CN111617248B

CN111617248B - Application of RFPL1S-201 in preparing medicine for inhibiting ovarian cancer proliferation, invasion and/or metastasis

Info

Publication number: CN111617248B
Application number: CN201910984948.8A
Authority: CN
Inventors: 贾雪梅; 徐娟; 刘丝雨; 许鹏飞; 葛莉莉; 黄可
Original assignee: Nanjing Maternity and Child Healthcare Hospital
Current assignee: Nanjing Maternity and Child Healthcare Hospital
Priority date: 2019-10-16
Filing date: 2019-10-16
Publication date: 2021-07-09
Anticipated expiration: 2039-10-16
Also published as: CN111617248A

Abstract

The invention discloses application of RFPL1S-201 in preparing a medicament for inhibiting ovarian cancer proliferation, invasion and/or metastasis. Application of RFPL1S-201 or substance promoting RFPL1S-201 expression in preparing medicine for inhibiting proliferation, invasion and/or metastasis of ovarian cancer. Use of an expression plasmid overexpressing RFPL1S-201 in the preparation of a medicament for inhibiting ovarian cancer proliferation, invasion and/or metastasis. The invention finds that lncRNA RFPL1S-201 can inhibit proliferation, invasion, metastasis and the like of ovarian cancer cells, and meanwhile lncRNA RFPL1S-201 can inhibit liver metastasis of ovarian cancer in vivo. The action mechanism of the compound mainly plays a role in inhibiting tumor progression and promoting tumor chemotherapy sensitivity by inhibiting an IFN-STAT1 signal channel.

Description

Application of RFPL1S-201 in preparing medicine for inhibiting ovarian cancer proliferation, invasion and/or metastasis

Technical Field

The invention belongs to the field of biological medicines, and relates to application of RFPL1S-201 in preparation of a medicine for inhibiting proliferation, invasion and/or metastasis of ovarian cancer.

Background

Ovarian cancer is a common malignant tumor of female reproductive system, can occur at any age, and seriously threatens the life of women because early symptoms are atypical, the progression is rapid, the pelvic cavity implantation metastasis is early, and the fatality rate is always higher than the first gynecological tumor [1 ]. The tumor cytoreduction and platinum-based chemotherapy are the main clinical treatment scheme, with the improvement of the surgical skill and the chemotherapy scheme, the short-term survival rate of ovarian cancer patients is obviously increased, but the long-term recurrence rate is high, and the prognosis is still poor. Ovarian cancer is one of the leading causes of death in patients due to its extremely high metastatic potential and extremely high drug resistance [2 ]. Therefore, the intensive research on the development and drug resistance mechanism of ovarian cancer is still the focus of the current research on ovarian cancer.

With the continuous progress of the ENCODE program, the development of RNAomics provides a new entry point for the prevention and treatment of various diseases. Wherein the long non-coding RNAs (lncRNAs) are RNA transcripts consisting of more than 200 nucleotides [3 ]. Although there is no protein coding potential, lncRNAs have been shown to play a role in a wide range of biological processes [4 ]. It has been reported that certain lncRNAs such as ROR, SHNG15, PRLB etc. can regulate tumor progression and metastasis, and can be used as potential therapeutic targets for ovarian cancer [5-7 ].

Research of our subject groups finds that lncRNA RFPL1S-201 can inhibit proliferation, invasion and metastasis of ovarian cancer and promote apoptosis of ovarian cancer cells induced by drugs, and WB, ELISA and high-throughput sequencing find that IFN-STAT1 pathway is remarkably reduced in ovarian cancer cells over-expressed by RFPL 1S-201. STAT1 has been found in literature to promote anti-tumor immunity and increase the sensitivity of cancer cells to chemotherapy and radiotherapy [8,9 ]. Activation of STAT1 and NF-. kappa.B in brain tumor cells significantly promotes the growth and drug resistance of cancer cells [10 ]. Type I Interferon (IFN) responses can activate the JAK-STAT1 signaling pathway, promoting stem cells, drug resistance and radiation resistance in cancer cells [11 ]. STAT1 overexpression inhibits glioblastoma angiogenesis, and high STAT1 expression suggests a poor glioblastoma prognosis [12 ]. STAT 1/ATF 4 promotes the progression of hepatocellular carcinoma and oral squamous cell carcinoma [13 ]. These results suggest that lncRNA RFPL1S-201 may inhibit proliferation, invasion and/or metastasis of ovarian cancer by inhibiting the IFN-STAT1 pathway.

Reference documents:

[1]Rebecca L,Siegel KDM,Ahmedin Jemal,DVM.Cancer Statistics.CA CANCER J CLIN2019；69:7-34.

[2]Barbier J,Chen X,Sanchez G,et al.An NF90/NF110-mediated feedback amplification loop regulates dicer expression and controls ovarian carcinoma progression.Cell research.2018；28:556-71.

[3]Fatica A,Bozzoni I.Long non-coding RNAs:new players in cell differentiation and development.Nature reviews Genetics.2014；15(1):7-21.

[4]Marchese FP,Grossi E,Marin-Bejar O,et al.A Long Noncoding RNA Regulates Sister Chromatid Cohesion.Molecular cell.2016；63(3):397-407.

[5]Liang Y,Song X,Li Y,et al.A novel long non-coding RNA-PRLB acts as a tumor promoter through regulating miR-4766-5p/SIRT1 axis in breast cancer.Cell Death and Disease.2018；9(5):563.

[6]Wang L,Yu X,Zhang Z,et al.Linc-ROR promotes esophageal squamous cell carcinoma progression through the derepression of SOX9.Journal of Experimental&Clinical Cancer Research.2017；36(1):182.

[7]Qu C,Dai C,Guo Y,et al.Long noncoding RNA SNHG15 serves as an oncogene and predicts poor prognosis in epithelial ovarian cancer.OncoTargets and Therapy.2019；12:101-11.

[8]Huang S,Bucana C D,Van Arsdall M,et al.Stat1 negatively regulates angiogenesis,tumorigenicity and metastasis of tumor cells[J].Oncogene,2002,21(16):2504-2512.

[9]Legrier M E,Bieche I,Gaston J,et al.Activation of IFN/STAT1 signalling predicts response to chemotherapy in oestrogen receptor-negative breast cancer[J].Br J Cancer,2016,114(2):177-187.

[10]Chen Q,Boire A,Jin X,et al.Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer[J].Nature,2016,533(7604):493-498.

[11]Qadir A S,Ceppi P,Brockway S,et al.CD95/Fas Increases Stemness in Cancer Cells by Inducing a STAT1-Dependent Type I Interferon Response[J].Cell Rep,2017,18(10):2373-2386.

[12]Duarte C W,Willey C D,Zhi D,et al.Expression signature of IFN/STAT1 signaling genes predicts poor survival outcome in glioblastoma multiforme in a subtype-specific manner[J].PLoS One,2012,7(1):e29653.

[13]Wu T S,Tan C T,Chang C C,et al.B-cell lymphoma/leukemia 10promotes oral cancer progression through STAT1/ATF4/S100P signaling pathway[J].Oncogene,2015,34(10):1207-1219.

disclosure of Invention

The invention aims to provide application of RFPL1S-201 in preparing a medicament for inhibiting ovarian cancer proliferation, invasion and/or metastasis.

The purpose of the invention can be realized by the following technical scheme:

RFPL1S-201(ENST00000419368.1the sequence information may log in the following website to get http:/be genome.ucsc.edu/cgi-bin/hgchgsid＝1039674013_7giPv9sGY2VkFaM2O5zAAPS6yleu&g ＝htcGeneMrna&i＝ENST00000419368.1&c＝chr22&l＝29867929&r＝29874059&o＝ wgEncodeGencodeBasicV36lift37&table＝wgEncodeGencodeBasicV36lift37) The application of the polypeptide as a therapeutic target in preparing or screening medicaments for inhibiting the proliferation, invasion and/or metastasis of ovarian cancer.

Application of RFPL1S-201 or substance promoting RFPL1S-201 expression in preparing medicine for inhibiting proliferation, invasion and/or metastasis of ovarian cancer.

Preferably, the invention is the application of RFPL1S-201 or the substance promoting the expression of RFPL1S-201 in preparing medicine for inhibiting the proliferation, invasion and/or liver metastasis of ovarian cancer.

Use of an expression plasmid overexpressing RFPL1S-201 in the preparation of a medicament for inhibiting ovarian cancer proliferation, invasion and/or metastasis.

Preferably, the expression plasmid for over-expressing RFPL1S-201 is used for preparing the medicine for inhibiting ovarian cancer proliferation, invasion and/or liver metastasis.

As a preferred embodiment of the present invention, the expression plasmid overexpressing RFPL1S-201 is obtained by ligating LncRNA RFPL1S-201 to the NheI/NotI site of pcDNA3.1(+) at the full length.

Has the advantages that:

the lncRNA RFPL1S-201 is found to be low in expression in ovarian cancer tissues and ovarian cancer cells, and high in expression in normal ovarian epithelium and normal ovarian epithelial cells (figure 1). The lncRNA RFPL1S-201 is over-expressed, and can inhibit the proliferation, invasion, metastasis and the like of ovarian cancer cells (figure 2-3); the over-expression of RFPL1S-201 can also significantly promote apoptosis induced by PTX and apoptosis inducer, and has dose dependence without affecting apoptosis of ovarian cancer cell (FIG. 4). Meanwhile, lncRNA RFPL1S-201 can inhibit liver metastasis of ovarian cancer in vivo and increase survival time of mice (figure 5). The action mechanism of the compound mainly plays a role in inhibiting tumor progression and promoting tumor chemotherapy sensitivity by inhibiting an IFN-STAT1 signal channel. Therefore, RFPL1S-201, a substance for promoting the expression of RFPL1S-201 or an expression vector for over-expressing RFPL1S-201 can be applied to the preparation of medicines for inhibiting the proliferation, invasion and/or metastasis of ovarian cancer.

Drawings

Figure 1RFPL1S-201 was significantly downregulated in ovarian cancer tissues and in most ovarian cancer cell lines (a): qRT-PCR detects the expression of RFPL1S-201 in ovarian cancer tissues and normal ovarian epithelial tissues; (B) the method comprises the following steps And (3) detecting the expression condition of RFPL1S-201 in the ovarian cancer cell strain and the normal ovarian epithelial cell strain by qRT-PCR.

FIG. 2 suppression of overexpression of RFPL1S-201 promotes proliferation, invasion and metastasis of ovarian cancer cells (A):

OD

0h, 24h, 48h and 72h in the over-expressed group of RFPL1S-201 and the control group A2780 cells₄₅₀A growth value; (B) the method comprises the following steps OD of RFPL1S-201 overexpression group and SKOV3 control group at 0h, 24h, 48h and 72h₄₅₀A growth value; (the experimental results are three independent experimental data ± SD); (C) the method comprises the following steps In A2780 cell invasion and migration experiments, cells at the lower layer of a Transwell chamber are stained with crystal violet and then are imaged under an inverted microscope (multiplied by 200); (D) the method comprises the following steps A2780 cell Transwell chamber lower layer cell protein quantification results, wherein the left vertical axis is an invasion result, and the right vertical axis is a migration result; (E) the method comprises the following steps In SKOV3 cell invasion and migration experiments, cells under a Transwell chamber are stained with crystal violet and then are imaged under an inverted microscope (x 200); (F) the method comprises the following steps Quantitative results of cellular proteins in the lower layer of the Transwell chamber of SKOV3 cells, wherein the left vertical axis shows invasion results and the right vertical axis shows migration results(results of three independent experiments data. + -. SD;. represents p)<0.05, represents p<0.01, p < 0.001).

FIG. 3 knockdown of RFPL1S-201 inhibited proliferation, invasion and metastasis of ovarian cancer cells (A):

OD

0h, 24h, 48h and 72h in the over-expressed group of RFPL1S-201 and the control group A2780 cells₄₅₀A growth value; (B) the method comprises the following steps OD of RFPL1S-201 overexpression group and SKOV3 control group at 0h, 24h, 48h and 72h₄₅₀A growth value; (the experimental results are three independent experimental data ± SD); (C) the method comprises the following steps In SKOV3 cell invasion and migration experiments, cells under a Transwell chamber are stained with crystal violet and then are imaged under an inverted microscope (x 200); (D) the method comprises the following steps SKOV3 cells Transwell chamber lower layer cellular protein quantification results, left vertical axis for invasion results, right vertical axis for migration results. (results of three independent experiments data. + -. SD;. represents p)<0.05, represents p<0.01, p < 0.001).

FIG. 4 overexpression of RFPL1S-201 can promote drug-induced apoptosis in ovarian cancer cells (A): qRT-PCR detects the overexpression efficiency of A2780 cells RFPL 1S-201; (B) the method comprises the following steps Detecting the overexpression efficiency of SKOV3 cells RFPL1S-201 by qRT-PCR; (C) the method comprises the following steps Flow cytometry detection of RFPL1S-201 overexpression and control a2780 cells in 0, 64, 256nmol PTX treatment for 48h before the premature + late ratio; (D) the method comprises the following steps Flow cytometry detection of RFPL1S-201 overexpression and control SKOV3 cells at 0, 128, 512nmol PTX treatment for 48h before the ratio of early and late withering; (E) the method comprises the following steps Detecting the ratio of early withering and late withering of RFPL1S-201 overexpression and control group A2780 cells after the cells are acted by an apoptosis inducer (concentration is 1:1000) for 12 hours by flow cytometry; (F) the method comprises the following steps Detecting the ratio of early withering and late withering of RFPL1S-201 overexpression and SKOV3 cells in a control group after 12 hours of action of an apoptosis inducer (concentration is 1:1000) by flow cytometry; (results of three independent experiments ± SD, p <0.05, p <0.01, p < 0.001).

FIG. 5RFPL1S-201 can inhibit the proliferation and metastasis of ovarian cancer cells in vivo

(A) The method comprises the following steps Gross images of the livers of nude mice in the control group and the RFPL1S-201 overexpression group; (B) the method comprises the following steps H & E staining microscopic (100X) images of liver tissue sections of nude mice in a control group and an RFPL1S-201 overexpression group; only 3 mice survived in the control group, and all livers had multiple metastases of liver parenchymal tissue; in the overexpression group, 8 mice were survived together, of which 2 mice showed only hepatic portal vein metastasis and no hepatic parenchymal metastasis, 3 mice showed only 1 hepatic parenchymal metastasis, and only 3 mice developed multiple hepatic parenchymal metastases similar to those of the control group. (C) The method comprises the following steps H & E staining images under microscope (100X) of lung tissue sections of nude mice in a control group and an RFPL1S-201 overexpression group, wherein no obvious lung metastasis is observed in the two groups; (D) the method comprises the following steps After injecting lentivirus to stably transfer RFPL1S-201 overexpression and a nude mouse survival curve after controlling SKOV3 cells, the survival time of RFPL1S-201 overexpression group mice is prolonged, and the difference has statistical significance (p is 0.0489).

FIG. 6 shows that IFN beta-STAT 1 signal pathway is remarkably reduced in ovarian cancer cell line with RFPL1S-201 overexpression

(A) The method comprises the following steps Differential expression of gene volcano plots in SKOV3 cells transfected with RFPL1S-201 overexpression plasmid and control plasmid pcDNA3.1; (B) the method comprises the following steps KEGG Pathway analysis SKOV3 cells transfected with RFPL1S-201 overexpression plasmid and control plasmid pcDNA3.1 were enriched with a bubble map for the differential gene. (C) The method comprises the following steps Differential heatmap of ISGs-related gene expression in SKOV3 cells transfected with RFPL1S-201 overexpression plasmid and control plasmid pcDNA3.1. (D) The method comprises the following steps qRT-PCR confirmed that RFPL1S-201 overexpressed ISGs-related genes that were differentially expressed in control cells. (E) Western blot experiment verifies that RFPL1S-201 over-expresses ISGs related gene expression which is differentially expressed in control cells. (F) The method comprises the following steps Western blot experiment verifies that RFPL1S-201 is over-expressed and STAT family protein expression in control cells. (G) The method comprises the following steps ELISA experiments analyzed the expression of IFN β in the culture supernatants of RFPL1S-201 over-expressed and control A2780 cells and SKOV3 cells. P <0.05, p <0.01, p <0.001

Detailed Description

Materials and methods experimental materials: the human ovarian epithelial cancer cell line a2780 was purchased from south kyaky bio. The human ovarian epithelial cancer cell line SKOV3 is purchased from a cell bank of the China academy of sciences typical culture collection committee,

RT Master kit was purchased from Thermo Fisher, Trizol was purchased from Thermo Fisher, CCK8 reagentThe kit is purchased from Jiangsu Kaiyi biotechnology, Inc., the plasmid extraction kit is an OMEGA plasmid extraction kit, the siRNA interference kit is purchased from Thermo Fisher, paclitaxel produced by Corden Pharma Latina S.P.A. provided by Baishi Mei Guibao (Shanghai) trade, Inc., cisplatin is purchased from Qilu pharmaceutical, Inc., Lipo2000 is purchased from Thermo Fisher, the DMEM medium is purchased from Kaiyi organism, and fetal calf serum is purchased from Thermo Fisher.

Example 1

1. Cell line

Ovarian cancer cell line SKOV3 was purchased from the cell bank of the China academy of sciences type culture Collection; normal ovarian epithelial cell line IOSE386, ovarian cancer cell lines A2780, HO-8910PM, OVCAR3 and OVCAR8 were purchased from Kaikyi organisms. The cell culture conditions were as follows:

culture solution: SKOV 3: McCoy's 5A incomplete broth (1 ×) + 10% Fetal Bovine Serum (FBS)

A2780: DMEM incomplete high-sugar medium (1X) + 10% Fetal Bovine Serum (FBS)

Digestion solution: 0.25% Trypsin-EDTA (1X)

Freezing and storing liquid: fetal Bovine Serum (FBS): dimethylsulfoxide (DMSO): 9: 1

2. Clinical specimen

The samples of the study are obtained from operation patients of maternal-child healthcare institute in Nanjing from 2016 to 2017, and 13 normal ovarian tissue samples (from cervical cancer and preventively resected ovaries of endometrial cancer) and 13 epithelial ovarian cancer tissue samples are collected together. Normal ovarian tissue and ovarian cancer tissue were age matched (44. + -.16 vs 42. + -.22). All excised tissues were confirmed by histopathological examination and all samples were snap frozen in liquid nitrogen and stored at-80 ℃ prior to use. This study was approved by the ethical committee of the maternal care facility, tokyo, and informed consent was obtained from each patient.

3. Total RNA extraction

Extracting total RNA with a Thermo kit (K0731) RNA extraction kit, reverse transcribing with a Thermo (K1622) reverse transcription kit, and storing the cDNA at-70 deg.C for later use.

5. Fluorescent quantitative PCR

The primers were synthesized by the Kinry Biotechnology Ltd, and the sequences were as follows: RFPL 1S-201-F: CATTTGCCAAGCACAGAACCA (SEQ ID NO.1), RFPL 1S-201-R: TCCCCTCAGCTCATGGTCTA (SEQ ID NO.2), β -ACTIN-F: AGCGAGCATCCCCCAAAGTT (SEQ ID NO.3), beta-ACTIN-R: GGGCACGAAGGCTCATCATT (SEQ ID NO. 4).

1) The primer dilution concentration is 10 mu M, and a reaction system is prepared according to the following proportion:

1) reaction conditions are as follows: 2min at 50 ℃; pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15 s; annealing at 60 ℃ for 60 s; extension at 95 ℃ for 15 s. The reaction was 40 cycles. Real-time quantitative PCR results Using 2^-△ctThe theory is to analyze.

The results are shown in FIG. 1; it can be seen that RFPL1S-201 is significantly reduced in ovarian cancer tissues and in most ovarian cancer cell lines compared to normal ovarian epithelium.

Example 2

Construction of RFPL1S-201 interfering RNA and overexpression plasmid:

the interfering RNA sequences of RFPL1S-201 and the interfering RNA sequences of the control were designed and synthesized by Thermo Fisher, USA.

The over-expression plasmid pc-RFPL1S-201 of RFPL1S-201 is constructed and synthesized by Shanghai Jie Ri bioengineering Co., Ltd on the basis of pcDNA3.1(+), and the cloning sites are: NheI/NotI, the LncRNA RFPL1S-201(ENST00000419368.1) was ligated to the Cytomegalovirus (CMV) promoter of the pcDNA3.1 vector in full length. The extracted plasmid concentration is determined by using an OMEGA kit (D6915-03) plasmid, and the detection sequence is successfully connected and is directly used for subsequent experiments or stored at-80 ℃.

2. Cell transfection

1) When the fusion degree of SKOV3 and A2780 cells cultured in the 6-well plate reaches 90% -95%, co-culturing RFPL1S-201 overexpression plasmid, control pcDNA3.1 plasmid, RFPL1S-201-siRNA and control siRNA and cells according to the proportion recommended by a Lipofectamine 2000 transfection kit;

2) removing culture solution in the 6-well plate 2h before transfection, and adding 2ml of fresh culture medium;

3) adding RFPL1S-201 overexpression, control plasmid and liposome Lipofectamine 2000 into 250 μ l OPTI-MEM culture medium respectively for dilution, gently blowing to avoid bubbles (at least 100 times), mixing, and standing at room temperature for 5 min;

4) suspending the plasmid diluent vertically and dripping the liposome Lipofectamine 2000 diluent, wrapping the liposome with the liposome by using the gravity of the liquid drop, gently blowing and beating (about 100 times), uniformly mixing, and standing at 37 ℃ for 5-20 min;

5) removing the culture medium from the 6-well plate, and adding 1.5ml of OPTI-MEM culture medium;

6) adding the OPTI-MEM culture medium prepared by mixing Lipofectamine 2000 and plasmid into a 6-pore plate, wherein each pore is 0.5ml, shaking the six-pore plate to mix the liquid in four directions, and placing the liquid in an incubator;

7) after 6h of transfection, the culture medium is changed into a culture medium corresponding to cells with serum or without double antibody, and after 18-48 h of transfection, the cells are collected for verification or subsequent experiments.

Example 3 cell proliferation assay

1) Transiently transfecting cells for 24h, counting the cells, diluting with a culture medium containing 10% FBS to a desired concentration, adding the cell suspension into a 96-well plate, wherein each 100 mu of suspension contains about 1000 cells, the cell suspension is divided into four groups of 0h, 24h, 48h and 72h, each group contains 5-6 auxiliary wells, placing the auxiliary wells at 37 ℃ and 5% CO₂Waiting for the cells to adhere to the wall in the incubator for 3-4 h;

2) cell activity was measured as group time after cell attachment: the medium was replaced with a mixed solution containing 10% CCK-8 reagent at 37 ℃ with 5% CO₂And (3) after reacting for 1h in the incubator, detecting by using an enzyme-labeling instrument, wherein the detection wavelength is as follows: 450 nm.

The results are shown in FIGS. 2A-B and FIGS. 3A-B; it can be seen from the figure that over-expression of RFPL1S-201 can significantly inhibit the proliferation of ovarian cancer cells, while knock-down of RFPL1S-201 can significantly promote the proliferation of ovarian cancer cells.

Example 4 cell migration and invasion assay

1) The specific steps of the invasion experiment are as follows:

A. subpackaging Matrigel: after the matrigel is melted on ice, the ice is subpackaged into 1.5ml of EP tubes with 60 mu l of each tube, so that repeated freezing and thawing are avoided;

B. spreading glue: mixing with serum-free medium according to the proportion of 1: 5(v/v), spreading on the upper surface of a Transwell chamber, 60 mu l/hole, and drying in an incubator at 37 ℃; the migration experiment has no A, B steps;

2) 200ul of cell suspension containing 5X 104 cells was added to the upper surface of the Transwell chamber, and 600 and 800. mu.l of complete medium containing 20% FBS was added to the 24-well plate in which the chamber was placed, and the chamber was placed at 37 ℃ in a 5% CO2 incubator;

3) placing the culture box for 24h, collecting the migration experiment chamber, and collecting the invasion experiment chamber after 48 h;

4) the Transwell chamber was placed in 4% paraformaldehyde to fix the cells for 20 min;

5) transferring the small chamber into 0.1% crystal violet dye solution for dyeing for 15 min;

6) washing the Transwell chamber 2 times in ddH2O, and gently wiping off the residual Matrigel and dye on the upper surface of the Transwell chamber with a cotton swab;

7) randomly pick 3 areas per well under an inverted microscope (200 ×);

8) cells on the lower surface membrane of the Transwell chamber were lysed by adding 200. mu.l of cell lysis solution, and then the light absorption value was measured at a wavelength of 562 nm.

The results are shown in FIGS. 2C-F and 3C-F; it can be seen from the figure that over-expression of RFPL1S-201 can significantly inhibit invasion and migration of ovarian cancer cells, while knock-down of RFPL1S-201 can significantly promote invasion and migration of ovarian cancer cells.

Example 5 apoptosis assay

The apoptosis test adopts an apoptosis kit of BD company and is carried out according to the kit specification, and the specific test method comprises the following steps:

1) induction of apoptosis:

A. apoptosis positive control agents induce apoptosis: after cells are transiently transfected for 24 hours, adding an apoptosis positive control reagent A + B provided in the kit according to the kit specification to induce apoptosis;

B. PTX induces apoptosis: 24h after transient transfection, 3 concentrations of paclitaxel PTX (A2780: 0nmol, 64nmol, 256 nmol; SKOV 3: 0nmol, 128nmol, 512nmol) were added to the cells;

2) adding PTX 48h or adding an apoptosis positive control reagent A + B provided in the kit to induce apoptosis for 24h, collecting all culture media in a culture dish and PBS (phosphate buffer solution) solution washed twice into a 50ml centrifuge tube, digesting the cells by trypsin digestive juice without EDTA (ethylene diamine tetraacetic acid) solution for 3-5min, adding three times of serum-containing culture medium to terminate digestion, transferring the liquid into the 50ml centrifuge tube, carrying out treatment at 4 ℃ and 3000rpm for 5min, and removing supernatant;

3) adding 4ml of precooled PBS, gently blowing and beating the cell suspension, transferring the cell suspension into a 15ml centrifuge tube, carrying out 5min at 4 ℃ and 3000rpm, and removing the supernatant;

4) repeating the step 2) once;

5) preparing 10 Xannexin V Binding Buffer into 1 Xwith double distilled water, adding 1X 106 cells into 100. mu.l of 1 Xannexin V Binding Buffer to prepare cell suspension, and transferring the cell suspension into a 1.5ml EP tube;

6) adding 5. mu.l Annexin V-PE and 5. mu.l 7-AAD to the cell suspension respectively;

7) gently shaking the cell suspension, and reacting for 15 minutes at room temperature in a dark place;

8) 400 mul of 1 XBinding Buffer is added into each tube of cell suspension and then mixed evenly, and the mixture is put on a machine for detection within 1 hour.

The results are shown in fig. 4, and it can be seen from the results that overexpression of RFPL1S-201 can significantly promote apoptosis induced by PTX and apoptosis inducer, etc., and has dose dependence.

Example 6 animal experiments

4-6 weeks old female nude mice of BABL/c were purchased from the university of Nanjing institute of model animals.

1) Firstly, marking the sequence of a nude mouse by using a method of cutting toes and an external ear pinna;

2) weighing nude mice, and uniformly dividing the nude mice into 2 groups according to the weight, wherein each group comprises 7 mice;

3) culturing lentivirusQuantitatively transfecting SKOV3 cell strain with RFPL1S-201 overexpression and control, digesting and centrifuging to prepare 1 × 10⁷The cell suspension is injected into the tail vein of nude mouse in 200 μ l each, about 2 × 10⁶(ii) individual cells;

4) after 35 days, the nude mice are subjected to neck breaking treatment, and lung and liver tissues are taken out to be subjected to H & E staining and immunohistochemistry;

5) hematoxylin and eosin staining test steps:

A. paraffin section dewaxing to water: placing the slices in xylene I for 20min, soaking in xylene II for 20min, soaking in anhydrous ethanol I for 5min, then adding anhydrous ethanol II for 5min, soaking in 75% ethanol for 5min, and cleaning with clear water;

B. hematoxylin staining: staining the slices with hematoxylin for 3-5min, differentiating with hydrochloric acid aqueous solution, turning the ammonia aqueous solution to blue, and cleaning with clear water;

C. eosin staining: putting the slices into gradient alcohol of 85% and 95% in sequence for dehydration, and then adding into eosin dye solution for dyeing for 5 min;

D. dewatering and sealing: placing the slices in anhydrous ethanol I for 5min, adding anhydrous ethanol II for 5min, adding anhydrous ethanol III for 5min, soaking in xylene I for 5min, making xylene II transparent for 5min, and sealing with neutral gum.

E. And (5) microscopic examination is carried out under a microscope, and an image analysis result is collected.

The results are shown in FIG. 5, and it can be seen from the figure that the overexpression of RFPL1S-201 can obviously inhibit liver metastasis of ovarian cancer cells and prolong the survival rate of mice.

Example 7

10mL of SKOV3 cell supernatant 48h after transient transfection of control plasmid PCDNA3.1 and LncRNA RFPL1S-201 plasmid was taken and placed in Millipore ultrafiltration centrifuge tubes at 4000g 10min 4 ℃ and supernatant fluid (about 1mL) was sampled.

1) Reagents and samples were prepared according to the Human IFN-. beta.ELISA Kit (FMS-ELH201) instructions;

2) respectively adding 100ul of the specimen and standard substances with different concentrations into corresponding holes, sealing the reaction holes with sealing plate gummed paper, and incubating at 37 deg.C for 90 min;

3) throwing out liquid in the holes, adding 350ul of washing liquid in each hole, standing for 30min, then throwing out the liquid, and patting on thick absorbent paper to dry

4) Biotinylated antibody working solution (100. mu.l/well) was added. Sealing the reaction hole with sealing plate gummed paper, incubating at 37 deg.C for 60 min

5) The plate was washed 4 times.

6) Add the enzyme conjugate working solution (100. mu.l/well). Sealing the reaction hole with a sealing plate gummed paper, and incubating for 30 minutes at 37 DEG C

7) The plate was washed 4 times.

8) Adding 100 mul/hole of color developing agent, shading, and incubating in incubator at 37 ℃ for 10-20 minutes.

9) Add stop solution 100. mu.l/well and measure OD450 values (within 5 min) immediately after mixing.

The results are shown in FIG. 6G, from which it can be seen that over-expression of RFPL1S-201 can significantly inhibit IFN- β secretion.

Sequence listing

<110> Nanjing City health care hospital for women and children

Application of <120> RFPL1S-201 in preparation of medicine for inhibiting proliferation, invasion and/or metastasis of ovarian cancer

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

catttgccaa gcacagaacc a 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcccctcagc tcatggtcta 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agcgagcatc ccccaaagtt 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gggcacgaag gctcatcatt 20

Claims

1. The application of an expression plasmid for over-expressing RFPL1S-201 in preparing a medicament for inhibiting ovarian cancer proliferation, invasion and/or metastasis, wherein the RFPL1S-201 is numbered ENST00000419368.1 in a UCSC database.

2. The use according to claim 1, characterized in that the expression plasmid overexpressing RFPL1S-201 is used in the preparation of a medicament for inhibiting ovarian cancer proliferation, invasion and/or liver metastasis.

3. The use of claim 1 or 2, wherein the expression plasmid overexpressing RFPL1S-201 is prepared by ligating LncRNA RFPL1S-201 to the NheI/NotI site of pcDNA3.1(+) in full length.