CN111979203B - Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs - Google Patents

Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs Download PDF

Info

Publication number
CN111979203B
CN111979203B CN201910440396.4A CN201910440396A CN111979203B CN 111979203 B CN111979203 B CN 111979203B CN 201910440396 A CN201910440396 A CN 201910440396A CN 111979203 B CN111979203 B CN 111979203B
Authority
CN
China
Prior art keywords
cttnbp2nl
vaccinia virus
gene
tumor
oncolytic vaccinia
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910440396.4A
Other languages
Chinese (zh)
Other versions
CN111979203A (en
Inventor
李恭楚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou Gongchu Biological Technology Co ltd
Original Assignee
Hangzhou Gongchu Biological Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou Gongchu Biological Technology Co ltd filed Critical Hangzhou Gongchu Biological Technology Co ltd
Priority to CN201910440396.4A priority Critical patent/CN111979203B/en
Publication of CN111979203A publication Critical patent/CN111979203A/en
Application granted granted Critical
Publication of CN111979203B publication Critical patent/CN111979203B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/768—Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention relates to the technical field of biomedical engineering, and provides an oncolytic vaccinia virus carrying CTTNBP2NL gene, a construction method and application thereof, wherein the DNA sequence of the CTTNBP2NL gene is shown as SEQ ID NO. 1. The construction method of the recombinant oncolytic vaccinia virus comprises two steps: (A) inserting the gene sequence of CTTNBP2NL into pCB plasmid through Xba I and Bgl II sites to obtain pCB-TTL plasmid; (B) the pCB-TTL plasmid and the vaccinia virus are recombined in cells, and are screened and identified to obtain the oncolytic vaccinia virus carrying the CTTNBP2NL gene. The oncolytic vaccinia virus disclosed by the invention has a remarkable inhibition effect on various tumor cells, remarkably improves the anti-tumor capacity of the oncolytic vaccinia virus in tumor-bearing mice, is reflected in inhibiting tumor growth and prolonging the survival time of the tumor-bearing mice, provides a new target for tumor virus treatment, and has a wide clinical application prospect.

Description

Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs
Technical Field
The invention relates to the technical field of biomedicine, in particular to an oncolytic vaccinia virus carrying a cortin-binding protein 2N-terminal-like protein (CTTNBP 2NL) gene, a construction method and application thereof.
Background
Oncolytic viruses refer to therapeutically valuable viruses that selectively infect and damage tumor tissue. Oncolytic viruses have a long history, and oncolytic viruses belonging to 10 virus families have been clinically tested to date, including Adenovirus (Adenovirus), Coxsackie virus (Coxackie virus), Herpes simplex virus (Herpes simplex virus, HSV), Measles virus (Measles virus), Newcastle disease virus (Newcastle disease virus), Parvovirus (Parvovirus), Poliovirus (Poliovirus), Reovirus (Reovirus), Vaccinia virus (Vaccidia virus) and Vesicular stomatitis virus (Vesicular stomatis virus). Herpes virus T-VEC is currently approved by the FDA for the treatment of melanoma. In general, oncolytic viruses have shown considerable safety and efficacy in clinical trials.
Vaccinia virus is a large double-stranded DNA virus in the poxvirus family that has several advantages over other oncolytic viruses: (1) it is unique among DNA viruses in that it replicates only in the cytoplasm to minimize the risk of integration within the host genome; (2) vaccinia virus was first formulated as a vaccine against smallpox virus, and its safety is greatly protected; (3) the cloning capacity of the vaccinia virus is large, and the insertion of a gene segment with larger length can be allowed; (4) the virus has strong replication capacity.
Oncolytic vaccinia viruses have shown anti-tumor efficacy. Most of the existing common oncolytic vaccinia viruses are subjected to attenuation modification, and comprise viral strains with deletion of a TK gene of thymidylate kinase or double deletion of a TK/vaccinia virus growth factor gene and the like. Deletion of the TK gene makes replication of vaccinia more dependent on intracellular TK levels, whereas cancer cells tend to have higher levels of TK compared to normal cells; in addition, vaccinia virus replication is dependent on the activation of the epidermal growth factor receptor, the EGFR/Ras pathway, making it highly selective for cancer cells. Oncolytic vaccinia viruses have shown the ability to target aggregate to cancer tissues in both experimental animals and humans, and have become an ideal viral vector for cancer therapy.
CTTNBP2NL has been shown to be involved in the composition of the complex of the striated interactive phosphatases and kinases (STRIPAK), Goudeault, M, L.M.D' Ambrosio, et al 2009.A PP2A phosphatases high intensity interaction network identities a non-linear phosphatases and kinase complex linked the cellular productivity model 3(CCM3) protein Cell Proteomics 8(1): 157-. The gene of CTTNBP2NL was cloned to a non-replicative adenovirus vector in the present group, and Ad-CTTNBP2NL recombinant adenovirus was constructed. Compared with a virus vector, Ad-CTTNBP2NL can obviously inhibit the in vitro proliferation of tumor cells, and shows that the exogenous expression of the CTTNBP2NL gene can generate certain cytotoxic effect on the tumor cells (Zhaozhen, anticancer research of recombinant adenovirus carrying the CTTNBP2NL gene, Shuichi academic thesis of Zhejiang university of science, 2017). However, the authors have not further verified by subsequent animal experiments, and it is unknown whether the recombinant adenovirus has a therapeutic effect on tumor cells in animal experiments, and therefore, it is not possible to determine whether the CTTNBP2NL gene can be applied to tumor therapy according to the experimental results.
In addition, whether the CTTNBP2NL gene is combined with oncolytic vaccinia virus and whether the CTTNBP2NL gene and oncolytic vaccinia virus only have a vector expression relationship or have a synergistic effect to jointly antagonize tumors is not reported yet.
Disclosure of Invention
The invention aims to solve the technical problems, and achieves a better treatment effect on tumor-bearing mice by combining the CTTNBP2NL gene with oncolytic vaccinia virus, so that the invention provides the oncolytic vaccinia virus carrying the CTTNBP2NL gene, a construction method and application thereof.
The first aspect of the present invention provides an oncolytic vaccinia virus carrying the CTTNBP2NL gene, wherein the oncolytic vaccinia virus carries the CTTNBP2NL gene (GenBank: NM-018704.3), and the DNA sequence of the CTTNBP2NL gene is shown in SEQ ID NO: 1:
atgaatct ggaaaaactc agcaagcctg aactcctgac actatttagt attcttgaag gagagcttga agcaagggac cttgttatag aagccttaaa ggcccaacac agagatactt tcattgaaga acgctatgga aaatataaca tcagtgatcc tttaatggct ctacagagag attttgaaac actgaaggag aaaaatgatg gcgaaaagca gccagtctgcacaaatccac tctctattct taaggttgtg atgaagcagt gcaagaacat gcaggagcgc atgctgtccc agctggctgc tgctgagagc aggcaccgaa aggtgatcct agaccttgag gaagaaaggc agcggcatgc acaggatacg gctgaaggag atgatgtcac ctacatgcta gagaaggaaa gagagaggct gactcaacag ttggaatttg aaaaatccca agtgaaaaag tttgaaaaag aacagaagaa gctctctagt cagctggaag aggagcgctc ccgccacaag cagctctcat ccatgctagt gcttgagtgc aagaaagcca ccaacaaggc agccgaggaa ggacagaagg caggagagct gagcctgaaa ttggagaagg agaagagccg ggtgagtaaa ctggaagaag agttggcagc tgagagaaag agaggcttgc agactgaggc ccaggtagag aagcagttat cagagtttga catcgaaagg gaacaactga gagcaaaact gaaccgagaa gagaaccgga ccaaaaccct gaaagaagaa atggaaagtt taaagaagat agtgaaggac ctagaggctt cccaccagca cagtagccct aatgagcaat tgaagaaacc agtaaccgtg tccaaaggca cagcaactga gcctctcatg ctaatgtctg tgttttgcca aacagagagttttccagcag aaagaaccca tgggagcaac atagccaaga tgacaaacac tgggctgcct ggtcctgcca ctcctgctta ctcatatgca aaaaccaatg gccattgtga cccagagata caaactacca gggagctgac tgcaggcaac aatgtagaaa accaggtgcc tccacgggaa aaatctgtgg cattggccca agagaaacca gtggagaatg gtgggtgtcc tgtggggatt gagactccag tcccaatgcc cagtcccctc tcttccagtg ggagctcact gtctcccagcagcactgcct cctcctctct aacatcctct ccttgctctt cgccggtact cactaagcgt ttattggggt catcagctag cagccctggc taccagtcat cgtaccaagt agggatcaac caacggttcc atgcagctcg ccacaaattt cagtcccaag cagatcagga ccaacaagcc agtggcctac agagccctcc atccagggat ttatccccca ccctcataga caactctgcc gccaagcagc tggcccgaaa cacagtcact caggtgctct ccagattcac tagccaacaa gggccaatca agccagtctc tcccaacagc tctccctttg gcacagacta tcgaaatcta gccaacactg ccaatccaag aggtgacaca agccattcac ctactccagg gaaagtgtcc agtcccctga gccccctgtc tccaggaatc aagtccccaa ccatccccag agctgagaga ggaaaccctc cacccatccc acccaagaaa cctggcctca ccccttctcc atctgctacc actccattga ccaaaactca ttcccaggca gcctctttga ccactgcaga agaccttgccagcagctgct cttccaatac tgttgtagca aatggtaagg atgttgagtt acttttgcct accagcagct ag
preferably, the vaccinia virus is the vaccinia virus Western Reserve strain, the vaccinia virus Tiantan strain, the vaccinia virus Wyeth strain, the vaccinia virus Copenhagen strain, the vaccinia virus Lister strain or the vaccinia virus NYCBH strain.
Experiments prove that the oncoVV-CTTNBP2NL has obvious treatment effects on various tumor animal models, can obviously inhibit the growth of hepatoma cell BEL-7404 mouse transplanted tumors, obviously eliminate glioma cell U87MG mouse transplanted tumors, obviously prolong the survival time of U87MG tumor-bearing mice and obviously inhibit the growth of colorectal cancer cell HCT116 mouse transplanted tumors (see examples 3-5).
According to the results of example 5, compared to vaccinia virus (oncoVV-GM-CSF) carrying granulocyte macrophage colony stimulating factor gene and adenovirus (Ad-CTTNBP2NL, the contents of the Zhao Zhen Shuoshi paper) carrying CTTNBP2NL gene, the onco-bearing mouse has better treatment effect of the onco-bearing mouse by the onco-VV-CTTNBP 2NL, and the survival time of the onco-bearing mouse can be remarkably prolonged. Meanwhile, the experimental result also shows that the CTTNBP2NL recombinant adenovirus vector Ad-CTTNBP2NL only generates certain toxicity to cells in an in vitro experiment, no effect is generated in an animal experiment, and the survival time of tumor-bearing mice in the experimental group is not different from that of a PBS group.
The second aspect of the invention provides a construction method of an oncolytic vaccinia virus carrying CTTNBP2NL gene, which comprises the following two steps: (A) inserting the gene sequence of CTTNBP2NL into pCB plasmid through Xba I and Bgl II sites to obtain pCB-CTTNBP2NL plasmid; (B) the pCB-CTTNBP2NL plasmid and vaccinia virus are recombined in cells, and after screening and identification, oncolytic vaccinia virus carrying CTTNBP2NL gene is obtained.
Preferably, the oncoVV-CTTNBP2NL vaccinia virus is constructed by recombining the Western Reserve strain of vaccinia virus and the plasmid pCB-CTTNBP2NL in the step (B).
In the construction method of the present invention, both of the step (A) and the step (B) can be carried out by a conventional operation method. In the step (B), during recombination, the vaccinia virus Western Reserve (WR) strain and the pCB-CTTNBP2NL plasmid are recombined in 293A cells, and the cell transfection is carried out according to the instruction of a kit (Effectene); during screening, taking xanthine, hypoxanthine and mycophenolic acid as screening drugs to screen recombinant virus liquid, and separating recombinant viruses through a plaque experiment; in identification, PCR identification is carried out by utilizing the characteristics that wild type viruses have complete TK regions but recombinant viruses do not have, and purified oncolytic vaccinia virus oncoVV-CTTNBP2NL is obtained.
The third aspect of the invention provides application of oncolytic vaccinia virus carrying CTTNBP2NL gene in preparing antitumor drugs.
Preferably, the anti-tumor drug is a drug for treating liver cancer, colorectal cancer, glioma, lung cancer, pancreatic cancer, prostate cancer and breast cancer. According to the description of the embodiment 2 of the invention, the in vitro inhibition effect of the oncolytic vaccinia virus oncoVV-CTTNBP2NL on liver cancer cells, colorectal cancer cells, glioma cells, lung cancer cells, pancreatic cancer cells, prostate cancer cells and breast cancer cells is obvious and is dose-dependent and time-dependent through the detection of the MTT method. According to the descriptions of examples 3 to 5, oncoVV-CTTNBP2NL has a significant therapeutic effect on various tumor animal models, and has a significant effect in animal experiments.
Preferably, the antitumor agent is an oncolytic vaccinia virus carrying CTTNBP2NL gene as the only active ingredient or a pharmaceutical composition comprising an oncolytic vaccinia virus carrying CTTNBP2NL gene.
The anti-tumor drug referred to in the present invention means a drug having an effect of inhibiting and/or treating a tumor, and may include a delay in the development of symptoms associated with tumor growth and/or a reduction in the severity of these symptoms, and it further includes a reduction in existing symptoms associated with tumor growth and prevention of the occurrence of other symptoms, and also a reduction or prevention of metastasis.
In a fourth aspect of the present invention, there is provided a pharmaceutical composition of oncolytic vaccinia virus carrying CTTNBP2NL gene, characterized by further comprising a pharmaceutically acceptable pharmaceutical carrier.
The recombinant virus of the present invention and pharmaceutically acceptable excipients together form a pharmaceutical composition to exert therapeutic effects more stably, and these preparations can ensure the conformation integrity of the amino acid core sequence of the bispecific antibody disclosed in the present invention, and at the same time protect the multifunctional group of the protein from degradation (including but not limited to aggregation, deamination or oxidation).
In general, liquid formulations can be stable for at least one year at 2 ℃ to 8 ℃ and lyophilized formulations can be stable for at least six months at 30 ℃. The preparation can be suspension, injection, or lyophilized preparation commonly used in pharmaceutical field.
When the recombinant virus and the composition thereof of the present invention are administered to animals including human, the dose to be administered varies depending on the age and body weight of the patient, the nature and severity of the disease, and the route of administration, and the results of animal experiments and various cases can be referred to, and the total dose of administration cannot exceed a certain range.
The invention has the following beneficial guarantee and effects:
experiments prove that the oncolytic vaccinia virus onco VV-CTTNBP2NL has obvious in-vitro inhibition effect on liver cancer cells, colorectal cancer cells, glioma cells, lung cancer cells, pancreatic cancer cells, prostate cancer cells and breast cancer cells, is dose-dependent and time-dependent, and has obvious treatment effect on various tumor animal models. Therefore, the invention obviously improves the anti-tumor capacity of the oncolytic vaccinia virus in tumor-bearing mice, embodies in inhibiting tumor growth and prolonging the survival time of the tumor-bearing mice, provides a new target for tumor virus treatment and has wide clinical application prospect.
In addition, the preparation method of the recombinant oncolytic vaccinia virus carrying CTTNBP2NL gene is mature, is suitable for large-scale standardized production, and provides guarantee for clinical application in the future.
Drawings
FIG. 1 is a plasmid map of pCB-CTTNBP2 NL.
FIG. 2 shows MTT assay for the growth inhibition of tumor cells BEL-7402(A), BEL-7404(B), U87MG (C), A549(D), HCT116(E), HT-29(F), BXPC-3(G), MDA-MB-231(H) and DU145(I) by oncolytical vaccinia virus oncoVV-CTTNBP2NL in vitro.
FIG. 3 shows the inhibitory effect of oncolytic vaccinia virus oncoVV-CTTNBP2NL on transplanted tumors of hepatoma cell BEL-7404 mice in vivo, while oncoVV-GM-CSF is used as a control.
FIG. 4 shows the inhibitory effect of oncolytic vaccinia virus oncoVV-CTTNBP2NL on glioma cells U87MG mouse transplants in vivo, with PBS as control.
FIG. 5 is a graph of the effect of oncolytic vaccinia virus onco VV-CTTNBP2NL on the survival time of U87MG tumor-bearing mice, PBS, Ad-CTTNBP2NL and onco VV-GM-CSF as controls.
FIG. 6 shows the inhibitory effect of oncolytic vaccinia virus oncoVV-CTTNBP2NL on transplanted tumors in colorectal cancer cells HCT116 mice in vivo, with PBS as control.
FIG. 7 shows the result of conservative domain analysis of the amino acid sequence of CTTNBP2NL using the NCBI's conservative domain database.
Detailed Description
The following examples and experimental examples further illustrate the present invention and should not be construed as limiting the present invention. The examples do not include detailed descriptions of conventional methods such as PCR methods, those used to construct vectors and plasmids, methods of inserting genes encoding proteins into such vectors and plasmids, or methods of introducing plasmids into host cells. Such methods are well known to those having ordinary skill in the art and are described in numerous publications, including Sambrook, j., Fritsch, e.f. and maniis, T. (1989) Molecular Cloning: a Laboratory Manual, 2 nd edition，Cold spring Harbor Laboratory Press。
Unless otherwise indicated, percentages and parts are by weight. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Moreover, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, and the preferred embodiments are described herein for illustrative purposes only.
Example 1 construction and identification of vaccinia Virus oncoVV-CTTNBP2NL
1. Construction of pCB-CTTNBP2NL recombinant plasmid
The pCB-CTTNBP2NL recombinant plasmid was constructed according to the plasmid map shown in FIG. 1. The CTTNBP2NL sequence was inserted into the pCB plasmid through Bgl II and Xba I sites to obtain pCB-CTTNBP2NL plasmid. The vTK-L and vTK-R regions in the pCB plasmid are recombined with the TK region of the wild type virus through homologous recombination, and an exogenous gene sequence is inserted into the TK region, so that the TK is deleted. The replication of the vaccinia virus depends on TK, and the TK level of tumor cells is far higher than that of normal cells, so the TK-deleted vaccinia virus has the characteristic of specifically replicating in the tumor cells.
In addition, the plasmid also carries xanthine guanine phosphotransferase (gpt) gene as a screening gene. The gpt gene is derived from Escherichia coli, and virus or cell death occurs because MPA blocks guanine synthesis in the presence of mycophenolic acid (MPA), which prevents normal nucleic acid synthesis in the virus or cell. In the presence of gpt gene, cells or viruses can synthesize guanine by an alternative pathway using hypoxanthine (hypoxanthine) and xanthine (xanthine), so that nucleic acid synthesis is not limited. Removing wild viruses by adding mycophenolic acid, hypoxanthine and xanthine into the culture solution to obtain purified recombinant viruses.
2. Recombination of Western Reserve (WR) strain vaccinia virus and pCB-CTTNBP2NL plasmid
(1) In an area of 6cm 2 The culture dish is inoculated with 293A cells with proper quantity, so that the cells can grow to 80-90% of the next day;
(2) discarding the culture solution, gently adding 1mL of Western Reserve (WR) vaccinia virus strain (0.05-0.1 MOI, diluting the virus solution with 2% serum-containing medium) along the side wall, standing at 37 deg.C and 5% CO 2 The cells are cultured in an incubator for 2-4 hours while shaking up about every 15min to prevent local drying out of the cells.
(3) Cell transfection was performed according to kit (Effectene) instructions, as follows:
adding buffer EC to 150 mu L of 1 mu g of pCB-CTTNBP2NL, then adding 8 mu L of Enhance buffer, oscillating for 1s, and standing for 5min at room temperature; adding 25 mu L of Effectene buffer into the three mixtures respectively, reversing and uniformly mixing for 5 times, shaking for 10s, standing at room temperature for 5-10 min, then adding 1mL of fresh culture solution (which can contain serum and antibiotics) into the mixtures respectively, and reversing for two times; meanwhile, the culture solution in the step 2 is discarded, 4mL of 10% FBS fresh culture solution is added, and the mixed transfection solution is added into the culture solution respectively; the Petri dish was placed at 37 ℃ in 5% CO 2 After culturing for 6-18 hours in the incubator, the culture solution is sucked away, washed once with PBS, and added with 5mL of fresh culture solution for continuous culture.
(4) Collecting virus liquid in a biological safety cabinet after the cells are completely diseased, subpackaging the virus liquid in centrifugal tubes, marking, repeatedly freezing and thawing the centrifugal tubes at minus 80 ℃ and 37 ℃ for three times to thoroughly crack the cells and release the viruses, centrifuging at 2000rmp for 5min, collecting supernatant, and storing in an ultra-low temperature refrigerator at minus 80 ℃ for later use.
3. Screening for recombinant viruses
(1) The 293A cell with good growth state is inoculated in a culture dish, and the next day cell density can reach about 80-90%.
(2) Three screening drugs were prepared: xanthine, hypoxanthine, mycophenolic acid.
(3) To each of the plates in (1), 500. mu.L of the previously packaged virus solution was carefully added along the side wall, and the mixture was placed at 37 ℃ in 5% CO 2 Culturing in an incubator for 2-4 h. After about 2-4h, the suspended virus solution was aspirated off and 3mL of fresh medium containing 7.5. mu.L (1X) mycophenolic acid, 75. mu.L (1X) xanthine and 7.5. mu.L (1X) hypoxanthine was added.
(4) Observing the pathological condition of cells every day, collecting all pathological cell sap in a biological safety cabinet after about two or three days, repeatedly freezing and thawing for three times, and storing in an ultralow temperature refrigerator at minus 80 ℃ for later use.
(5) And repeatedly screening the virus liquid collected each time for 3-4 times according to the method.
4. Virus plaque picking and identification
(1) Preparation of 5% low-solvent adhesive: 0.25g of low melting point glue is weighed and dissolved in 5mL of PBS, and the mixture is autoclaved at 121 ℃ for 20min and then stored in a refrigerator at 4 ℃ for later use.
(2) Inoculating 293A cell in good state into six-well plate, and allowing virus solution to be 10% the next day when cell density reaches about 90% -4 ～10 -6 Performing gradient serial dilution, then removing old culture solution in a six-hole plate, adding 1mL diluted virus solution into each hole to adsorb viruses, placing the holes in an incubator for culturing for 2-4h, placing boiled low-melting-point glue in a 40 ℃ water bath kettle for heat preservation, then placing the holes in a clean bench, adding three times of volume of DMEM culture solution to make the final concentration of the DMEM culture solution be 1.25%, rapidly mixing the DMEM culture solution uniformly by using a suction pipe, rapidly sucking off suspended virus solution in the plates by using a liquid transfer gun, carefully adding 2mL culture solution containing 1.25% low-melting-point glue along the side wall by using the suction pipe, paying attention to avoid blowing up cells, then placing the cells in 37, 5% CO 2 Cell culture of (2)And (5) culturing in a box.
(3) Observing cytopathic condition under an inverted microscope every day, if isolated virus plaques appear, picking them and placing them in a 12-well plate paved with 293A cells in advance, marking them, placing them at 37 deg.C and 5% CO 2 After the virus liquid is fully diseased, the virus liquid is collected in a safety cabinet and placed in a 1.51mL centrifuge tube and a-80 ℃ ultra-low temperature refrigerator for storage for further identification.
(4) PCR identification was performed using the characteristics that wild-type viruses have the intact TK region but recombinant viruses do not, and purified vaccinia virus oncoVV-CTTNBP2NL was obtained.
Example 2 MTT assay for the in vitro inhibitory Effect of oncoVV-CTTNBP2NL on tumor cells
Liver cancer cells BEL-7402 and BEL-7404, glioma cells U87MG, lung cancer cells A549, colorectal cancer cells HCT116 and HT-29, pancreatic cancer cells BXPC-3, breast cancer cells MDA-MB-231 and prostate cancer cells DU145 are selected and used in the experiment according to the proportion of 5 multiplied by 10 respectively 3 The density of each well is inoculated into a 96-well plate, 90 mu L of cell culture solution is added into each well for culture overnight, 2MOI, 5MOI or 10MOI virus is respectively added, 6 repeat wells are arranged, the experimental control group is cells without virus, and the blank group is culture solution without cells.
37℃，5％CO 2 Incubate, set two time gradients of 48h and 72h, and add 20. mu.L of MTT solution (5mg/mL) per well protected from light by the corresponding time point. The incubator stands for 4 hours, after the culture solution of each group is sucked, 150 mu L of dimethyl sulfoxide is added into each hole, and the mixture is placed on a shaking table to be shaken for 10min, so that the crystal is fully dissolved. Measuring OD value on an enzyme-linked detector, and detecting the wavelength at 490 nm.
Calculating the cell survival rate according to the measured OD value, wherein the formula is as follows:
the cell survival rate is (treatment group OD value-zero adjustment group OD value)/(control group OD value-zero adjustment group OD value) × 100%.
The analysis result is shown in fig. 2, and the oncoVV-CTTNBP2NL can significantly inhibit the proliferation of the nine tumor cells in vitro, and is dose-dependent and time-dependent.
Example 3 oncoVV-CTTNBP2NL significantly inhibited the growth of hepatoma cell BEL-7404 mouse transplanted tumor
Establishing a nude mouse subcutaneous transplantation tumor by using liver cancer cell BEL-7404, injecting oncoVV-CTTNBP2NL or oncoVV-GM-CSF into the abdominal cavity, and periodically measuring the tumor volume. The animal experiment method is as follows:
all animal experiments in the study are carried out by strictly referring to NIH experimental animal guidance, female BALB/c nude mice of 4 weeks old are selected, and 1 × 10 injections are injected into each mouse 7 BEL-7404 cells were injected subcutaneously at the axillary end of the forelimb per 100. mu.L of cells. The growth of the tumor volume was observed daily after cell injection and measured with a micrometer, and the tumor volume ((mm) was calculated 3 ) Long x wide ═ 2 )/2). When the tumor grew to a stable state, it was divided into 2 groups: 6-8 nude mice in each group were selected from the group of oncoVV-GM-CSF and oncoVV-CTTNBP2 NL. After the grouping, each nude mouse was subjected to 1 intraperitoneal injection of 1X 10 7 pfu virus, tumor size was periodically examined. Since tumors in the oncoVV-CTTNBP2NL group generally scabbed over time after virus injection, causing difficulty in measurement, tumors were peeled off with a surgical instrument 52 days after virus injection and then weighed to compare the tumor weights in the oncoVV-GM-CSF and oncoVV-CTTNBP2NL treated groups.
The results are shown in FIG. 3: oncoVV-CTTNBP2NL significantly inhibited BEL-7404 mouse graft tumor growth compared to the oncoVV-GM-CSF control.
Example 4 onco VV-CTTNBP2NL significant elimination of glioma cells U87MG mouse graft tumor
A nude mouse subcutaneous transplantation tumor is established by using glioma cells U87MG, oncoVV-CTTNBP2NL or PBS with the same volume is injected into the abdominal cavity, and the tumor volume is measured periodically. The animal experiment method is as follows:
all animal experiment operations in the study are carried out by strictly referring to NIH experimental animal guidance, female BALB/c nude mice of 4 weeks old are selected, and 1 × 10 injections are injected into each mouse 7 Cells were injected subcutaneously with U87MG cells per 100. mu.L of cells in their forelimb axillary. The growth of the tumor volume was observed daily after cell injection and measured with a micrometer, and the tumor volume ((mm) was calculated 3 ) Long x wide ═ 2 )/2). When the tumor grew to a stable state, it was divided into 2 groups: PBS group and oncoVV-CTTNBP2NL group, each 6-8Only nude mice. After the grouping, each nude mouse was subjected to 1 intraperitoneal injection of 1X 10 7 pfu virus or equal volume of PBS, and then tumor volumes were measured periodically.
The results are shown in FIG. 4: oncoVV-CTTNBP2NL significantly eliminated the U87MG mouse graft tumor compared to PBS control.
Example 5 oncoVV-CTTNBP2NL significantly prolonged survival time of U87MG tumor-bearing mice
Utilizes glioma cell U87MG to establish nude mouse subcutaneous transplantation tumor, and 1 × 10 is injected into abdominal cavity 7 pfu oncoVV-GM-CSF, oncoVV-CTTNBP2NL or equal volume PBS in addition to 1 group of tumor-bearing mice injected intratumorally with 1X 10 8 pfu Ad-CTTNBP2NL, because the adenoviral vector is not suitable for systemic administration, it was injected intratumorally and the dose was 10 times that of vaccinia virus. Mice survival time was recorded starting after injection. The animal test method was the same as described in example 4. The oncoVV-GM-CSF is similar to the oncolytic vaccinia virus drug Pexa-Vec (formerly known as JX-594) that has entered clinical stage III, and was constructed by itself according to literature reports (Parato, K.A., C.J.Breitbach, et al.2012.the oncolytical poxvirus JX-selective therapeutics in and restriction cancer cells drive by genetic pathway common activated vaccines in cancers. mol Ther 20(4): 749-.
The results are shown in FIG. 5: compared with the controls such as PBS, oncoVV-GM-CSF, Ad-CTTNBP2NL and the like, the oncoVV-CTTNBP2NL obviously prolongs the survival time of tumor-bearing mice, and is superior to the current oncolytic vaccinia virus medicament Pexa-Vec which enters the clinical stage III. In addition, Ad-CTTNBP2NL did not significantly prolong mouse survival time compared to PBS group, indicating that CTTNBP2NL recombinant adenovirus vector toxic to tumor cells in vitro did not have any anti-tumor effect on animal experiments.
Example 6 oncoVV-CTTNBP2NL significantly inhibited the growth of transplanted tumors of colorectal cancer cells HCT116 mice
The colorectal cancer cell HCT116 is used for establishing a nude mouse subcutaneous transplantation tumor, oncoVV-CTTNBP2NL or equal volume PBS is injected into the abdominal cavity, and the tumor volume is measured periodically. The animal experiment method is as follows:
all animal experiment operations in the study are carried out by strictly referring to NIH experimental animal guidance, and 4 weeks old animal is selectedFemale BALB/c nude mice, 8X 10 injections per mouse 6 HCT116 cells were injected subcutaneously per 100. mu.L of cells at their anterior axillary end. The growth of the tumor volume was observed daily after cell injection and measured with a micrometer, and the tumor volume ((mm) was calculated 3 ) Equal to (length x width) 2 )/2). When tumors grew to a stable state, they were divided into 2 groups: PBS group and oncoVV-CTTNBP2NL group, each group containing 7-8 nude mice. After the grouping, each nude mouse was subjected to 1 intratumoral injection of 1X 10 7 pfu virus or an equal volume of PBS, and then tumor volumes were measured periodically.
The results are shown in FIG. 6: oncoVV-CTTNBP2NL significantly inhibited HCT116 mouse transplantable tumors compared to PBS control.
Example 7 conservative Domain analysis of CTTNBP2NL protein
The amino acid sequence of CTTNBP2NL was analyzed using a Conserved Domain Database (CDD) of the National Center for Biotechnology Information (NCBI) to obtain the Conserved Domain Information of CTTNBP2 NL.
The results are shown in FIG. 7: the CTTNBP2NL protein contains 2 conserved domains, one is a cortex protein binding protein 2 (cortex-binding protein 2) family conserved domain located at amino acids 5-188, and the other is a RecF/RecN/SMC N-terminal domain located at amino acid 136-279.
While the preferred embodiments of the present invention have been illustrated and described, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Hangzhou Gongchu Biotechnology Co., Ltd
<120> oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs
<130> claim specification
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1920
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgaatctgg aaaaactcag caagcctgaa ctcctgacac tatttagtat tcttgaagga 60
gagcttgaag caagggacct tgttatagaa gccttaaagg cccaacacag agatactttc 120
attgaagaac gctatggaaa atataacatc agtgatcctt taatggctct acagagagat 180
tttgaaacac tgaaggagaa aaatgatggc gaaaagcagc cagtctgcac aaatccactc 240
tctattctta aggttgtgat gaagcagtgc aagaacatgc aggagcgcat gctgtcccag 300
ctggctgctg ctgagagcag gcaccgaaag gtgatcctag accttgagga agaaaggcag 360
cggcatgcac aggatacggc tgaaggagat gatgtcacct acatgctaga gaaggaaaga 420
gagaggctga ctcaacagtt ggaatttgaa aaatcccaag tgaaaaagtt tgaaaaagaa 480
cagaagaagc tctctagtca gctggaagag gagcgctccc gccacaagca gctctcatcc 540
atgctagtgc ttgagtgcaa gaaagccacc aacaaggcag ccgaggaagg acagaaggca 600
ggagagctga gcctgaaatt ggagaaggag aagagccggg tgagtaaact ggaagaagag 660
ttggcagctg agagaaagag aggcttgcag actgaggccc aggtagagaa gcagttatca 720
gagtttgaca tcgaaaggga acaactgaga gcaaaactga accgagaaga gaaccggacc 780
aaaaccctga aagaagaaat ggaaagttta aagaagatag tgaaggacct agaggcttcc 840
caccagcaca gtagccctaa tgagcaattg aagaaaccag taaccgtgtc caaaggcaca 900
gcaactgagc ctctcatgct aatgtctgtg ttttgccaaa cagagagttt tccagcagaa 960
agaacccatg ggagcaacat agccaagatg acaaacactg ggctgcctgg tcctgccact 1020
cctgcttact catatgcaaa aaccaatggc cattgtgacc cagagataca aactaccagg 1080
gagctgactg caggcaacaa tgtagaaaac caggtgcctc cacgggaaaa atctgtggca 1140
ttggcccaag agaaaccagt ggagaatggt gggtgtcctg tggggattga gactccagtc 1200
ccaatgccca gtcccctctc ttccagtggg agctcactgt ctcccagcag cactgcctcc 1260
tcctctctaa catcctctcc ttgctcttcg ccggtactca ctaagcgttt attggggtca 1320
tcagctagca gccctggcta ccagtcatcg taccaagtag ggatcaacca acggttccat 1380
gcagctcgcc acaaatttca gtcccaagca gatcaggacc aacaagccag tggcctacag 1440
agccctccat ccagggattt atcccccacc ctcatagaca actctgccgc caagcagctg 1500
gcccgaaaca cagtcactca ggtgctctcc agattcacta gccaacaagg gccaatcaag 1560
ccagtctctc ccaacagctc tccctttggc acagactatc gaaatctagc caacactgcc 1620
aatccaagag gtgacacaag ccattcacct actccaggga aagtgtccag tcccctgagc 1680
cccctgtctc caggaatcaa gtccccaacc atccccagag ctgagagagg aaaccctcca 1740
cccatcccac ccaagaaacc tggcctcacc ccttctccat ctgctaccac tccattgacc 1800
aaaactcatt cccaggcagc ctctttgacc actgcagaag accttgccag cagctgctct 1860
tccaatactg ttgtagcaaa tggtaaggat gttgagttac ttttgcctac cagcagctag 1920

Claims (2)

1. The application of the oncolytic vaccinia virus carrying CTTNBP2NL gene in preparing antitumor drugs is characterized in that the oncolytic vaccinia virus carries CTTNBP2NL gene, and the DNA sequence of the CTTNBP2NL gene is shown as SEQ ID NO 1; the anti-tumor drug is a drug for treating liver cancer, colorectal cancer, glioma, lung cancer, pancreatic cancer, prostate cancer and breast cancer,
the construction method of the oncolytic vaccinia virus carrying CTTNBP2NL gene comprises the following steps:
(A) inserting the gene sequence of CTTNBP2NL into pCB plasmid through Xba I and Bgl II sites to obtain pCB-CTTNBP2NL plasmid;
(B) the pCB-CTTNBP2NL plasmid and the vaccinia virus Western Reserve strain are recombined in cells, and are screened and identified to construct oncoVV-CTTNBP2NL vaccinia virus.
2.The use of the oncolytic vaccinia virus carrying CTTNBP2NL gene according to claim 1 in the preparation of anti-tumor drug, characterized in that:
wherein the antitumor drug is an oncolytic vaccinia virus carrying CTTNBP2NL gene as a unique active ingredient or a pharmaceutical composition containing the oncolytic vaccinia virus carrying CTTNBP2NL gene.
CN201910440396.4A 2019-05-24 2019-05-24 Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs Active CN111979203B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910440396.4A CN111979203B (en) 2019-05-24 2019-05-24 Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910440396.4A CN111979203B (en) 2019-05-24 2019-05-24 Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs

Publications (2)

Publication Number Publication Date
CN111979203A CN111979203A (en) 2020-11-24
CN111979203B true CN111979203B (en) 2022-08-19

Family

ID=73436714

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910440396.4A Active CN111979203B (en) 2019-05-24 2019-05-24 Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs

Country Status (1)

Country Link
CN (1) CN111979203B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4769330A (en) * 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
CN102391996A (en) * 2011-11-07 2012-03-28 中国食品药品检定研究院 Recombination VTT and method for detecting vaccinia virus neutralizing antibody by using same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4769330A (en) * 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
CN102391996A (en) * 2011-11-07 2012-03-28 中国食品药品检定研究院 Recombination VTT and method for detecting vaccinia virus neutralizing antibody by using same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PREDICTED: Homo sapiens CTTNBP2 N-terminal like (CTTNBP2NL), transcript variant X1;genbank;《Genbank》;20150312;CDS,ORIGIN,LOCUS部分 *
携带CTTNBP2NL基因的重组腺病毒的抗癌研究;赵珍珍;《浙江理工大学硕士学位论文万方数据库》;20170926;摘要 *

Also Published As

Publication number Publication date
CN111979203A (en) 2020-11-24

Similar Documents

Publication Publication Date Title
US20240100106A1 (en) Isolated recombinant oncolytic adenoviruses, pharmaceutical compositions, and uses thereof for drugs for treatment of tumors and/or cancers
CN110499297B (en) Novel oncolytic virus and preparation method and application thereof
JP7248325B2 (en) Isolated Recombinant Oncolytic Vaccinia Viruses, Pharmaceutical Compositions, and Uses Thereof for Medicines for the Treatment of Tumors and/or Cancers
KR20170003920A (en) Oncolytic vaccinia virus
CN111514311B (en) Target exosome loaded with adriamycin and si-PVT1 together, preparation method thereof and anti-osteosarcoma application thereof
JP7374527B2 (en) Genetically modified mesenchymal stem cells expressing α1-antitrypsin (AAT)
Li et al. Genetically engineered neural stem cells migrate and suppress glioma cell growth at distant intracranial sites
US20200318137A1 (en) Trail-secreting mesenchymal stem cells and use thereof to treat brain tumors
US11376290B2 (en) Recombinant oncolytic virus, synthetic DNA sequence, and application thereof
CN111979203B (en) Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs
WO2020078274A1 (en) Striatin interacting protein inhibitor and use thereof in preparation of anti-tumor drug
CN101130081B (en) Use of PNAS-4 gene in preparing antineoplastic and antineoplastic auxiliary medicament
WO2020233102A1 (en) Pharmaceutical composition for treatment of tumor or cancer, and application thereof
Wang et al. Thymosin beta-4 recombinant adeno-associated virus enhances human nucleus pulposus cell proliferation and reduces cell apoptosis and senescence
WO2020011754A1 (en) Chimeric vaccinia viruses
CN110564700B (en) Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application
CN111979204B (en) Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application
CN113755455B (en) Oncolytic vaccinia virus carrying SIKE gene, construction method and application
CN111094324B (en) Oncolytic virus, synthetic DNA sequence and application thereof
KR20100074386A (en) Mesenchymal stem cell producing human hepatic growth factor (hhgf), method for preparing the same and therapeutic agent of liver diseases
CN113939304B (en) M1 virus variants and uses thereof
US20190284538A1 (en) Recombinant oncolytic virus, synthetic dna sequence, and application thereof
WO2017167209A1 (en) Trail-secreting mesenchymal stem cells and use thereof to treat brain tumors
JP2022524379A (en) Syncytial oncolytic herpes simplex mutant as a powerful cancer treatment
KR20160066375A (en) Human Neural Stem Cells Expressing Prodrug Conversion Enzyme and Pharmaceutical Composition Comprising the Same for Treating Primary and Metastatic Cancer

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant