KR20160066375A - Human Neural Stem Cells Expressing Prodrug Conversion Enzyme and Pharmaceutical Composition Comprising the Same for Treating Primary and Metastatic Cancer - Google Patents

Abstract

The present invention relates to a neuroblastoma cell expressing a prodrug drug conversion enzyme and a pharmaceutical composition for treating a primary cancer and a metastatic cancer comprising the same as an active ingredient. Neurogenic stem cells that express genetically transformed prodrug conversion enzymes of the present invention convert tumor-directed and nontoxic prodrugs into toxic drugs, and thus have a selective and therapeutic effect on cancer, especially primary cancer and metastatic cancer Since it is excellent and safe, it can be developed as an anti-cancer drug for cancer.

Description

TECHNICAL FIELD [0001] The present invention relates to a pharmaceutical composition for the treatment of neural stem cells expressing a prodrug drug converting enzyme and primary and metastatic cancers containing the same as an active ingredient.

The present invention relates to neural stem cells whose genetic traits are modified to express a prodrug conversion enzyme, and pharmaceutical compositions and kits for the treatment of primary and metastatic cancers containing the same as an active ingredient.

Neural stem cells (NSCs) capable of self-renewal and differentiation into neurons or glia can be cultured from the subventricular zone (SVZ) of adults. In the adult brain, neural stem cells are present in the ventral estuary of the lateral ventricle, the brain's two zones where neural tissue development continues, and in the subgranular zone (SGV) of the hippocampal dentate gyrus. Since neural stem cells have the property of migrating to the damaged area of the brain or the ischemic or tumorous brain lesion area, the movement of the endogenous or exogenous neural stem cells is very important for brain tissue regeneration. Direct cell migration is initiated by various cytokines and growth factors, including stromal cell-derived factor (SDF-1α / CVR4), vascular endothelial growth factor (VEGF) ) / Vascular endothelial growth factor receptor, VEGF-receptor). The preceding studies on this subject are as follows. Studies have shown that hepatocyte growth factor (HGF) activity in mouse mesenchymal stem cells isolated from rat bone marrow is related to proliferation, differentiation and migration of cells. kinase / Akt signaling is involved in the survival, proliferation, differentiation and migration of stem cells. Akt regulates the proliferation of embryonic mouse NSCs in rats and has been shown to inhibit cell cycle regulators such as cyclin D, cyclin-dependent kinase inhibitors p27Kip1 and p21Cip1 / Waf1 To regulate neuronal differentiation influenced by neurons. Increased Akt activity due to increased phosphorylation of PI3K promotes stem cell migration in vitro and in vivo as well as cell proliferation and apoptosis signaling. It is reported that the proliferation and migration of neural progenitor cells are inhibited by LY294002, a selective inhibitor of PI3K, and that the PI3K / Akt signal by bFGF (basic fibroblast growth factor) increases the migration propensity of neural stem cells Respectively. Vascular endothelial growth factor is an important mediator of tumor proliferation and angiogenesis and is frequently overexpressed in various cancers. Other studies have shown that transplanting neural stem cells expressing vascular endothelial growth factor into the brain of an endodermic animal model of the brain protects the nerve tissue from bleeding and increases functional recovery of the brain. In addition, studies of vascular endothelial growth factor and platelet-derived growth factor α / β (PDGFα / β) have shown that vascular endothelial growth factor induces cell migration through platelet-derived growth factor receptor And that a series of complex mechanisms are involved in signal transduction. In addition, another study has shown that the inhibition of the second vascular endothelial growth factor receptor significantly inhibits the learning ability of the mouse when inhibited the nerve formation in the dentate gyrus of adult mice.

Neural stem cell-based therapies for Parkinson's disease, Huntington's disease, multiple sclerosis, spinal cord injury, and primary or metastatic cancer metastasis in the brain have been successfully developed based on the above presented theories. The efficacy of neural stem cell-derived enzyme / prodrug therapy (NDEPT) was tested in animal models with primary human or metastatic cancers in humans. Treatment with enzymes and prodrugs can minimize side effects if they are designed to selectively recognize target cancer cells in normal cells. Enzymes used in enzyme / prodrug therapy have the ability to convert toxic non-toxic prodrugs, such as cytosine deaminase (CD) or carboxyl esterase (CE), into toxic drugs It should be an enzyme. CE-expressing CE gene is mainly used to activate SN-38 by activating pro-drug CPT-11 (irinotican). SN-38, an active form of CPT-11, inhibits mammalian topoisomerase I (ITP) by a 1000-fold higher potency than CPT-11 so that double-stranded DNA cleaved during the differentiation of cancer cells accumulates in cancer cells . Previous studies have shown that CPT-11 reduces the number of ovarian cancer cells when treated with immortalized neural stem cell HB1.F3 cells or with HB1.F3.CE cells transfected with CE gene . Lung cancer is the second most frequently occurring cancer and is a major threat to human health. Among malignant tumors, primary lung cancer has a high metastatic rate, which is 40% of all patients, so that metastatic cancer can be detected in the brain. Metastatic lung cancer is a degenerative disease in which quality of life deteriorates with very painful symptoms after one year of diagnosis.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

Korea Publication No. 10-2014-00105576 Korea Publication No. 10-2013-014942 Korea Publication No. 10-2013-0109417

1. Doetsch F, Nat Neurosci. 2003; 6: 11271134. 2. Imayoshi I, et al., J Neurosci. 2010; 30: 34893498. 3. Goldman S, Nat Biotechnol. 2005; 23: 862871. 4. Gutova M, et al., Stem Cells. 2008; 26: 14061413. 5. Forte G, et al., Stem Cells. 2006; 24: 2333. 6. Vojtek AB, et al., Mol Cell Biol. 2003; 23: 44174427. 7. Sinor AD and Lillien L, J Neurosci. 2004; 24: 85318541. 8. Katakowski M, et al., J Neurosci Res. 2003; 74: 494501. 9. Zhang R, et al., J Neurosci. 2004; 24: 58105815. 10. Schmidte, et al., Stem Cells. 2006; 24: 17501758. 11. Liang Z, et al., Biochem Biophys Res Commun. 2007; 359: 716722. 12. Lee HJ, et al., PLoS One. 2007; 2: e156. 13. Spaeth E, et al., Gene Ther. 2008; 15: 730738. 14. Zhang RL, et al., Neuroscientist. 2005; 11: 408416. 15. Martino G, et al., Nat Rev Neurosci. 2006; 7: 395406. 16. Yi BR, et al., Lab Anim Res. 2013; 29: 131137. 17. Yi BR, et al., Mol Oncol. 2013; 7: 543554. 18. Yi BR, et al., Cancer Gene Ther. 2012; 19: 644651. 19. Yi BR, et al., Int J Mol Sci. 2012; 13: 1251912532. 20. Yi BR, et al., Int J Oncol. 2012; 41: 798804. 21. Kim KY, et al., Cancer Sci. 2010; 101: 955962. 22. Yi BR, et al., Int J Oncol. 2011; 39: 833839. 23. Yi BR, et al., Oncol Rep. 2012; 27: 18231828. 24. Basic JS, et al., N Engl J Med. 2010; 363: 733742. 25. Liang S, et al., Genes & cancer. 2012; 3: 141151. 26. Willimsky G, et al., Oncotarget. 2013; 4: 11171118. 27. Hatfield MJ, et al., Biochemical pharmacology. 2011; 81: 2431. 28. Bencharit S, st al., Nature structural biology. 2002; 9: 337342. 29. Morton CL, et al., Cancer chemotherapy and pharmacology. 2005; 6: 629636. 30. Wierdl M, et al., Cancer gene therapy. 2008; 15: 183192. 31. Kim DJ, et al., Oncol Rep. 2013; 30: 11291136. 32. Kim HS, et al., Mol Cells. 2013; 36: 347354. 33. Kim KY, et al., Int J Oncol. 2012; 40: 10971104. 34. Ren G, et al., Cell Stem Cell. 2008; 2: 141150. 35. Miller RJ, et al., J Neuroimmunol. 2008; 198: 3138. 36. Laurenzanae, et al., Oncotarget. 2014; 5: 37113727. 37. Schmidt NO, et al., Brain Res. 2009; 1268: 2437 38. Ellis LM, et al., Nat Rev Cancer. 2008; 8: 579591. 39. Shinjyo N, et al., Stem Cells. 2009; 27: 28242832. 40. Luo Y, et al., J Neurochem. 2005; 93: 452462. 41. Wang B, et al., Neurosci Lett. 2009; 461: 252257. 42. Zhang Q, et al., Molecules. 2011; 16: 1014610156.

The present inventors have sought to develop a therapeutic agent for neural stem cells capable of treating primary cancer and metastatic cancer. As a result, we succeeded in producing an immortalized neural stem cell expressing a prodrug transgene through genetic transformation, and genetically transgenic cells produced through an animal model having a primary cancer and an animal model having a metastatic cancer The present inventors have completed the present invention by experimentally confirming that neural stem cells have excellent therapeutic effect on primary cancer and metastatic cancer.

Accordingly, an object of the present invention is to provide a neural stem cell expressing a prodrug conversion enzyme.

It is another object of the present invention to provide a pharmaceutical composition for the treatment of primary cancer and metastatic cancer, which comprises neural stem cells expressing the prodrug drug converting enzyme as an active ingredient.

It is still another object of the present invention to provide a kit for the treatment of primary cancer and metastatic cancer including neural stem cells and prodrug expressing the prodrug conversion enzyme.

The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a neural stem cell which is transformed with an expression vector comprising a nucleic acid molecule encoding a prodrug-converting enzyme to express the prodrug-converting enzyme.

As used herein, the term " stem cell " refers to a cell having the ability to continue proliferation, i. E. The ability to self-replicate, and to differentiate into different types of specific cell types.

According to one embodiment of the present invention, the stem cell into which the prodrug encoding enzyme-encoding nucleic acid molecule is introduced is a neural stem cell.

As used herein, the term " neural stem cells " refers to undifferentiated cells capable of differentiating into cells constituting any central nervous system such as neurons, astrocyte, and oligodendrocytes.

A specific method of separating neural stem cells is disclosed in U.S. Patent No. 5,654,183, which is incorporated herein by reference. Neural stem cells can be cultured by adding basic fibroblast growth factor (bFGF), epidermal growth factor (EGF), or FGF (fibroblast growth factor) growth factors to the medium in a suitable concentration range, for example, 5-100 ng / .

The neural stem cells of the present invention may preferably be primary cultured neural stem cells isolated and cultured from human tissues or may be obtained by culturing the primary cultured stem cells with a tumor gene (e.g., v-myc gene) Which can be established by introduction of a vector containing the vector in an expressible form.

The neural stem cells of the present invention are genetically modified neural stem cells transformed with an expression vector containing a nucleic acid molecule encoding a prodrug conversion enzyme to express the prodrug conversion enzyme.

As used herein, the term " prodrug-conversion enzyme "refers to an enzyme that has the activity of converting a non-toxic prodrug into a toxic drug. The prodrug- It is used for neural stem cell-derived enzyme / prodrug therapy.

According to another embodiment of the present invention, the prodrug conversion enzyme is carboxyl esterase (CE). The carboxylesterase is an enzyme that catalyzes the reaction of forming an alcohol and a carboxylic acid by cleaving a carboxylic ester bond.

According to another embodiment of the present invention, the non-toxic prodrug is CPT-11 (irinotecan). The CPT-11 is converted to the toxic substance SN-38 by the carboxylesterase expressed in the neural stem cells of the present invention. SN-38 induces intracellular accumulation of double-stranded DNA that has been cleaved by a potent inhibitor of mammalian topoisomerase I, resulting in cytotoxicity. For information on the above enzyme / prodrug therapy, see the Clinical Cancer Research Vol. 7, 3314-3324, Nov 2001, which is incorporated herein by reference.

In the present invention, the vector used for introducing the prodrug encoding enzyme-encoding nucleic acid molecule into the neural stem cells may be, but is not limited to, the following vectors: 1) adenovirus vector; 2) retroviral vectors; 3) Adeno-associated viral vectors; 4) herpes simplex virus vector; 5) SV 40; 6) polyoma virus vectors; 7) papilloma virus vector; 8) Picardovirus vectors; 9) Vexinia virus vector; 10) helper-dependent adenovirus vector.

The origin of replication contained in the vector of the present invention includes, but is not limited to, f1 replication origin, SV40 replication origin, pMB1 replication origin, Adeno replication origin, AAV replication origin, and BBV replication origin.

Promoters that can be used in the vectors of the present invention include promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., adenovirus late promoter, vaccinavirus 7.5K promoter , The SV40 promoter, the cytomegalovirus promoter and the tk promoter of HSV) can be used, and the polyadenylation sequence is included as the transcription termination sequence, for example, the SV40 polA sequence and the BGH polA sequence.

The vector used in the present invention includes an antibiotic resistance gene commonly used in the art as a selection marker, and examples thereof include ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin , Puromycin, and tetracycline.

The step of selecting the transformed stem cells by the introduction of the vector can be easily carried out using the phenotype expressed by the above-mentioned selection marker. When the selectable marker is a gene resistant to a specific antibiotic, it can be easily selected by culturing in a medium containing the antibiotic.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition comprising (a) a pharmaceutically effective amount of a neural stem cell that is transformed with a vector comprising a nucleic acid molecule encoding the prodrug conversion enzyme to express the prodrug conversion enzyme; And (b) a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for the treatment of primary or metastatic cancer.

The neural stem cells expressing the prodrug converting enzyme of the present invention have an efficacy in the treatment of primary cancer and metastatic cancer by converting non-toxic prodrug into prodrug by transferring and proliferating to cancer tissue according to the tumor-directing characteristic.

According to an embodiment of the present invention, the primary cancer is a breast cancer, lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer Endometrial cancer, small intestine cancer, endocrine cancer, thyroid cancer, pituitary cancer, renal cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchial cancer, or bone marrow cancer.

According to another embodiment of the present invention, the metastatic cancer is cancer that has metastasized to the brain. More preferably, the cancer that has metastasized to the brain is selected from the group consisting of breast cancer, lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer or skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, Cancer of the prostate, bronchus or bone marrow, more preferably lung cancer, breast cancer, breast cancer, endometrial cancer, endometrial cancer, cervical cancer, small bowel cancer, endocrine cancer, thyroid cancer, parathyroid cancer, kidney cancer, soft tissue tumor, Skin cancer is a cancer that has spread to the brain.

The pharmaceutical composition of the present invention may be prepared in the form of an injection, typically in the form of a suspension containing cells. The pharmaceutical form of injection includes a sterile aqueous solution or spray ready for immediate preparation of a solution or dispersion. In all cases, the pharmaceutical agent in the form of injection solution should be sterilized and preferably has fluidity to facilitate injection.

The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier besides the neural stem cells as an active ingredient.

The term " pharmaceutically acceptable " means that it does not cause an allergic reaction or a similar adverse reaction when administered to a human. Such carriers include certain solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents in pharmaceutically active materials is well known in the art. The carrier of the pharmaceutical composition may be a solvent or dispersion medium containing, for example, water, saline, ethanol, a polyol (such as glycerol, propylene glycol and liquid polyethylene glycol), a suitable mixture thereof, . Fluidity can be maintained by the use of a coating agent such as lecithin. To prevent microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and the like may be included and may include an introduction system of sugar or sodium chloride. In addition, agents for delaying absorption in the composition may be included, for example, aluminum monostearate and gelatin in order to prolong the absorption action upon administration to the body. The sterile injectable solution is prepared by mixing, if necessary, an appropriate amount of the active substance with a suitable solvent having the above-mentioned various other ingredients, followed by filtration and sterilization.

The pharmaceutical composition of the present invention may be administered by parenteral, intraperitoneal, intradermal, intramuscular, intravenous routes and may be administered by direct injection into a tissue in which primary cancer or metastatic cancer is present.

The pharmaceutical compositions of this invention are administered in therapeutically effective amounts in a manner compatible with the formulation. The dosage can also be adjusted according to the condition or condition of the subject to be treated. For parenteral administration with aqueous injection solutions, the solution should be suitably buffered as needed, first making the liquid diluent sufficiently saline or glucose isotonic. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, intradermal and intraperitoneal administration. The contents of carriers, formulations and media that can be used in the present compositions with respect to relaxation are known in the art (see Remington's Pharmaceutical Sciences 1995, 15th Edition).

According to another aspect of the present invention, there is provided a pharmaceutical composition comprising (a) a neural stem cell which is transformed with a vector comprising a prodrug conversion enzyme and expresses the prodrug conversion enzyme; And (b) a prodrug thereof. The present invention also provides a kit for the treatment of primary and metastatic cancer.

According to one embodiment of the present invention, the prodrug conversion enzyme is a carboxyl esterase.

According to another embodiment of the present invention, the prodrug is CPT-11 (irinotecan).

The contents of the neural stem cells expressing the prodrug transduction enzyme in the kit for treating primary or metastatic cancer of the present invention are the same as those described in the invention relating to the neural stem cells and pharmaceutical composition described above, Are not duplicated for the sake of avoidance.

The present invention relates to a neural stem cell expressing a prodrug converting enzyme and a pharmaceutical composition for treating primary cancer and metastatic cancer comprising the same as an active ingredient. The neuro-stem cells expressing the genetically transformed and prodrug converting enzyme of the present invention convert tumor-directed and non-toxic prodrugs into toxic drugs, and thus have excellent selectivity and therapeutic effect on cancer, especially primary cancer and metastatic cancer Minimizing the side effects of toxic drugs and thus being able to be developed as a therapeutic agent for cancer cells.

Figure 1 shows the results of treatment gene expression of HB1.F3.CE cells and anti-cancer effects of stem cells and prodrugs on A549 lung cancer cells. Total RNA was extracted from A549 lung cancer cells and stem cells, and rabbit and human CE genes were amplified by polymerase chain reaction (PCR). The PCR products were separated by 1.5% agarose gel electrophoresis and GAPDH was used as a positive control. Panel A: Amount of rabbit CE gene expression in stem cells, Panel B: Results of treatment of HB1.F3.CE cells or HB1.F3.CE cells with CPT-11. After the cancer cells were placed in a 96-well plate, CPT-11 and stem cells were treated together. Stem cells were not cultured in the negative control group. Four days after treatment with the prodrug, MMT experiments were performed to determine the activity of the cells. Panel C: Expression of Human CE Gene in A549 Lung Cancer Cells. Each experiment was repeated three times and the mean ± SD values for cells treated with CPT-11 without HB1.F3.CE cells and P <0.05 were marked with *.
Figure 2 is a sequence of stem cell treatment for primary lung cancer. Panel A: Experimental processing sequence. The primary lung cancer model was prepared by injecting A549 lung cancer cells (2 X 10 ⁶ cells / mouse) into the dorsal subcutaneous tissues of BALB / c nude mice. Five weeks after the injection of cancer cells, CM-DiI-stained neural stem cells (4 x 10 ⁶ cells / mouse) were injected around the tumor mass and CPT-11 (13.5 mg / Injection. Panel B: Volume change of tumor mass. The volume of tumor mass was measured weekly and calculated by the formula of 0.5236 X length X height. Panel C: Relative comparisons of volume of tumor mass at 9 weeks. Each experimental result was expressed as mean ± SEM for the negative control group. In the negative control group not treated with both stem cells and CPT-11, the value of P <0.05 was *, and the value of P <0.05 was indicated as # in CPT-11 treated group only.
Figure 3 shows immunohistochemical staining and hematoxylin and eosin staining results. The mice were sacrificed and the tumors were excised and fixed in 10% normal formalin. In addition, a monoclonal anti-PCNA primary antibody (1: 1,000 dilution) was used to identify the PCNA protein as a proliferation marker. The primary antibody was reacted and biotinylated anti-mouse secondary antigen (1: 500 dilution) was reacted on the slide. Panel B: Tumor mass treated with CPT-11 (H & E stain), Panel C: Tumor mass of rats treated with HBT.F3.CE cells and CPT-11 (H & E staining), panel D: immunohistochemical staining for PCNA of each tumor mass, panel E: relative expression of PCNA protein. In the negative control group not treated with both stem cells and CPT-11, the value of P <0.05 was *, and the value of P <0.05 was indicated as # in CPT-11 treated group only. The enlargement of each photograph was 100 times or 200 times.
FIG. 4 shows the results of the migration ability of neural stem cells present in a tumor burden. The ability of human neural stem cells to migrate to A549 lung cancer cells was confirmed in animal models. Panel A: negative control, panel B: CPT-11 treated mice, panel C: HB1.F3.CE cells and mice treated with CPT-11, red fluorescence: HB1.F3.CE stained with CM- Cell cytoplasm. Blue fluorescence: DAPI stained nuclei of A549 lung cancer cells and HB1.F3.CE cells, white arrows: stained stem cells. Each picture was magnified 100 times.
FIG. 5 shows the results of tumor-directed and histopathological analysis of stem cells in an animal model of metastatic lung cancer. A549 lung cancer cells (1 × 10 ⁵ cells / mouse) were transplanted into the right hemisphere of mouse brain and CM-DiI stained stem cells (1 × 10 ⁵ cells / mouse) were injected twice in the left hemisphere of mice. CPT-11 (13.5 mg / kg / day) was injected intraperitoneally for 5 days to induce the therapeutic effect of stem cells. After injection of the final prodrug, the brain of all experimental mice was sectioned for hematoxylin and eosin staining for histological analysis. Panel A: Experimental design of metastatic lung cancer animal model. Panel B: negative control of brain specimens. C: Brain specimen treated with HB1.F3.CE cells and CPT-11 simultaneously. D: Negative control. In vivo migration capacity of stem cells was confirmed by fluorescence analysis after DAPI staining of brain specimens. E: Experimental group treated with HB1.F3.CE cells and CPT-11 simultaneously. Blue fluorescence: A549 lung cancer cells stained with DAPI stain and nuclei of HB1.F3.CE cells. White arrow: Moved stem cells. Each picture is magnified 100 to 200 times.
Figure 6 relates to the identification of tumor orientation through vascular endothelial growth factor and vascular endothelial growth factor receptor (VEGF / VEGFR2). Panel A: Various chemotactic factors are released from cancer cells. To identify the factors involved in the migration, total RNA was extracted from A549 lung cancer cells and real-time PCR was performed on the chemotactic factors including uPA, SDF-1α, VEGF, MCP-1 and SCF. Respectively. Panel B: Inhibition of mobility by treatment with KRN633, a VEGFR2 inhibitor. Stem cells were treated with 100 μM of KRN633 to inhibit the binding of VEGF to VEGFR2 prior to in vitro migration experiments. After treatment for one hour, CM-DiI stained cells were put on a plate cultured with lung cancer cells and cultured together for one day. Then, the transferred stem cells were observed under a microscope. Panel C: A bar graph showing the amount of stem cells transferred after KRN633 treatment. The red fluorescence is the cytoplasm of HB1.F3.CE cells stained with CM-DiI. Each photograph is magnified 200 times.
Figure 7 shows the result of the change in the movement ability controlled by the down stream. The lysates of KRN633 treated HB1F3.CE cells were extracted using protein extraction solution. The quantified protein was separated by SDS-PAGE and transferred to the PVDF transfer membrane. For the immunoblotting, the protein-transferred membranes were incubated with anti-phospho-Erk1 / 2 antibody (1: 1,000 dilution), anti-phosphorylated Ark antibody (1: 1,000 dilution) and anti- (1: 2, 000 dilution). Each protein was normalized on the basis of GAPDH. Panel A: Expression levels of p-Erk1 / 2, p-Akt and c-fos in HB1.F2.CE cells treated with KRN633. Panel B: Relative value of p-Erk1 protein. Panel C: Relative value of p-Erk1 protein. Panel D: Relative value of p-Akt protein. Each experiment was performed in triplicate and the mean ± SD was shown for cells treated with CPT-11 without HB1.F3.CE cells, and P <0.05 for negative control cells not treated with both stem cells and CPT-11 * In the group treated with CPT-11 only, and those having P < 0.05 in the group treated only with CPT-11.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Methods

1. Cell culture

A549 lung cancer cell lines were obtained from Korean Cell Line Bank (Seoul, Korea) and were cultured in DMEM medium (Hyclone Laboratories Inc., Logan, UT, USA), 10% (v / v) FBS 100 g / ml streptomycin (Cellgro Mediatech Inc., Manassas, Va., USA), 100 units / ml penicillin (Cellgro Mediatech Inc., ), 10 mM HEPES (Gibco, Carlsbad, CA, USA). Blood-killed human neural stem cells, HB1, F3, and CE cells were obtained from Chung-Ang University (Seoul, Korea) and were treated with 10% FBS, 100 unit / ml penicillin, 100 μg / ml streptomycin, 10 mM HEPES and 0.1% (Invitrogen, Sandiego, Calif., USA) in a DMEM medium. All cell lines were cultured at 37 ° C in a humidified 5% CO ₂ atmosphere and 0.02% EDTA and 0.05% trypsin solution (Gibco, Carlsbad, CA, USA) were used for subculture.

2. Therapeutic effect of HB1.F3.CE cells and CPT-11 on lung cancer cells

The viability of lung cancer cells was determined by MTT assay according to the manufacturer's instructions. Briefly, A549 lung cancer cells (1650 cells / well / 100 [mu] l of medium) were added to 96-well plates and incubated overnight at 37 [deg.] C. The next day, HB1.F3.CE cells (3350 cells / well / 100 μl medium) or an equal volume of medium was placed in a 96-well plate with lung cancer cells, and then the prodrug CPT-11 (irinotecan; Sigma-Aldrich Co. St. Louis , Mo, USA) were added to the medium at 0.1, 0.2, 0.3, 0.5, 1.0 or 10 mmol. After 4 days, 10 μl of MMT (3- (4-, 5-dimethylthiazol-2-yl) -2,5-dyphenyl tetrazolium bromide, Sigma-Alderich Co., St. Louis, Mo. USA) The insoluble formazan crystal was dissolved in dimethyl sulfoxide (DMSO; Junsei chemical, Tokyo, Japan) and incubated at 37 ° C for 4 hours. The absorbance of the reduced MTT was measured at 540 nm using a VERSA man microplate reader (Molecular Devices, Sunyvale, Calif., USA). The results of each experiment were expressed as mean value (n = 12) for three duplicate experiments.

3. Semi-quantitative reverse transcription (PCR) and quantitative real-time PCR (PCR)

Total RNA was extracted from A549 lung cancer cells using TRIzol RNA extraction solution (Invitrogen Life Technologies, Carlsbad, Calif., USA). Briefly, 1 μg of RNA was extracted from HB1.F3.CE cells and A549 lung cancer cells using a murine lukemia virus reverse transcriptase (MMLV-RT; iNtRon Biotechnology, Seongnam, Gyeonggi-do, Korea) (iNtRon Biotechnology, Sungnam, Gyeonggi-do, Korea), 200 nM monomer random primer (TaKaRa Bio., Shiga, Japan), 5 times reaction buffer (RNase inhibitor, iNtRon Biotechnology, Sungnam, Gyeonggi-do, Korea). Complementary DNA (cDNA) was generated from this RNA for one hour at 37 ° C and the reaction was stopped by incubation at 95 ° C for 5 minutes. PCR was performed using cDNAs prepared from total RNA extracted from HB1.F3.CE cells and A549 lung cancer cells to confirm expression of human CE gene (hCE) and rabbit CE gene (rCE). The reaction was carried out using 2.5 units of Taq polymerase (iNtRon Biotechnology, Seongnam, Gyeonggi-do, Korea), 5pM dNTP, 10x PCR buffer (iNtRon Biotechnology, Seongnam, Gyeonggi-do, Korea) and 10pM primer sets . The nucleotide sequence of the primer set used in the reaction is as follows (Table 1).

gene Orientation The nucleotide sequence (5 → 3) rCE Omni direction TGCTGGGCTATCCACTCTCT (SEQ ID NO: 1) Reverse CTCCAGCATCTCTGTGGTGA (SEQ ID NO: 2) hCE Omni direction CACTCCTGCTGACTTGACCA (SEQ ID NO: 3) Reverse CATCCCCTGTGCTGAAGAAT (SEQ ID NO: 4) uPA Omni direction GGCAGGCAGATGGTCTGTAT (SEQ ID NO: 5) Reverse TTGCTCACCACAACGACATT (SEQ ID NO: 6) SDF-1α Omni direction GTGTCACTGGCGACACGTAG (SEQ ID NO: 7) Reverse TCCCATCCCACAGAGAGAAG (SEQ ID NO: 8) MCP-1 Omni direction CAAGCAGAAGTGGGTTCAGGA (SEQ ID NO: 9) Reverse TCTTCGGAGTTTGGGTTTGC (SEQ ID NO: 10) VEGF Omni direction CCAGCACATAGGAGAGATGAGCTT (SEQ ID NO: 11) Reverse TCTTTCTTTGGTCTGCATTCACAT (SEQ ID NO: 12) SCF Omni direction GGCAAATCTTCCAAAAGACTACA (SEQ ID NO: 13) Reverse GCCTTCAGAAATATTTGAAAACTTG (SEQ ID NO: 14) GAPDH Omni direction ATGTTCGTCATGGGTGTGAACCA (SEQ ID NO: 15) Reverse TGGCAGGTTTTTCTAGACGGCAG (SEQ ID NO: 16)

PCR was carried out by denaturation at 95 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and extension at 72 ° C for 30 seconds. . The products of RT-PCR (reverse transcription PCR) were separated by 1.5% agarose gel electrophoresis and stained with EtBr (ethidium bromide; Sigma-Aldrich Co. St. Louis, MO, USA) After visualization, digital photographs were taken using a GelDoc 2000 instrument (Gel Doc 2000; BioRad Laboratories, Hercules, Calif., USA). In addition, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) gene was used as a positive control in electrophoresis.

To quantify the expression of chemotactic factors such as uPA (urokinase-type plasminogen activator), SDF-1α, VEGF, MCP-1 (monocyte chemotactic protein 1) and SCF expressed in A549 lung cancer cells, real- ) Was used to quantify the cDNA. Real-time PCR was performed by denaturing at 95 ° C for 15 seconds using a 2X SYBP green mix (TaKaRa Bio., Shiga, Japan), ROX dye (TaKaRa Bio., Shiga, Japan) and the primer set For 20 seconds, and extension at 72 DEG C for 15 seconds as one cycle. All results were analyzed using the comparative 2 ^-ΔΔCt method and normalized for the expression level of the GAPDH gene.

4. Primary lung cancer mouse model

For the present invention, male BALB / c nude mice were purchased from Central Laboratory Animal (Seoul, Korea) for 6 weeks. The nude mice used were maintained in an aseptic environment with occasional ventilation system, changing day and night over a period of 12 hours. All mice were fed free of pressurized sterilized food and distilled water. A549 lung cancer cells (2 × 10 ⁶ cells / 100 μl / mouse) were suspended in phosphate buffered saline (PBS) and stained with a matrigel (BD Biosciences, Franklin Lakes, NJ, USA) . When the size of the tumor burden was 200 mm ³ , 24 mice were divided into 3 groups; 1) treated with HB1.F3.CE cells and CPT-11, 2) treated with CPT-11 alone, and 3) negative control with both stem cells and CPT-11 not treated. Five weeks after the inoculation, 4 x 10 ⁶ HB1.F3.CE cells suspended in the solution were injected twice into the lung cancer load between 35 and 40 days. The stem cells before injection were stained with 2 μM of chloromethylbenzamide-1,1'-dioctadecyl-3,3,3'-tetramethyl-indocarbocyanine perchlorate (Invitrogen Life Technologies) and the prodrug CPT-11 was HB1.F3. After 11 days of injecting CE cells, mice were injected intraperitoneally with a dose of 13.5 mg / kg / day in 100 μl of physiological saline. The size of the tumor was measured with a caliper and measured weekly according to the formula: length X width X height X 0.5236. At 48 hours after the last experiment, mice were sacrificed and histopathologic analysis of tumor mass was performed.

5. Xenotransplantation model of brain metastatic lung cancer

A 2149 lung cancer cell (1 × 10 ⁵ cells / 8 μl / mouse) was purchased from the Central Laboratory Animal and the white matter (anterior / posterior (AP) + 1.0 mm, (DV) -3.2 mm], respectively, to establish a metastatic lung cancer model. After 2 weeks, 21 mice were divided into 3 groups; 1) HB1.F3.CE cells and CPT-11 treated group, 2) CPT-11 treated group, and 3) negative control group treated with stem cells and prodrug. HB1.F3.CE cells and CPT-11 treated mice were injected with HB1.F3.CE cells (1x10 ⁵ cells / mouse) stained with 2 μM CM-DiI in the left hemisphere of the brain and CPT-11 (13.5 mg / kg / day) was injected into the peritoneal peritoneal cavity twice a week for 5 days once a day.

6. Hematoxylin and Eosin (H & E) staining and fluorescence analysis

Tumor burden and brain were collected from sacrificed mice, fixed in 4% normal formalin (Sigma-Aldrich Co., St. Louis, Mo., USA) and hardened in paraffin to make paraffin blocks. The paraffin block was stained with hematoxylin and eosin (H &E; Sigma-Aldrich Co., St. Louis, Mo., USA) and cut to a thickness of 3 μm using a sliding microtome. The manipulation slice was used to identify other histologic findings including apoptosis or necrosis and was performed with DAPI (4,6-diamidino-2-phenylindole; Sigma-Aldrich Co , St. Louis, Mo., USA), and fluorescence analysis was performed on stem cells transferred to the brain or tumor load. Stem cells were stained with 2 μM CM-DiI and injected into a primary or metastatic lung cancer mouse model. DAPI staining was used as a control staining method on slides and observed using a BX51 optical microscope (Olympus, Tokyo, Japan).

7. Immunohistochemical method

Immunohistochemistry was performed on tissue sections from primary lung cancer mouse models. To expose the antigen from the tissue, tissue slides were immersed in 0.01 M citrate buffer (pH 6.0) and incubated for 10 min in a microwave oven. After the antigen recovery, the internal peroxidase function was stopped The reaction was carried out in a solution of 0.3% methanol / hydrogen peroxidase (Sigma-Aldrich Co., St. Louis, MO, USA) at room temperature for 30 minutes. The slides were incubated for 1 hour at room temperature in 5% BSA (bovine serum albumin, Sigma-Aldrich Co., St. Louis, MO, USA) containing 10% NGS (normal goat serum; Vector Laboratories, Burlingame, Lt; / RTI &gt; Subsequently, the cells were washed twice with 1 × physiological saline (PBS-Tween) containing 0.05% Tween 20. The cells were washed twice with a PCNA (proliferating cell nuclear antigen) primary mouse monoclonal antibody (1: 100 dilution, Abcam, Plc., Cambridge, UK) overnight at 4 ° C. At the end of the reaction, the slides were washed 4 times for 10 minutes each in PBS-Tween and reacted at 37 ° C for 30 minutes in a biotinylated secondary antibody (1: 500 dilution, Vector Laboratories, Burlingame, CA, USA) solution. Each slide was treated with ABC kit (Vectastain Universal Elie ABC Kit, Vector Laboratories, Burlingame, CA, USA) for 30 minutes and DAB material (Sigma-Aldrich Co., St. Louis, MO, USA ) And hematoxylin staining solution, and observed with a BX51 optical microscope and taken digital photographs.

8. Transwell assay

Transwell migration analysis was performed to confirm the migration ability of HB1.F3.CE cells. Briefly, A549 lung cancer cells were cultured in a 24-well plate at 37 占 폚 for one day. The bottoms of the transwells (8 μM pore, BD Biosciences) were coated with fibronectin (250 μg / ml, Sigma-Aldrich Co., St. Louis, Mo. USA) and stained with CM- And placed in a gastric chamber for one day. A dose response comparison of the effect of the VEGFR2 inhibitor, 100 μM KRN633 (Selleckchem, Houston, Tex., USA) on the mobility of HB1.F3.CE cells was performed before inoculation into transwells. After incubation for one hour with the inhibitor, the cells were treated with trypsin / EDTA, and the cells were removed from the culture plate and transferred to a transwell well chamber. After the incubation, the cells that had not migrated were removed with a cotton swab and the migrated cells were fixed in cold methanol for 10 minutes, and red fluorescent staining cells were identified through a fluorescence microscope (IX71 inverted microscope, Olympus, Tokyo, Japan) .

9. Immunoblotting

HB1.F3.CE cells (1.0 × 10 ⁵ cells / dish) were placed on a 60 mm ² dish containing DMEM medium containing 10% FBS and incubated at 37 ° C. overnight. Then, 50-100 μM of KRN633 was added to the medium And incubated for one hour. The cells were washed twice with physiological saline for one hour and washed with 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid and 0.1% SDS (sodium dodecyl sulfate) 1X RIPA protein extraction solution. The extracted proteins were extracted with BCA (bicinchoninic acid; Sigma-Aldrich Co., St. Louis, MO, USA) and cupric sulfate (Sigma-Aldrich Co., St. Louis, And 40 μg of the protein was separated by size using 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and then transferred to a PVDF (polyvinylidene difluoride) transfer membrane (ioRad Laboratories Inc.) . The transfer membrane in which the protein was transferred was immersed in a blocking solution containing 5% v / v skimmed milk powder in TBS-T (Tris-buffered saline, 0.1% Tween 20; BioRad Laboratories Inc.), and then anti-phospho-Erk1 / 2 (1: 1,000 dilution, Cell signaling technology Inc., Danvers, MA, USA), anti-c-fos (1: 2,000 dilution, Cell signaling technology Inc., Danvers, MA, USA) Diluted, Abcam plc.), Anti-GAPDH (1: 1,000 dilution, Santa Cruz Biotechnology Inc., CA, USA). The transfection membranes were reacted overnight with primary antibodies and incubated with goat anti-rabbit (horseradish peroxidase linked goat anti-rabbit, 1: 3,000 dilution, Santa Cruz Biotechnology Inc., CA, USA) or horseradish peroxidase- Mice (anti-mouse, 1: 3,000 dilution, BioRad Laboratories Inc.) secondary IgG antibody were reacted for 2 hours. Proteins were then identified using an enhanced chemiluminescence (ECL) kit (West-Q chemiluminescent Substrate Plus kit, GenDEPOT; Barker, TX, USA). Protein signal intensity values were analyzed by the Quantity One analysis program (BioRad Laboratories Inc.) and the percentage of protein normalized to cells not treated with KRN633. The results were plotted through GraphPad prism sofrware package.

10. Statistical Analysis

The results from each experiment were analyzed with the GraphPad Prism program. Data from cell and animal models were expressed as mean ± SD or SEM, and compared with one-way ANOVA followed by Tukey's test for all control groups. P <0.05 was considered statistically significant.

Experiment result

1. Anti-cancer effect of HB1.F3.CE cells and CPT-11 on A549 lung cancer cells

When the HB1.F3.CE cell, a therapeutic neural stem cell expressing the CE gene, and the prodrug CPT-11 were administered together, it was confirmed that the proliferation of A549 lung cancer cells was inhibited. For this, it was confirmed that rabbit-derived CE (rCE) gene was expressed from HB1.F3.CE cells using RT-PCR (panel A of FIG. 1). The survival rate of A549 lung cancer cells was also measured using MTT assay after treatment with 0.1, 0.2, 0.3, 0.5, 1.0 or 10.0 占 퐂 / ml of CPT-11. In the group treated with low concentration of CPT-11 (0.1 μg / ml), only the A549 lung cancer cells did not change the proliferation of cancer cells, but the HB1.F3.CE cells and the group treated with the prodrug CPT-11 , The growth of HB1.F3.CE cells was slowed and the survival rate of A549 lung cancer cells was 35% lower than before (Panel B in Fig. 1). In addition, the proliferation of A549 lung cancer cells was reduced by 60% in the group treated with HB1.F3.CE cells compared to the group treated with CPT-11 alone. This corresponds to 40% of the result of treatment with a high concentration of CPT-11 (1.0 μg / ml). These results demonstrate that human CE (hCE) gene, which is internally produced in A549 lung cancer cells and HB1.F3.CE cells, activates CPT-11 and induces cytotoxicity. It was confirmed that the internal factors caused by hCE expression of A549 lung cancer cells and HB1.F3.CE cells were not included (panel C in Fig. 1).

2. Cancer growth inhibition by HB1.F3.CE cells and CPT-11

Animal experiments were performed in BALB / c nude mice using HB1.F3.CE cells and CPT-11 to determine if HB1.F3.CE cells inhibited the growth of primary lung cancer tissues. A549 lung cancer cells were injected into the nude mice, and HB1.F3.CE cells and CPT-11 were injected according to the experimental period (panel A of FIG. 2). Experimental results The tumor burden of the CPT-11 +/- HB1.F3.CE cell test group was reduced compared to the negative control group (panel B of FIG. 2). The differences in tumor mass appeared after 3 weeks of treatment with CPT-11 and HB1.F3.CE cells. After 4 weeks of treatment, the volume of the tumor was reduced by 80% in the CPT-11 + / + HB1.F3.CE cells, and the volume of the tumor was reduced by 40% in the CPT-11 treated group (FIG. 2 C).

3. Histological analysis of tumor mass resected in mice

Hematoxylin and eosin staining was performed on the tumor mass of the cut-off mouse in order to confirm the effect of the therapeutic gene expressed in stem cells. The invasive tendency characteristic of the cancer cells of the control group, high density, and large nuclear inner cancer cells were confirmed (panel A of FIG. 3). In contrast, apoptosis and necrosis of lung cancer cells were observed in the CPT-11 +/- HB1.F3.CE cell test group, and apoptosis and necrosis were observed in the CPT-11 + / + HB1.F3.CE cell test group. Nuclear pyknosis, karyorrhexis, and karyolysis, which are characteristic of necrosis, were more evident than in the CPT-11 +/- HB1.F3. CE cell group (see panels B and C in Figure 3) ). In addition, in the CPT-11 + / + HB1.F3.CE cell test group, the density of lung cancer cells was remarkably reduced by nuclear lysis. Immunohistochemical staining of the proliferating cell nuclear antigen (PCNA) protein, which is a differentiated cell marker, was performed in lung cancer tissues. As a result, it was found that the negative control group had stronger nuclei than the CPT-11 +/- HB1.F3.CE cell group The number of differentiated cancer cells confirmed by staining was found to be high, and the relative expression level of PCNA in the CPT-11 + / + HB1.F3. CE cell-treated group was reduced by 70% as compared with the negative control (panel E in FIG. 3).

4. Tumor orientation of stem cells in primary lung cancer mouse models

Fluorescence analysis was used to determine whether stem cells migrated to lung cancer tissues. Before injecting stem cells into mice, HB1.F3.CE cells were stained with CM-DiI, a red fluorescent dye. As a result, red fluorescence was not observed in the group treated with the negative test group and CPT-11 (panel A and B in FIG. 4), but red fluorescence was observed in the group treated with HB1.F3.CE cell and CPT-11 (Panel C in Fig. 4).

5. Effect of stem cells on brain metastases of lung cancer in lung cancer mouse model

In order to measure the therapeutic effect of stem cells and prodrug drugs, lung cancer cells were injected directly into the right hemisphere of mouse brain to construct a brain metastatic lung cancer model (panel A of FIG. 5). Two weeks after the injection of lung cancer cells, HB1.F3.CE cells labeled with red fluorescence were injected into the left hemisphere and CPT-11, a prodrug, was injected intraperitoneally. Antitumor effects of CPT-11 and HB1.F3.CE cells were evaluated 4 weeks after the injection of lung cancer cells. Histopathological findings showed tumor burden in all areas of the mouse brain and a difference between normal brain tissue and lung cancer cells (panel B of FIG. 5). In addition, liquefactive necrosis was confirmed in HB1.F3. CE cells and CPT-11 treated groups (Panel C in FIG. 5), and nuclear condensation and nuclear decay were observed in cancer cells.

6. Transfection of stem cells in metastatic lung cancer mouse model

After addition of cancer cells to the brain of primary lung cancer mouse model, HB1.F3.CE cells with CM-DiI fluorescent label were injected. In order to investigate the migration tendency of stem cells, fluorescence-labeled HB1.F3.CE cells in the right hemisphere were injected into the left hemisphere and analyzed by fluorescence microscopy. In the control group, fluorescence labeling was not observed in the right hemisphere tumor burden (Fig. 5 Panel D). In the primary lung cancer mouse model in which HB1.F3.CE cells and CPT-11 were co-injected, red fluorescence labeling was observed near the right hemisphere tumor burden (panel E of FIG.

7. Function of VEGF / VEGFR2 signaling

To elucidate the ability of stem cells to migrate to tumor cells, quantitative analysis of chemoattractant factors including uPA, SDF-1α, VEGF, MCP-1 and SCF from A549 lung cancer cells by real- (Panel A of FIG. 6). The results showed that A549 lung cancer cells mainly excreted chemotactic factors such as uPA, VEGF, MCP-1 and SCF, and VEGFR2 inhibition assay showed that VEGF / VEGFR2 signal transduction leads to A549 lung cancer cells of HB1.F3.CE cells It was confirmed that it induces movement. For transwell analysis of cancer cells and stem cells, HB1.F3.CE cells were stained with CN-DiI, and 100 μM KRN633 was pretreated for one hour to inhibit the binding of VEGF and VEGFR2 released from the cells . The KRN633-treated stem cells were cultured in the upper chambers of Transwell for a day and the migration of the cells was measured. As a result, it was confirmed that the migration to the lung cancer cells was significantly reduced as compared with the KRN633-untreated stem cells B). Eight cells migrated in approximately one transwell, a 75% decrease compared to the migration of cells not treated with KRN633.

8. Mechanism of inhibition of movement effect by Erk1 / 2 and Akt

The inhibition of VEGFR2 by KRN633 was carried out in order to clarify the cancer - friendly migration phenomenon by stem cell VEGF / VEFGR2 signaling. For further understanding, cultured stem cells were treated with 50 μM, 100 μM KRN633 for 0, 30, and 60 minutes, followed by extraction of various downstream signaling proteins associated with stimulation of VEGF / VEGFR2 signaling (Panel A of FIG. 7). The present inventors confirmed that the expression of p-Erk1 / 2 protein in the stem cells was definitely increased due to treatment with KRN633 at 50 μM and 100 μM (panels B and C in FIG. 7). On the other hand, selective down-regulation of endogenous VEGFR2 in stem cells using inhibitors decreased Akt phosphorylation within the time of experiment but increased after one hour (panel D in FIG. 7). The relative value of Akt phosphorylation-related c-fos protein due to treatment with KRN633 did not change significantly.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chungbuk National University Industry Academic Cooperation Foundation <120> Human Neural Stem Cells Expressing Prodrug Conversion Enzyme and          Pharmaceutical Composition Comprising the Same for Treating          Primary and Metastatic Cancer <130> MP14-0263 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for rCE <400> 1 tgctgggcta tccactctct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for rCE <400> 2 ctccagcatc tctgtggtga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for hCE <400> 3 cactcctgct gacttgacca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for hCE <400> 4 catcccctgt gctgaagaat 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for uPA <400> 5 ggcaggcaga tggtctgtat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for uPA <400> 6 ttgctcacca caacgacatt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for SDF-1a <400> 7 gtgtcactgg cgacacgtag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> Reverse PCR primer for SDF-1a <400> 8 tcccatccca cagagagaag 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for MCP-1 <400> 9 caagcagaag tgggttcagg a 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for MCP-1 <400> 10 tcttcggagt ttgggtttgc 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for VEGF <400> 11 ccagcacata ggagagatga gctt 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for VEGF <400> 12 tctttctttg gtctgcattc acat 24 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for SCF <400> 13 ggcaaatctt ccaaaagact aca 23 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for SCF <400> 14 gccttcagaa atatttgaaa acttg 25 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward PCR primer for GAPDH <400> 15 atgttcgtca tgggtgtgaa cca 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse PCR primer for GAPDH <400> 16 tggcaggttt ttctagacgg cag 23

Claims (10)

A neural stem cell that is transformed with an expression vector comprising a nucleic acid molecule encoding a prodrug-converting enzyme to express the prodrug-converting enzyme.
The stem cell according to claim 1, wherein the neural stem cell is an immortalized stem cell established by introducing into a primary culture stem cell or a primary culture stem cell a vector containing a tumor gene in a form capable of expressing the oncogene Characterized by neural stem cells.
The neural stem cell according to claim 1, wherein the prodrug conversion enzyme is carboxyl esterase.
(a) a pharmacologically effective amount of the neural stem cells of any one of claims 1 to 3; And (b) a pharmaceutically acceptable carrier.
The method of claim 4, wherein the primary cancer is selected from the group consisting of breast cancer, lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, A prostate cancer, an endometrial cancer, a cervical cancer, a small intestine cancer, an endocrine cancer, a thyroid cancer, a pituitary cancer, a kidney cancer, a soft tissue tumor, a urethral cancer, a prostate cancer, a bronchial cancer or a bone cancer.
The method of claim 4, wherein the metastatic cancer is selected from the group consisting of breast cancer, lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer or skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, Wherein the cancer is a cancer that has metastasized to the brain from endometrial cancer, cervical cancer, small bowel cancer, endocrine cancer, thyroid cancer, pituitary cancer, kidney cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchial cancer or bone marrow cancer.
(a) a neural stem cell according to any one of claims 1 to 3; And (b) a prodrug.
8. The kit according to claim 7, wherein the prodrug is CPT-11 (irinotecan).
The method of claim 7, wherein the primary cancer is selected from the group consisting of breast cancer, lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, Wherein the cancer is cancer, endometrial cancer, cervical cancer, small bowel cancer, endocrine cancer, thyroid cancer, parathyroid cancer, kidney cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchial cancer or bone cancer.
8. The method of claim 7, wherein the metastatic cancer is selected from the group consisting of breast cancer, lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer or skin or ocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, Wherein the cancer is metastatic to the brain from endometrial cancer, cervical cancer, small bowel cancer, endocrine cancer, thyroid cancer, pituitary cancer, kidney cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchial cancer or bone marrow cancer.

Images