CN113755455B - Oncolytic vaccinia virus carrying SIKE gene, construction method and application - Google Patents
Oncolytic vaccinia virus carrying SIKE gene, construction method and application Download PDFInfo
- Publication number
- CN113755455B CN113755455B CN202010507015.2A CN202010507015A CN113755455B CN 113755455 B CN113755455 B CN 113755455B CN 202010507015 A CN202010507015 A CN 202010507015A CN 113755455 B CN113755455 B CN 113755455B
- Authority
- CN
- China
- Prior art keywords
- sike
- vaccinia virus
- gene
- oncolytic vaccinia
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/768—Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24032—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24051—Methods of production or purification of viral material
- C12N2710/24052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Abstract
The application relates to the technical field of biomedical engineering, and provides an oncolytic vaccinia virus carrying a SIKE gene, a construction method and application thereof, wherein the DNA sequence of the SIKE gene is shown as SEQ ID NO. 1. The construction method of the recombinant oncolytic vaccinia virus comprises two steps: (A) Inserting the gene sequence of SIKE into pCB plasmid through Xba I and Bgl II sites to obtain pCB-SIKE plasmid; (B) The pCB-SIKE plasmid and vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the SIKE gene. Experiments prove that the oncolytic vaccinia virus oncovV-SIKE has remarkable in-vitro inhibition effect on various tumor cells such as liver cancer cells, breast cancer cells or glioma cells, is dose-dependent, has remarkably improved virus replication level, and has remarkable treatment effect on tumor animal models. Therefore, the application can be used for preparing anti-tumor virus medicaments, provides a new target point for tumor virus treatment, and has wide clinical application prospect.
Description
Technical Field
The application relates to the technical field of biological medicines, in particular to an oncolytic vaccinia virus carrying IKK epsilon inhibitor (Suppressor of IKK epsilon, SIKE or SIKE 1) genes, a construction method and application thereof.
Background
Oncolytic viruses are therapeutically valuable viruses that are capable of selectively infecting and damaging tumor tissue. Oncolytic viruses have a long history of 10 viral families of oncolytic viruses to date have entered clinical trials, including Adenovirus (adenoviruses), coxsackie virus (coxrackie viruses), herpes simplex virus (Herpes simplex virus, HSV), measles virus (Measles virus), newcastle disease virus (Newcastle disease virus), parvovirus (Parvovirus), poliovirus (Poliovirus), reovirus (reoviruses), vaccinia virus (vaccina virus) and vesicular stomatitis virus (Vesicular stomatitis virus). Currently, herpes virus T-VECs have been FDA approved for the treatment of melanoma. In general, oncolytic viruses exhibit considerable safety and efficacy in clinical trials.
Vaccinia virus is a coated double stranded DNA virus that has several advantages over other oncolytic viruses: (1) It is unique in DNA viruses in that it replicates only in the cytoplasm to minimize the risk of integration within the host genome; (2) Vaccinia virus was first prepared as a vaccine against smallpox virus, which has great safety assurance; (3) The clonality of vaccinia virus is large, and insertion of gene fragments with larger length can be allowed; (4) Vaccinia virus exhibits the ability to target aggregation to cancerous tissues in both experimental animals and humans. Vaccinia virus has therefore become an ideal viral vector for cancer treatment.
Most of the common oncolytic vaccinia viruses at present are subjected to attenuation modification, including Thymine Kinase (TK) gene deletion or TK/vaccinia virus growth factor gene double deletion virus strains and the like. Deletion of the TK gene makes replication of vaccinia virus more dependent on intracellular TK levels, whereas cancer cells tend to have higher levels of TK than normal cells; in addition, vaccinia virus replication also relies on the driving of the EGFR/Ras pathway, which makes it highly selective for cancer cells.
IKK epsilon inhibitor (Suppressor of IKK epsilon, SIKE or SIKE 1) is a factor involved in regulating the IKK epsilon and TBK1 signaling pathways, and overexpression of SIKE inhibits IKK epsilon and TBK 1-mediated responses against vesicular stomatitis virus (Huang, J., T.Liu, et al 2005, SIKE is an IKK epsilon/TBK1-associated suppressor of TLR 3-and viruses-triggered IRF-3 activation pathways.EMBO J24 (23): 4018-4028.). SIKE inhibits phosphorylation and activation of IRF3 by TBK1 by competing with transcription factor IRF3 (Marion, J.D., C.F. Roberts, et al 2013.Mechanism of endogenous regulation of the type I interferon response by Suppressor of IkappaB Kinase Epsilon (SIKE), a novel substrate of TANK-binding kinase 1 (TBK 1). J Biol Chem 288 (25): 18612-18623.). It can be seen that SIKE is involved to some extent in the response of cells to certain viral infections. However, it has not been reported whether SIKE has an antitumor effect, and whether exogenous expression of SIKE using oncolytic vaccinia virus as a vector is applicable to tumor therapy has been a problem to be solved.
Disclosure of Invention
The application aims to solve the technical problems, and achieves better treatment effect on tumor-bearing mice by combining the SIKE gene with the oncolytic vaccinia virus, so as to provide the oncolytic vaccinia virus carrying the SIKE gene, and a construction method and application thereof.
In a first aspect, the present application provides an oncolytic vaccinia virus carrying a SIKE gene (GenBank: nm_ 025073.2), the DNA sequence of which is shown in SEQ ID No. 1:
atgagctgcaccatcgagaagatcctgacagacgccaagacgctgctggagaggctacgggagcacgatgcggccgccgagt cgctggtggatcagtcggcggcgctgcaccggcgggtagcagctatgcgggaggcggggacagcgcttccggaccagtatcaagag gatgcatccgatatgaaggacatgtccaaatacaaacctcacattctgctgtcccaagagaacacacagattagagacttgcaacaggaa aacagagagctatggatttccttggaggaacaccaggatgctttggaacttatcatgagcaaatatcggaaacagatgttacagttaatggtt gctaaaaaagcggtggatgctgaaccagtcctgaaagctcaccagtctcactctgcagaaattgagagtcagattgacagaatctgtgaaa tgggagaagtgatgaggaaagcagttcaggtggatgatgaccagttttgtaagattcaggaaaaattagcccaattagagcttgaaaataa ggaacttcgagaattattgtccatcagcagtgagtctcttcaagccagaaaggaaaactcaatggacactgcttcccaagccatcaaataa
preferably, the vaccinia virus is the Western Reserve strain, the Tiantan strain, the Wyeth strain, the Copenhagen strain, the Lister strain or the NYCBH strain of vaccinia virus.
The second aspect of the application provides a construction method of an oncolytic vaccinia virus carrying a SIKE gene, comprising the following two major steps: (A) Inserting the gene sequence of SIKE into pCB plasmid through Xba I and Bgl II sites to obtain pCB-SIKE plasmid; (B) The pCB-SIKE plasmid and vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the SIKE gene.
Preferably, in the step (B), the oncoVV-SIKE vaccinia virus is obtained by recombination of a vaccinia virus Western Reserve strain and a pCB-SIKE plasmid.
In the construction method of the present application, both of the step (A) and the step (B) may be operated by a conventional operation method. In the step (B), during recombination, the vaccinia virus Western Reserve (WR) strain and the pCB-SIKE plasmid are recombined in 293A cells, and cell transfection is performed according to the instruction of a kit (Effectene); during screening, screening recombinant virus liquid by taking xanthine, hypoxanthine and mycophenolic acid as screening medicaments, and separating the recombinant virus by a plaque experiment; upon identification, PCR was performed using the characteristics of the wild-type virus with the complete TK region but not the recombinant virus to obtain purified oncolytic vaccinia virus oncoVV-SIKE.
Experiments prove that the replication level of the oncoVV-SIKE vaccinia virus in tumor cells is higher than that of a control vaccinia virus without the SIKE gene; compared with a control virus, the oncoVV-SIKE has better treatment effect on tumor-bearing mice, and can obviously prolong the survival time of the tumor-bearing mice.
In a third aspect, the application provides the use of an oncolytic vaccinia virus carrying a SIKE gene for the preparation of an antitumor agent.
Preferably, the antitumor drug is a drug for treating liver cancer, breast cancer or glioma. According to the description of the embodiment 3 of the application, the oncolytic vaccinia virus oncovV-SIKE has remarkable in vitro inhibition effect on liver cancer cells, breast cancer cells and glioma cells, and is dose-dependent and time-dependent, as detected by MTT method. According to the descriptions of examples 4 to 5, oncoVV-SIKE also had a remarkable therapeutic effect on tumor-bearing animal models, and the effect was remarkable in animal experiments.
Preferably, the antitumor agent is a pharmaceutical composition comprising an oncolytic vaccinia virus carrying the SIKE gene as the sole active ingredient or comprising an oncolytic vaccinia virus carrying the SIKE gene.
The antitumor drug referred to in the present application, which is a drug having the effect of inhibiting and/or treating tumors, may include a delay in the development of symptoms associated with tumor growth and/or a reduction in the severity of these symptoms, and it further includes a reduction in the symptoms associated with existing tumor growth and prevention of the occurrence of other symptoms, and also a reduction or prevention of metastasis.
In a fourth aspect, the present application provides a pharmaceutical composition of an oncolytic vaccinia virus carrying the SIKE gene, comprising a pharmaceutically acceptable carrier.
The recombinant virus and pharmaceutically acceptable auxiliary materials form a pharmaceutical preparation composition, so that the pharmaceutical preparation composition can exert curative effects more stably, and the preparations can ensure the structural integrity of the amino acid core sequence of the bispecific antibody disclosed by the application, and also can protect the multifunctional groups of proteins from degradation (including but not limited to condensation, deamination or oxidation).
In general, liquid formulations can be stored at 2 ℃ to 8 ℃ for at least one year, and lyophilized formulations remain stable at 30 ℃ for at least six months. The preparation can be suspension, water injection, freeze-drying preparation and the like commonly used in the pharmaceutical field.
In the case of administering the recombinant virus and the composition thereof of the present application to animals including humans, the administration amount varies depending on the age and weight of the patient, the nature and severity of the disease, and the administration route, and the results and various conditions of animal experiments may be referred to, and the total administration amount may not exceed a certain range.
The application has the beneficial effects that:
the application provides an oncolytic vaccinia virus carrying a SIKE gene, a construction method and application thereof, and experiments prove that the oncolytic vaccinia virus oncoVV-SIKE has remarkable in-vitro inhibition effect on various tumor cells such as liver cancer cells, breast cancer cells or glioma cells, is dose-dependent and time-dependent, has remarkably improved virus replication level, and has remarkable treatment effect on tumor animal models. Therefore, the application can be used for preparing anti-tumor virus medicaments, provides a new target point for tumor virus treatment, and has wide clinical application prospect.
In addition, the preparation method of the recombinant oncolytic vaccinia virus carrying the SIKE gene is mature, is suitable for large-scale standardized production, and provides a guarantee for future clinical application.
Drawings
FIG. 1 is a map of pCB-SIKE plasmid.
FIG. 2 shows comparison of replication levels of oncolytic vaccinia virus oncovV-SIKE and control virus oncovV in tumor cells MHCC97-H (A) and U87MG (B).
FIG. 3 shows the in vitro inhibition of tumor cells BEL-7404 (A), MHCC97-H (B), U87MG (C) and MDA-MB-231 (D) by MTT assay of oncolytic vaccinia virus oncovV-SIKE, and oncovV as control virus.
FIG. 4 shows the inhibition of U87MG mice engraftment by oncolytic vaccinia virus oncovV-SIKE in vivo, with PBS and oncovV-GM-CSF as controls.
FIG. 5 shows the effect of oncolytic vaccinia virus oncovV-SIKE on survival time of U87 MG-bearing mice, PBS and oncovV-GM-CSF as controls.
FIG. 6 is a result of conserved domain analysis of amino acid sequences of SIKE using the NCBI conserved domain database.
Detailed Description
The following examples and experimental examples are provided to further illustrate the present application and should not be construed as limiting the present application. Examples do not include detailed descriptions of conventional methods, such as PCR methods, those used to construct vectors and plasmids, methods of inserting genes encoding proteins into such vectors and plasmids, or methods of introducing plasmids into host cells. Such methods are well known to those having ordinary skill in the art and are described in numerous publications, including Sambrook, j., fritsch, e.f. and maniis, t. (1989) Molecular Cloning: a Laboratory Manual,2 nd edition，Cold spring Harbor Laboratory Press。
The experimental methods of the specific conditions are not noted in the following examples, either according to conventional conditions or according to the conditions recommended by the manufacturer. The following examples illustrate the construction and use of oncolytic vaccinia virus by way of example of recombination of the Western Reserve (WR) strain of vaccinia virus with the SIKE gene. However, the scope of the present application is not limited thereto, and is also applicable to recombination of other vaccinia virus strains with the SIKE gene.
Example 1 construction and characterization of vaccinia Virus oncoVV-SIKE
1. The gene sequence of SIKE (SEQ ID NO. 1) was inserted into pCB plasmid through Xba I and Bgl II sites to obtain pCB-SIKE plasmid.
The pCB-SIKE plasmid map is shown in FIG. 1. Wherein vTK-L and vTK-R insert the foreign gene into the TK region by homologous recombination with the thymidine kinase TK region of the wild-type virus, while causing TK deletion. In addition, the plasmid also carries xanthine guanine phosphotransferase (xanthine-guanine phoshporibosyl transferase, gpt) gene as a screening gene, the gpt gene is derived from Escherichia coli, and in the presence of mycophenolic acid (MPA), viruses or cells die because MPA can block guanine synthesis, and thus the synthesis of nucleic acid of the viruses or cells cannot be normally performed. In the presence of gpt gene, the cell or virus can synthesize guanine by alternative routes using hypoxanthine (hypoxanthine) and xanthine (xanthine), so that nucleic acid synthesis is not limited.
2.The recombination of the Western Reserve (WR) strain vaccinia virus and pCB-SIKE plasmid proceeds as follows:
(1) At an area of 6cm 2 Appropriate numbers of 293A cells were inoculated into the dishes of (E) to allow for 80-90% sheeting the next day.
(2) Removing the culture solution, gently adding 1mL of virus solution (0.05-0.1 MOI, diluting the virus solution with 2% serum-containing medium) along the side wall, standing at 37deg.C, and 5% CO 2 Culturing in an incubator for 2-4 hours, and shaking uniformly every 15min to prevent the cells from dying locally.
(3) Cell transfection was performed according to the kit (effect) instructions, as follows:
1. Mu.g of pCB-SIKE was supplemented with buffer EC to 150. Mu.L, and 8. Mu.L of enhancement buffer was added, respectively, and the mixture was shaken for 1s and allowed to stand at room temperature for 5min. 25 mu L of Effectene buffer is added into the three mixtures respectively, the mixture is mixed for 5 times in a reverse way, the mixture is oscillated for 10s and kept stand for 5 to 10min at room temperature, and then 1mL of fresh culture solution (which can contain serum and antibiotics) is added into the mixture respectively, and the mixture is inverted for two times.
At the same time, the virus solution in step 2 was discarded, 4mL of 10% FBS fresh culture solution was added, and the mixed transfection solutions were added thereto, respectively, and then the culture dish was placed at 37℃with 5% CO 2 After culturing for 6-18 hours in the incubator, the culture solution is sucked, washed once by PBS, and 5mL of fresh culture solution is added for continuous culturing.
(4) After the cells are completely diseased, collecting virus liquid in a biosafety cabinet, subpackaging the virus liquid into a centrifuge tube, marking the centrifuge tube, repeatedly freezing and thawing the centrifuge tube for three times at-80 ℃ and 37 ℃, thoroughly lysing the cells to release the virus, centrifuging at 2000rmp for 5min, collecting the supernatant, and storing the supernatant in an ultralow temperature refrigerator at-80 ℃ for later use.
3. Screening recombinant viruses, comprising the following steps:
(1) 293A cells with good growth state are inoculated in a culture dish, and the next day cell density can reach about 80% -90%.
(2) Three screening drugs were prepared: xanthine, hypoxanthine, mycophenolic acid.
(3) 500. Mu.L of the previously packaged virus solution was carefully added to the side wall of each dish in (1), and the mixture was placed at 37℃with 5% CO 2 Culturing in an incubator for 2-4h; after about 2-4h, the suspended virus solution was aspirated and 3mL of fresh medium containing 7.5. Mu.L of (1X) mycophenolic acid, 75. Mu.L of (1X) xanthine and 7.5. Mu.L of (1X) hypoxanthine was added.
(4) And observing cytopathic conditions every day, collecting all cytopathic cell sap in a biosafety cabinet after about two or three days, repeatedly freezing and thawing for three times, and storing in an ultralow temperature refrigerator at-80 ℃ for standby.
(5) The virus liquid collected each time is screened repeatedly for 3-4 times according to the method.
4. Virus plaque and identification
(1) Preparing 5% low melting point glue: 0.25g of the low-melting-point glue is weighed and dissolved in 5mL of PBS, and the mixture is autoclaved for 20min at 121 ℃, and then stored in a refrigerator at 4 ℃ for standby.
(2) Inoculating 293A cells in good condition into six-hole plate, and when cell density reaches about 90% the next day, mixing virus liquid according to 10 -4 ～10 -6 Serial dilutions were performed on the gradient, after which six were discardedAdding 1mL of diluted virus liquid into each hole of old culture solution in the hole plate to enable viruses to be adsorbed, placing the old culture solution in an incubator for culturing for 2-4 hours, and placing the boiled low-melting-point glue in a water bath kettle with the temperature of 40 ℃ for heat preservation; then placing into an ultra clean bench, adding three times volume of DMEM culture solution to make its final concentration be 1.25%, quickly mixing uniformly by using a pipette and quickly sucking away the suspended virus solution in the plate by using a pipette, then carefully adding 2mL of culture solution containing 1.25% of low-melting-point glue along the side wall by using a pipette, taking care not to blow up the cells, then placing it at 37 deg.C and 5% CO 2 Is cultured in a cell culture box.
(3) Observing cytopathy condition under inverted microscope every day, if isolated virus plaque appears, picking it up and placing it in 12-well plate with 293A cells laid in advance, marking, placing it at 37deg.C, 5% CO 2 After the cell culture box is fully diseased, collecting the virus liquid in a 1.5mL centrifuge tube in a safety cabinet, and storing in an ultralow temperature refrigerator at-80 ℃ for further identification.
(4) PCR identification (self-identification) was performed using features of the wild-type virus with intact TK region but not of the recombinant virus, resulting in a purified oncolytic vaccinia virus oncovV-SIKE.
Example 2 replication levels of oncolytic vaccinia virus oncoVV-SIKE in tumor cells were significantly higher than control virus oncoVV
Liver cancer cell MHCC97-H or glioma cell U87MG is mixed according to the ratio of 5 multiplied by 10 3 Density of wells/wells were seeded into 96-well plates, each well was incubated overnight with 90. Mu.L of cell culture broth, 5MOI oncoVV-SIKE virus or control virus oncoVV, respectively, and 3 or more replicate wells were placed per time gradient. Cells were collected together with culture medium and the replication efficiency of oncoVV-SIKE and control virus oncoVV in tumor cells was examined by TCID50 method (half the amount of tissue culture infection).
The detection results are shown in fig. 2: the replication efficiency of the oncoVV-SIKE virus in hepatoma cells mhc 97-H and glioma cells U87MG is significantly higher than that of the control virus oncoVV.
Example 3 MTT method for detecting in vitro inhibitory Effect of oncoVV-SIKE on tumor cells
Liver cancer is the choice in this experimentCells BEL-7404 and MHCC97-H, glioma cell U87MG and breast cancer cell MDA-MB-231, respectively, at 5X 10 3 The density of each well is inoculated into a 96-well plate, 90 mu L of cell culture solution is added into each well for culture overnight, 1MOI, 2MOI or 5MOI of virus is respectively added, 6 repeated wells are arranged, the experimental control group is cells without virus, and the blank group is culture solution without cells.
37℃，5％CO 2 The culture was continued for 72 hours, and 20. Mu.L of MTT solution (5 mg/mL) was added to each well in the dark. The incubator was left to stand for 4 hours, after the culture liquid of each tissue was sucked off, 150. Mu.L of dimethyl sulfoxide was added to each well, and the mixture was put on a shaker for shaking for 10 minutes to sufficiently dissolve the crystals. And (3) measuring an OD value on an ELISA (enzyme-linked immunosorbent assay) with a detection wavelength of 490nm.
Cell viability was calculated from the OD values measured as:
cell viability = (treatment OD value-zeroed OD value)/(control OD value-zeroed OD value) ×100%.
The analysis results are shown in FIG. 3, the oncoVV-SIKE significantly inhibited tumor cell proliferation in vitro, was dose dependent, and was significantly superior to the control virus oncoVV.
Example 4 oncoVV-SIKE significantly inhibited the growth of transplanted tumor in U87MG mice
The glioma cells U87MG are used for establishing subcutaneous transplantation tumor of nude mice, oncoVV-GM-CSF, oncoVV-SIKE or equal volume PBS is injected into the abdominal cavity, and tumor volume is measured periodically. oncoVV-GM-CSF is similar to the oncolytic vaccinia virus drug Pexa-Vec (previously known as JX-594) that has entered clinical stage III, and is self-constructed according to literature reports (parao, k.a., c.j.breitbach, et al 2012.the oncolytic poxvirus JX-594 selectively replicates in and destroys cancer cells driven by genetic pathways commonly activated in cancers.Mol Ther 20 (4): 749-758). The animal experiment method is as follows:
all animal experimental procedures of the study were performed strictly with reference to NIH experimental animal guidelines, 4-week-old female BALB/c nude mice were selected and injected 1X 10 per mouse 7 mu.L of cells were subcutaneously injected into the U87MG cells at the axilla ends of the forelimbs. Tumor volume growth was observed daily after cell injection and measured with a micrometer to calculate tumor volume ((mm) 3 ) = (length x width 2 )/2). When the tumors grew to steady state, they were divided into 3 groups: PBS group, oncovV-GM-CSF group and oncovV-SIKE group, 6-8 nude mice each. After grouping, 1 intraperitoneal injection of 1×10 per nude mice was performed 7 pfu virus or an equal volume of PBS, then tumor volumes are measured periodically.
The results are shown in FIG. 4, in which tumors of the oncoVV-SIKE group began to shrink about 25 days after virus injection, while PBS and the oncoVV-GM-CSF control group continued to grow, indicating that oncoVV-SIKE significantly inhibited U87MG mice from engrafting tumors.
Example 5 oncoVV-SIKE significantly prolonged survival of U87 MG-bearing mice
Establishes subcutaneous transplantation tumor of nude mice by utilizing glioma cell U87MG, and is injected into abdominal cavity with 1 multiplied by 10 7 pfu oncovV-GM-CSF, oncovV-SIKE or an equal volume of PBS, and mice time to death was recorded. The animal experiment was as described in example 4.
The results are shown in FIG. 5: both oncoVV-GM-CSF and oncoVV-SIKE significantly prolonged the survival time of tumor-bearing mice compared to PBS, but oncoVV-SIKE was superior to oncoVV-GM-CSF. The average survival times of PBS, oncovV-GM-CSF and oncovV-SIKE mice were 28.5, 44 and 57.5 days, respectively.
Example 6 conserved Domain analysis of SIKE proteins
The amino acid sequence of SIKE was analyzed using the conserved domain database (Conserved Domain Database, CDD) of the national center for biotechnology information (National Center for Biotechnology Information, NCBI) to obtain the conserved domain information of SIKE.
The results are shown in FIG. 6: the SIKE protein contains 1 conserved domain, which is a SIKE family conserved domain at amino acids 4-561, which is conserved among SIKE family members, including SIKE, circulating Cathodic Antigen (CCA), and FGFR1 oncogene partner 2.
While the preferred embodiments of the present application have been described in detail, the present application is not limited to the embodiments, and various equivalent modifications and substitutions can be made by those skilled in the art without departing from the spirit of the present application, and these equivalent modifications and substitutions are intended to be included in the scope of the present application as defined in the appended claims.
。
Sequence listing
<110> Hangzhou Chao biotechnology Co., ltd
<120> oncolytic vaccinia virus carrying SIKE gene, construction method and application
<130> claim specification
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 624
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgagctgca ccatcgagaa gatcctgaca gacgccaaga cgctgctgga gaggctacgg 60
gagcacgatg cggccgccga gtcgctggtg gatcagtcgg cggcgctgca ccggcgggta 120
gcagctatgc gggaggcggg gacagcgctt ccggaccagt atcaagagga tgcatccgat 180
atgaaggaca tgtccaaata caaacctcac attctgctgt cccaagagaa cacacagatt 240
agagacttgc aacaggaaaa cagagagcta tggatttcct tggaggaaca ccaggatgct 300
ttggaactta tcatgagcaa atatcggaaa cagatgttac agttaatggt tgctaaaaaa 360
gcggtggatg ctgaaccagt cctgaaagct caccagtctc actctgcaga aattgagagt 420
cagattgaca gaatctgtga aatgggagaa gtgatgagga aagcagttca ggtggatgat 480
gaccagtttt gtaagattca ggaaaaatta gcccaattag agcttgaaaa taaggaactt 540
cgagaattat tgtccatcag cagtgagtct cttcaagcca gaaaggaaaa ctcaatggac 600
actgcttccc aagccatcaa ataa 624
Claims (6)
1. The application of the oncolytic vaccinia virus carrying the SIKE gene in preparing an antitumor drug is characterized in that the oncolytic vaccinia virus carries the SIKE gene, and the DNA sequence of the SIKE gene is shown as SEQ ID NO. 1; the antitumor drug is a drug for treating liver cancer, breast cancer or glioma.
2. Use of an oncolytic vaccinia virus carrying a SIKE gene according to claim 1 for the preparation of an antitumor drug, characterized in that:
wherein the oncolytic vaccinia virus is a vaccinia virus WesternReserve strain, a vaccinia virus Tiantan strain, a vaccinia virus Wyeth strain, a vaccinia virus Copenhagen strain, a vaccinia virus Lister strain or a vaccinia virus NYCBH strain.
3. The use of an oncolytic vaccinia virus carrying a SIKE gene according to claim 1 or 2 for the preparation of an antitumor drug, wherein the construction method of an oncolytic vaccinia virus carrying a SIKE gene comprises the steps of:
(A) Inserting the gene sequence of SIKE into pCB plasmid through XbaI and BglII sites to obtain pCB-SIKE plasmid;
(B) The pCB-SIKE plasmid and vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the SIKE gene.
4. Use of an oncolytic vaccinia virus carrying a SIKE gene according to claim 3 for the preparation of an antitumor drug, characterized in that:
wherein, the step B is the recombination of vaccinia virus WesternReserve strain and pCB-SIKE plasmid, and the oncoVV-SIKE vaccinia virus is constructed and obtained.
5. Use of an oncolytic vaccinia virus carrying a SIKE gene according to claim 1 for the preparation of an antitumor drug, characterized in that:
the anti-tumor drug takes the oncolytic vaccinia virus carrying the SIKE gene as the only active ingredient or is a pharmaceutical composition containing the oncolytic vaccinia virus carrying the SIKE gene.
6. A pharmaceutical composition comprising the SIKE gene-carrying oncolytic vaccinia virus as claimed in claim 1 or 2, comprising the SIKE gene-carrying oncolytic vaccinia virus as an active ingredient, further comprising a pharmaceutically acceptable pharmaceutical carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010507015.2A CN113755455B (en) | 2020-06-05 | 2020-06-05 | Oncolytic vaccinia virus carrying SIKE gene, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010507015.2A CN113755455B (en) | 2020-06-05 | 2020-06-05 | Oncolytic vaccinia virus carrying SIKE gene, construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113755455A CN113755455A (en) | 2021-12-07 |
| CN113755455B true CN113755455B (en) | 2023-09-12 |
Family
ID=78785114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010507015.2A Active CN113755455B (en) | 2020-06-05 | 2020-06-05 | Oncolytic vaccinia virus carrying SIKE gene, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113755455B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695543A (en) * | 2013-12-16 | 2014-04-02 | 中国人民解放军第二军医大学 | Application of pattern recognition receptor RIG-I in preparing kit for tumor diagnosis or prognosis evaluation |
| CN104107430A (en) * | 2014-08-01 | 2014-10-22 | 武汉大学 | Function and application of IkB kinase epsilon inhibitor (SIKE) in treating cardiac hypertrophy |
| CN110564700A (en) * | 2018-06-06 | 2019-12-13 | 杭州功楚生物科技有限公司 | Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015070027A1 (en) * | 2013-11-07 | 2015-05-14 | University Of Southern California | Use of ikk epsilon inhibitors to activate nfat and t cell response |
-
2020
- 2020-06-05 CN CN202010507015.2A patent/CN113755455B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695543A (en) * | 2013-12-16 | 2014-04-02 | 中国人民解放军第二军医大学 | Application of pattern recognition receptor RIG-I in preparing kit for tumor diagnosis or prognosis evaluation |
| CN104107430A (en) * | 2014-08-01 | 2014-10-22 | 武汉大学 | Function and application of IkB kinase epsilon inhibitor (SIKE) in treating cardiac hypertrophy |
| CN110564700A (en) * | 2018-06-06 | 2019-12-13 | 杭州功楚生物科技有限公司 | Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application |
Non-Patent Citations (1)
| Title |
|---|
| Silencing of IKKε using siRNA inhibits proliferation and invasion of glioma cells in vitro and in vivo;Li H等;《International Journal of Oncology》;第41卷(第1期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113755455A (en) | 2021-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128550B (en) | Novel replicative oncolytic adenovirus capable of simultaneously blocking immune check points PD-L1 and TIGIT and application | |
| CN110499297B (en) | Novel oncolytic virus and preparation method and application thereof | |
| JP7025339B2 (en) | Replicable attenuated vaccinia virus with or without expression of human FLT3L or GM-CSF with thymidine kinase deletion for cancer immunotherapy | |
| KR100392984B1 (en) | Recombinant Cells from the Monocyte-Macrophage Cell System for Gene Therapy | |
| US11806374B2 (en) | Isolated recombinant oncolytic adenoviruses, pharmaceutical compositions, and uses thereof for drugs for treatment of tumors and/or cancers | |
| CN111467489B (en) | Medicine for treating tumor | |
| WO2019062234A1 (en) | Isolated recombinant oncolytic poxvirus, pharmaceutical composition, and use thereof in treatment of tumors and/or cancer | |
| JPH06508039A (en) | Recombinant defective adenovirus expressing cytokines for antitumor therapy | |
| JP7378840B2 (en) | Oncolytic virus expressing interferon and its application | |
| BR112020013715A2 (en) | modified vaccinia vectors | |
| CN111925996A (en) | African swine fever gene deletion attenuation and live vaccine thereof | |
| JP2021503965A (en) | Immunomodulatory vaccinia virus strain with high replication efficiency | |
| US20220275370A1 (en) | Striatin interacting protein inhibitor and use thereof in preparation of anti-tumor drug | |
| CN113755455B (en) | Oncolytic vaccinia virus carrying SIKE gene, construction method and application | |
| CN110564700B (en) | Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application | |
| CN111979204B (en) | Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application | |
| CN111979203B (en) | Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs | |
| US11951141B2 (en) | Replication-enhanced oncolytic adenoviruses | |
| CN114712393B (en) | Application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer | |
| RU2779634C1 (en) | Immunobiological agent and method for its use for induction of specific immunity against viruses sars-cov-2 variant b.1.617.2 (delta) and sars-cov-2 variant b.1.1.529 (omicron) (variants) | |
| WO2021197506A1 (en) | Recombinant newcastle disease virus and preparation method, recombinant plasmid, and use therefor | |
| WO2017167209A1 (en) | Trail-secreting mesenchymal stem cells and use thereof to treat brain tumors | |
| US20190284538A1 (en) | Recombinant oncolytic virus, synthetic dna sequence, and application thereof | |
| JP2007063190A (en) | Angiogenesis inhibitor using cancer cell-specific gene expression method | |
| CN108841867A (en) | The recombined glandulae correlation viral vectors and its construction method of carrying SCC/BST2 mutant antigen gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |