique properties and effects of hydrogels: the injected small molecular hydrogel can provide mechanical support force for the ventricle after myocardial infarction, delay ventricular remodeling and prevent ventricular cavity expansion, and meanwhile, the solidified hydrogel is in a porous state, can provide support and space for regenerated myocardial cells, is convenient for the growth of the regenerated myocardial cells so as to promote myocardial repair, and is an ideal treatment mode for acute myocardial infarction and other cardiomyopathies.

(3) Experimental validation of cardioprotection: experiments show that after the recombinant human MNK2 protein kinase hydrogel is injected into local myocardium of an acute myocardial infarction mouse, MNK2 can be slowly released along with degradation of small molecular hydrogel to play a role, myocardial regeneration is finally promoted, ventricular remodeling is inhibited, the infarction area is reduced, and the cardiac function is remarkably improved.

(4) Operability and safety of the method: the invention only needs injection operation, is convenient and easy to operate, and can avoid high risks of treatment such as extracorporeal circulation, allogenic heart transplantation and the like. In addition, the invention has simple operation and feasible implementation conditions, provides a new myocardial tissue engineering product, and provides a new strategy for the biological treatment of acute myocardial infarction.

Drawings

FIG. 1 is a diagram of the constructed pFastBacHTA-MNK2Insect cell vectors and restriction enzyme sites;

FIG. 2 is an assessment of the effect of infection after Bacmids infected Sf9 cells (fluorescence plot);

FIG. 3 is an electrophoretic validation of the prepared high concentration recombinant human MNK2 protein kinase;

FIG. 4 shows the expression of myocardial MNK2 7 days after local injection of recombinant human MNK2 protein kinase hydrogel into mouse myocardium;

FIG. 5 shows that the recombinant human MNK2 protein kinase hydrogel can significantly promote the recovery of the cardiac function of mice after MI;

fig. 6 shows that the application of the recombinant human MNK2 protein kinase hydrogel can significantly reduce the infarct size (a.ttc) and the degree of fibrosis (b.massson staining) after MI in mice;

FIG. 7 shows that the recombinant human MNK2 protein kinase hydrogel can promote the proliferation of mouse post-MI myocardial cells, including mitosis (A, PH3+), DNA synthesis (B, EDU +), and cell cycle activity (C, Ki67 +).

Detailed Description

The technical solution and the technical effect of the present invention will be further described in detail by the following specific embodiments and the accompanying drawings. It will be understood by those skilled in the art that the following examples are illustrative of the present invention only and should not be taken as limiting the scope of the invention. In addition, the specific technical operation steps or conditions not indicated in the examples are performed according to the general techniques or conditions described in the literature in the field or according to the product specification. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

EXAMPLE 1 preparation of biologically active recombinant human MNK2 protein kinase

TAT-MNK2 (nucleotide sequence) is shown as SEQ NO. 3.

2. Construction of pFastBacHTA-MNK2 insect cell vector

Bac-to-bachtvector kit was designed to express and purify recombinant proteins with histidine tags in Sf9, Sf21, or HighFive cells after production of baculovirus vectors in e. The pfastbach vector has the following characteristics: (1) a polyhedrin strong promoter for expression of proteins; (2) three reading frames for simplified cloning; (3) an N-terminal 6xHis tag for easy purification of the recombinant fusion protein; (4) for removal of histidine-tagged TEV protease cleavage sites after protein purification.

Construction Process of recombinant vector

(1) Plasmid design:

pUCori, F1ori terminator SV40poly (A) signal; the restriction enzyme site 5 'BamHI, 3' HindIII; TAT-MNK2 primer design requirements: GC value is between 40 and 55, the length of the primer fragment is between 30 and 35bp

The primer sequence is as follows:

F：GAGGAGGCGGCTCTATGGTGCAGAAGAA

R：CGCCTCCTCCTCACTCATTCACAGTA

(2) TAT-CHEK1 fragment is PCR amplified and identified and purified

Using the PrimeSTARHS DNAPolymerase kit, system conditions were as follows:

the primers were diluted to a concentration of 10nmol/ul each and added to the reaction system. (primer dilution to Standard concentration)

PCR50ul reaction system (performed on ice):

and (3) PCR reaction conditions:

and purifying the PCR product. The purification steps are as follows: binding buffer, centrifugation at 12000rpm for 1 min; washing twice at 12000rpm for 1 min; eluting with 20-50ul water

(3) Ligating the vector with TAT-CHKE1, and recombining

The MultiS One Step Cloning Kit was used for recombination (accession number: C113):

the optimum amount of each fragment was [ 0.02X log of base of fragment ] ng

For example, when cloning inserts of 0.5kb, 1kb, and 2kb in length into a cloning vector of 5kb in length, the vector and each fragment are used in the optimum amounts:

the optimal using amount of the linearized cloning vector is as follows: 0.02 × 5000 ═ 100 ng;

optimum amount of 0.5kb insert: 0.02 × 500-10 ng;

the optimum amount of the 1kb insert used: 0.02 × 1000 ═ 20 ng;

optimum amount of 2kb insert used: 0.02 × 2000-40 ng;

A. the amount of linearized cloning vector used should be between 50ng and 200 ng. When the optimum amount of DNA to be used is calculated to be out of this range using the above formula, the lowest/highest amount to be used may be selected as it is.

B. Each insert should be used in an amount greater than 10 ng. When the optimum amount of use is calculated to be less than this value using the above formula, 10ng may be used as it is.

C. When the linearized cloning vector and the amplified product of the insert were used without DNA purification, 1/5 (i.e., 4 ul) was added in a total volume not exceeding the volume of the reaction system.

And (3) recombination reaction:

the following reaction system was set up on ice:

in order to ensure the accuracy of sample addition, the linearized vector and the insert can be diluted appropriately before the recombinant reaction system is configured, and the sample addition amount of the components can not be less than 1ul

(4) Identification of recombinant products

PCR identification

Sequencing identification

The constructed vector information and the restriction enzyme sites are shown in FIG. 1.

Transformation of DH10Bac competent cells

(1) Competent cells (stored at-80 ℃) were placed in an ice bath and, if required, the freshly thawed cell suspension was dispensed into sterile, pre-cooled centrifuge tubes and placed in an ice bath. (the recommended amount of the competent cells for one transformation is 50-100ul, which can be divided according to the actual situation. it should be noted that the volume of DNA used should not exceed one tenth of the volume of the competent cell suspension.) the following experiment is exemplified by 100ul of competent cells.

(2) To the competent cell suspension, 1-10ng of pFastBacHTA-MNK2 recombinant plasmid was added, the tube was gently rotated to mix the contents, and allowed to stand in an ice bath for 30 minutes.

(3) The centrifuge tube was placed in a 42 ℃ water bath for 30 seconds and then the tube was quickly transferred to an ice bath to allow the cells to cool for 2 minutes without shaking the centrifuge tube.

(4) 900ul of sterile SOC (no antibiotics) was added to each tube, mixed well and incubated at 37 ℃ for 4 hours with shaking on a shaker at 200 rpm.

(5) Performing 10-fold gradient dilution with SOC culture medium, e.g. dividing into 3

dilution gradients

10^-1，10^-2，10^-3。

(6) 100ul of each gradient of culture was taken for plating. After the liquid in the plate was completely absorbed, the plate was inverted and incubated at 37 ℃ for 24 to 48 hours.

(7) The remaining bacterial liquid was kept in a 4 ℃ refrigerator, depending on the growth of the colonies on the plate.

(8) Selecting 4 large (>1mm) white colonies with good isolation, plating again, scribing, and growing for at least 16 hours;

(9) culturing overnight;

(10) the colonies that successfully recombined (white) were selected for PCR to verify recombination.

(11) The verification primer is as follows: M13-F: CCCAGTCACGACGTTGTAAAACG

M13-R：AGCGGATAACAATTTCACACAGG

The fragment identified by PCR was 3.7kb + the insert length, and if identified, indicated successful transformation and successful virion ligation to the plasmid.

Extraction of Bacmids

Early preparation:

(1) RNaseA solution was added to Buffer P1, mixed well and stored at 2-8 ℃.

(2) LyseBlue reagent was used as follows 1: 1000 into Buffer P1;

(3) buffer P3 was precooled at 4 ℃. Check Buffer P2 for SDS precipitation;

(4) isopropanol and 70% ethanol are necessary.

The experimental operation steps are as follows:

(1) after 12-16 hours of growth, the cultured bacteria were harvested by centrifugation at 6000 Xg for 15 minutes at 4 ℃.

(2) The suspension was thoroughly resuspended in 10ml of Buffer P1.

(3) Add 10ml of Buffer P2, through the inverted sealed tube 4-6 times to achieve the purpose of fully mixing, at room temperature (15-25℃) were incubated for 5 minutes, if the Lyseblue reagent, the solution will turn blue.

(4) During incubation, the discharge port of the QIAFilter Cartridge was screwed with a lid and placed in a qiaack or convenient tube.

(5) 10ml of precooled Buffer P3 was added to the lysate and immediately inverted 4-6 times to achieve thorough mixing. If Lyseblue reagent is used, the color of the solution will then become colorless.

(6) The lysate was poured into a qiafillter cart Cartridge and incubated for 10 minutes at room temperature, taking care not to insert a plunger.

(7) The QIAGEN-tip was equilibrated by adding 10ml of buffer QBT, which was then emptied by gravity.

(8) The lid of the discharge port of the qiafillter Cartridge was removed, the plunger was gently inserted into the qiafillter Cartridge, and the lysate of the cells was filtered into the equilibrated QIAGEN-tip, allowing the lysate to flow by gravity into the resin.

(9) QIAGEN-tip was washed with 2X 30ml Buffer QC.

(10) Using 15ml Buffer QF to elute DNA, if the structure exceeds 45kb, preheating the Buffer solution 65 ℃ in advance will help to increase the yield.

(11) The DNA was precipitated by adding 10.5ml of room temperature isopropanol, mixed and centrifuged at 15000 Xg for 30 minutes at 4 ℃ and the supernatant was carefully discarded.

(12) The DNA was washed with 5ml of 70% ethanol at room temperature and centrifuged at 15000 Xg for 10 minutes, and the supernatant was carefully discarded.

(13) Air drying for 5-10min

Eluting with sterile water, measuring concentration, subpackaging pure bacmid (3ug per tube), and freezing to-80 deg.C. The recombinant AcMNPV virus can be rapidly and efficiently produced. Taking the English prefix and the suffix of baculovirus (baculovirus) and plasmid (plasmid) to be named Bacmid, namely baculovirus plasmid. The vector can grow in Escherichia coli like plasmid, and has infection to lepidopteran insect cells.

Bacmids transfected Sf9 cells

(1) Preparing a Sf-900 II culture solution:

culture solution containing serum Sf-900 II: 45ml of Sf-900 II culture medium, 5ml of serum and 500ul of double antibody;

culture solution without serum Sf-900 II: sf-900 II 50 ml.

(2) The cell culture solution was changed to Sf-900 II serum-free culture solution, and bacmids were transfected into Sf9 cells using CELLFECTIN kit (gibco, cat # 10362100), and after 5 hours, was changed to Sf-900 II serum-containing culture solution.

(3) After three days of culture in the incubator, the transfection effect is observed by a fluorophor sight glass, after observation and evaluation, the liquid supernatant in the culture dish is taken, the liquid supernatant is centrifuged for 10min at the temperature of 4 ℃ and the speed of 15000rpm by a centrifuge, and the supernatant is taken after the centrifugation is finished.

(4) The supernatant was uniformly dropped into a culture dish after passage (5 to 10ul per well of a six-well plate) to carry out cell infection, and the cell infection was repeated while the incubator was left to stand for three days (see FIG. 2).

(5) The virus titer after transfection should be 2-4X 10⁷pfu/ml. After 3 transfections, the virus titer will exceed 10⁹pfu/ml. Use of cells after three passages of transfected virus for protein extraction

6. Amplification of viruses

(1) Sterilizing the conical flask at high temperature and high pressure for later use;

(2) adding 125ml of Sf-900 II culture solution containing serum into a conical flask;

(3) according to the following steps of 1: adding the virus-containing supernatant Title3 (reaching the appropriate virus titer) extracted after the third transfection at the ratio of 1000;

(4) the conical flask was sealed and placed on a 37 ℃ cell incubator shaker for 3 days.

7. Extraction of proteins

8. Purification of proteins

(1) Ni-NTAslurry was placed in resin and washed.

(2) The lysate-Ni-NTA mixture was loaded stepwise into a 5ml plastic column until all the mixture was loaded. At this time, if the protein is labeled with EGFP, the resin (blue in primary color) turns to light green due to the binding of the EGFP-labeled protein to the resin.

(3) The resin was washed with 2 × 8ml buffer. If the resin binding of the egfp-tagged protein is good, the washed resin remains pale green.

(4) Protein was eluted by adding 0.75ml elution buffer to the resin, labeled (E1). At this time, if the elution is good, the color of the resin changes back to blue.

(5) 4X 0.75ml of elution buffer was added further and E2, E3, E4, E5 were collected. 20ul each of E1-E5 was used for protein detection by the Biorad method. If the protein content is good, the detection result will quickly turn blue.

(6) E1-E5 were pooled together and passed through a gel exclusion spin filter for a total of about 3.75 ml (0.75 ml. times.5) with a spin of 20 minutes until a volume reduction of about 200ul was achieved. At this point, the concentrated eluate was green, indicating that the protein gradually became granular. Mixing with a pipette each time to avoid protein precipitation. Then 2ml buffer was added and the next round of operation was started, again dropping to 200ul and repeating two more rounds. Finally, the total dilution of the original buffer was about 18 × 10 × 10 × 10 ═ 1.8 × 10⁴. The supernatant was then carefully transferred to another tube without agitating the denatured protein particles, with the indicated 10 minutes of rotation of the exchanged eluent. The OD600 values of the protein concentration were measured, rapidly frozen in liquid nitrogen and stored at-80 ℃.

9. Validation of proteins

(1) Running glue for examination and silver staining after protein extraction;

(2) WB running flag, recombinant human MNK2 and the like were verified against the counterstaining results to verify the protein purity (see FIG. 3).

Example 2 preparation of hydrogel of recombinant human MNK2 protein kinase

(1) 20mg of gel-forming precursor molecule powder is weighed and fully dissolved by 800uL double distilled water at room temperature. The lysate was sterilized by filtration through a 0.22um filter, the pH was adjusted to 7.4 with sterile sodium bicarbonate powder, and the total volume of the lysate was made up to 1000ul (hereinafter referred to as solution A).

(2) Dissolving the prepared recombinant human MNK2 protein kinase solution with known concentration in ice at-80 deg.C, collecting the solution containing 10mg protein kinase, and supplementing the total volume of the protein solution to 1000ul with sterile PBS (hereinafter referred to as solution B)

(3) Mixing the solution A and the solution B at room temperature, and slowly blowing and mixing by a pipette to obtain a small molecule hydrogel-recombinant human MNK2 protein kinase mixture which needs to be used immediately.

Example 3 application of recombinant human MNK2 protein kinase hydrogel in promotion of myocardial regeneration and repair

1. Preparation and administration of mouse acute myocardial infarction model

50 male mice (P56) aged 8 weeks were anesthetized with 1.2070Avertin intraperitoneal injection (/ kg), and were manually ventilated with a small animal ventilator after tracheal intubation. The skin is cut off along the fourth intercostal space on the left side by adopting an ophthalmological scissors, the ophthalmological forceps are used for separating intercostal muscles in a blunt manner and then enter the thoracic cavity, the left auricle is exposed, the needle is inserted from the lowest edge of the left auricle by adopting 6-0, the cardiac muscle on the front wall of the ventricle becomes pale, the needle is taken out from the junction of the pulmonary artery cone and the left auricle, and the left prompting ligation is observed by ligating an LAD suture line to be correct. An operator lifts two ends of the ligature to fix the heart position, holds the insulin needle by an assistant, and selects the upper part, the left side and the right side of the edge of the paleness-like area of the myocardium on the anterior wall of the left ventricle to carry out intramyocardial injection of 30-50uL of hydrogel premix. Grouping experiments: MNK2 gel group (n-25), recombinant human MNK2 protein kinase hydrogel (prepared in example 2) was injected. In the control group (n-25), hydrogel containing no recombinant human MNK2 protein kinase was injected alone. The injected hydrogel was pre-stained with trypan blue. Then, the intercostal muscles and skin incisions were sutured layer by layer using 6-0 sutures. After the surgery was closed, the mice were placed on a thermostatic table and allowed to wake up. The myocardial infarction injury model is successfully constructed on the 4 th day after myocardial infarction by ultrasonic detection of the heart.

The recombinant human MNK2 protein kinase hydrogel is injected into the myocardial infarction edge, and gel liquid-solid phase transformation occurs at body temperature, so that MNK2 is wrapped in the small molecule hydrogel and slowly released along with degradation of the hydrogel. 7 days after injection, mice were injected with heart tissue from the peripheral region, and protein was extracted, and western felt verified that after the injection of MNK2 protein kinase hydrogel, the mouse myocardium injection region MNK2 was overexpressed (see FIG. 4).

2. Application evaluation of recombinant human MNK2 protein kinase hydrogel in acute myocardial infarction regeneration repair

The MNK2 gel group survived 20 after 22 days of operation, and the pure gel group survived 15. By applying cardiac hyperaccumulation to cardiac infarction mice, the EF value and the FS value of the mice in the MNK2 gel group are obviously improved compared with those in the pure gel control group, which shows that the MNK2 hydrogel can obviously promote the recovery of the cardiac function of the mice after MI (see figure 5).

Mice were sacrificed and fresh heart tissue was subjected to TTC staining and massson staining to find that MNK2 gel mice had significantly reduced myocardial infarct size and degree of fibrosis compared to the gel-only mice (see fig. 6).

The mitosis, DNA synthesis and cell cycle activity of myocardial cells in the infarct border zone of MNK2 gel group mice are remarkably increased by taking fresh myocardial infarction border zone tissues to prepare paraffin sections or frozen sections and respectively carrying out PH3, EDU and Ki67 staining, which indicates that the recombinant human MNK2 protein kinase hydrogel can promote proliferation of myocardial cells of mice after MI (see figure 7).

The results show that the recombinant human MNK2 protein kinase hydrogel can promote myocardial regeneration and repair, reduce infarct size, inhibit cardiac remodeling and improve cardiac function. The embodiment shows that the recombinant human MNK2 protein kinase hydrogel can be used as a new strategy for the regeneration, repair and treatment of the myocardium after acute myocardial infarction.

Sequence listing

<110> Jiangsu province national hospital (the first subsidiary hospital of Nanjing medical university)

<120> fusion protein of MNK2 protein kinase and cell-penetrating peptide, hydrogel thereof and application of hydrogel in promoting myocardial regeneration

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>414

<212>PRT

<213> human (human)

<400>1

Met Val Gln Lys Lys Pro Ala Glu Leu Gln Gly Phe His Arg Ser Phe

1 5 10 15

Lys Gly Gln Asn Pro Phe Glu Leu Ala Phe Ser Leu Asp Gln Pro Asp

20 25 30

His Gly Asp Ser Asp Phe Gly Leu Gln Cys Ser Ala Arg Pro Asp Met

35 40 45

Pro Ala Ser Gln Pro Ile Asp Ile Pro Asp Ala Lys Lys Arg Gly Lys

50 55 60

Lys Lys Lys Arg Gly Arg Ala Thr Asp Ser Phe Ser Gly Arg Phe Glu

65 70 75 80

Asp Val Tyr Gln Leu Gln Glu Asp Val Leu Gly Glu Gly Ala His Ala

85 90 95

Arg Val Gln Thr Cys Ile Asn Leu Ile Thr Ser Gln Glu Tyr Ala Val

100 105 110

Lys Ile Ile Glu Lys Gln Pro Gly His Ile Arg Ser Arg Val Phe Arg

115 120 125

Glu Val Glu Met Leu Tyr Gln Cys Gln Gly His Arg Asn Val Leu Glu

130 135 140

Leu Ile Glu Phe Phe Glu Glu Glu Asp Arg Phe Tyr Leu Val Phe Glu

145 150 155 160

Lys Met Arg Gly Gly Ser Ile Leu Ser His Ile His Lys Arg Arg His

165 170 175

Phe Asn Glu Leu Glu Ala Ser Val Val Val Gln Asp Val Ala Ser Ala

180 185 190

Leu Asp Phe Leu His Asn Lys Gly Ile Ala His Arg Asp Leu Lys Pro

195 200 205

Glu Asn Ile Leu Cys Glu His Pro Asn Gln Val Ser Pro Val Lys Ile

210 215 220

Cys Asp Phe Asp Leu Gly Ser Gly Ile Lys Leu Asn Gly Asp Cys Ser

225 230 235 240

Pro Ile Ser Thr Pro Glu Leu Leu Thr Pro Cys Gly Ser Ala Glu Tyr

245 250 255

Met Ala Pro Glu Val Val Glu Ala Phe Ser Glu Glu Ala Ser Ile Tyr

260 265 270

Asp Lys Arg Cys Asp Leu Trp Ser Leu Gly Val Ile Leu Tyr Ile Leu

275 280 285

Leu Ser Gly Tyr Pro Pro Phe Val Gly Arg Cys Gly Ser Asp Cys Gly

290 295 300

Trp Asp Arg Gly Glu Ala Cys Pro Ala Cys Gln Asn Met Leu Phe Glu

305 310 315 320

Ser Ile Gln Glu Gly Lys Tyr Glu Phe Pro Asp Lys Asp Trp Ala His

325 330 335

Ile Ser Cys Ala Ala Lys Asp Leu Ile Ser Lys Leu Leu Val Arg Asp

340 345 350

Ala Lys Gln Arg Leu Ser Ala Ala Gln Val Leu Gln His Pro Trp Val

355 360 365

Gln Gly Cys Ala Pro Glu Asn Thr Leu Pro Thr Pro Met Val Leu Gln

370 375 380

Arg Trp Asp Ser His Phe Leu Leu Pro Pro His Pro Cys Arg Ile His

385 390 395 400

Val Arg Pro Gly Gly Leu Val Arg Thr Val Thr Val Asn Glu

405 410

<210>2

<211>466

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Arg Lys

15 10 15

Lys Arg Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Arg Lys Lys Arg

20 25 30

Arg Gln Arg Arg Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

35 40 45

Gly Gly Gly Ser Met Val Gln Lys Lys Pro Ala Glu Leu Gln Gly Phe

50 55 60

His Arg Ser Phe Lys Gly Gln Asn Pro Phe Glu Leu Ala Phe Ser Leu

65 70 75 80

Asp Gln Pro Asp His Gly Asp Ser Asp Phe Gly Leu Gln Cys Ser Ala

85 90 95

Arg Pro Asp Met Pro Ala Ser Gln Pro Ile Asp Ile Pro Asp Ala Lys

100 105 110

Lys Arg Gly Lys Lys Lys Lys Arg Gly Arg Ala Thr Asp Ser Phe Ser

115 120 125

Gly Arg Phe Glu Asp Val Tyr Gln Leu Gln Glu Asp Val Leu Gly Glu

130 135 140

Gly Ala His Ala Arg Val Gln Thr Cys Ile Asn Leu Ile Thr Ser Gln

145 150 155 160

Glu Tyr Ala Val Lys Ile Ile Glu Lys Gln Pro Gly His Ile Arg Ser

165170 175

Arg Val Phe Arg Glu Val Glu Met Leu Tyr Gln Cys Gln Gly His Arg

180 185 190

Asn Val Leu Glu Leu Ile Glu Phe Phe Glu Glu Glu Asp Arg Phe Tyr

195 200 205

Leu Val Phe Glu Lys Met Arg Gly Gly Ser Ile Leu Ser His Ile His

210 215 220

Lys Arg Arg His Phe Asn Glu Leu Glu Ala Ser Val Val Val Gln Asp

225 230 235 240

Val Ala Ser Ala Leu Asp Phe Leu His Asn Lys Gly Ile Ala His Arg

245 250 255

Asp Leu Lys Pro Glu Asn Ile Leu Cys Glu His Pro Asn Gln Val Ser

260 265 270

Pro Val Lys Ile Cys Asp Phe Asp Leu Gly Ser Gly Ile Lys Leu Asn

275 280 285

Gly Asp Cys Ser Pro Ile Ser Thr Pro Glu Leu Leu Thr Pro Cys Gly

290 295 300

Ser Ala Glu Tyr Met Ala Pro Glu Val Val Glu Ala Phe Ser Glu Glu

305 310 315 320

Ala Ser Ile Tyr Asp Lys Arg Cys Asp Leu Trp Ser Leu Gly Val Ile

325330 335

Leu Tyr Ile Leu Leu Ser Gly Tyr Pro Pro Phe Val Gly Arg Cys Gly

340 345 350

Ser Asp Cys Gly Trp Asp Arg Gly Glu Ala Cys Pro Ala Cys Gln Asn

355 360 365

Met Leu Phe Glu Ser Ile Gln Glu Gly Lys Tyr Glu Phe Pro Asp Lys

370 375 380

Asp Trp Ala His Ile Ser Cys Ala Ala Lys Asp Leu Ile Ser Lys Leu

385 390 395 400

Leu Val Arg Asp Ala Lys Gln Arg Leu Ser Ala Ala Gln Val Leu Gln

405 410 415

His Pro Trp Val Gln Gly Cys Ala Pro Glu Asn Thr Leu Pro Thr Pro

420 425 430

Met Val Leu Gln Arg Trp Asp Ser His Phe Leu Leu Pro Pro His Pro

435 440 445

Cys Arg Ile His Val Arg Pro Gly Gly Leu Val Arg Thr Val Thr Val

450 455 460

Asn Glu

465

<210>3

<211>1401

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cgaaaaaagc ggagacagag acggcgggga ggcggcgggt ctcgaaaaaa gcggagacag 60

agacggcggg gcggaggggg cagccgaaaa aagcggagac agagacggcg gggaggcggc 120

gggtctggcg gagggggcag cggaggaggc ggctctatgg tgcagaagaa accagccgaa 180

cttcagggtt tccaccgttc gttcaagggg cagaacccct tcgagctggc cttctcccta 240

gaccagcccg accacggaga ctctgacttt ggcctgcagt gctcagcccg ccctgacatg 300

cccgccagcc agcccattga catcccggac gccaagaaga ggggcaagaa gaagaagcgc 360

ggccgggcca ccgacagctt ctcgggcagg tttgaagacg tctaccagct gcaggaagat 420

gtgctggggg agggcgctca tgcccgagtg cagacctgca tcaacctgat caccagccag 480

gagtacgccg tcaagatcat tgagaagcag ccaggccaca ttcggagcag ggttttcagg 540

gaggtggaga tgctgtacca gtgccaggga cacaggaacg tcctagagct gattgagttc 600

ttcgaggagg aggaccgctt ctacctggtg tttgagaaga tgcggggagg ctccatcctg 660

agccacatcc acaagcgccg gcacttcaac gagctggagg ccagcgtggt ggtgcaggac 720

gtggccagcg ccttggactt tctgcataac aaaggcatcg cccacaggga cctaaagccg 780

gaaaacatcc tctgtgagca ccccaaccag gtctcccccg tgaagatctg tgacttcgac 840

ctgggcagcg gcatcaaact caacggggac tgctccccta tctccacccc ggagctgctc 900

actccgtgcg gctcggcgga gtacatggcc ccggaggtag tggaggcctt cagcgaggag 960

gctagcatct acgacaagcg ctgcgacctg tggagcctgg gcgtcatctt gtatatccta 1020

ctcagcggct acccgccctt cgtgggccgc tgtggcagcg actgcggctg ggaccgcggc 1080

gaggcctgcc ctgcctgcca gaacatgctg tttgagagca tccaggaggg caagtacgag 1140

ttccccgaca aggactgggc ccacatctcc tgcgctgcca aagacctcat ctccaagctg 1200

ctggtccgtg acgccaagca gaggctgagt gccgcccaag tcctgcagca cccctgggtt 1260

caggggtgcg ccccggagaa caccttgccc actcccatgg tcctgcagag gtgggacagt 1320

cacttcctcc tccctcccca cccctgtcgc atccacgtgc gacctggagg actggtcaga 1380

accgttactg tgaatgagtg a 1401

Claims

1. A fusion protein of MNK2 protein kinase and a cell-penetrating peptide, which is characterized in that the fusion protein comprises an MNK2 protein kinase sequence and a cell-penetrating peptide sequence, wherein the MNK2 protein kinase sequence is connected with the cell-penetrating peptide sequence through a connecting peptide.

2. The fusion protein of the MNK2 protein kinase and the cell-penetrating peptide according to claim 1, wherein the amino acid sequence of the MNK2 protein kinase is shown as SEQ ID NO: 1 is shown.

3. The MNK2 protein kinase and cell-penetrating peptide fusion protein according to claim 1, wherein the cell-penetrating peptide is selected from any one of the following: TAT, MPG Δ NLS, Stearyl-R8, Transportan, Pep-1.

4. The fusion protein of the MNK2 protein kinase and the cell-penetrating peptide according to claim 1, wherein the amino acid sequence of the fusion protein is shown in SEQ ID NO: 2, respectively.

5. The fusion protein of the MNK2 protein kinase and the cell-penetrating peptide according to claim 1, wherein the nucleotide sequence of the fusion protein is shown in SEQ ID NO: 3, respectively.

6. An injectable hydrogel comprising the fusion protein of claim 1, wherein the injectable hydrogel is prepared by mixing the fusion protein and a gel-forming precursor molecule in an aqueous phase, wherein the gel-forming precursor molecule is dfeffdeffyrgd.

7. The injectable hydrogel of claim 6, wherein the mass ratio of the fusion protein to gel-forming precursor molecules is 1: (1.8-2.2).

8. A method of preparing the injectable hydrogel of claim 6, comprising the steps of:

9. The use of the fusion protein of MNK2 protein kinase and transmembrane peptide of claim 1 in the preparation of a medicament for the treatment of cardiomyopathy which is one or more of acute myocardial infarction, old myocardial infarction, myocardial ischemia injury, coronary atherosclerosis, myocardial ischemia, ventricular remodeling after myocardial infarction, or arrhythmia caused by infarction.

10. The use of claim 9, wherein the medicament is administered by intracoronary injection or direct myocardial injection.