CN111979204B - Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application - Google Patents
Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application Download PDFInfo
- Publication number
- CN111979204B CN111979204B CN201910441406.6A CN201910441406A CN111979204B CN 111979204 B CN111979204 B CN 111979204B CN 201910441406 A CN201910441406 A CN 201910441406A CN 111979204 B CN111979204 B CN 111979204B
- Authority
- CN
- China
- Prior art keywords
- vaccinia virus
- gene
- avl
- oncolytic vaccinia
- sponge
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/768—Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24032—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24051—Methods of production or purification of viral material
- C12N2710/24052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
Abstract
The application relates to the technical field of biomedical engineering, and provides an oncolytic vaccinia virus carrying a sponge lectin gene, a construction method and application thereof, wherein the DNA sequence of the sponge lectin gene is shown as SEQ ID NO. 1. The construction method of the recombinant oncolytic vaccinia virus comprises two steps: (A) Inserting the gene sequence of AVL into pCB plasmid through Xba I and Bgl II sites to obtain pCB-AVL plasmid; (B) The pCB-AVL plasmid and vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the sponge lectin gene. The oncolytic vaccinia virus oncoVV-AVL has remarkable in-vitro inhibition effect on breast cancer cells, liver cancer cells, colorectal cancer cells and glioma cells, is dose-dependent, and has remarkable treatment effect on various tumor animal models, so that the anti-tumor capability of the oncolytic vaccinia virus in tumor-bearing mice is remarkably improved.
Description
Technical Field
The application relates to the technical field of biological medicine, in particular to an oncolytic vaccinia virus carrying a sponge lectin gene, a construction method and application thereof.
Background
Oncolytic viruses are therapeutically valuable viruses that are capable of selectively infecting and damaging tumor tissue. Since the first report in 1991 that Thymidine Kinase (TK) deleted herpes simplex virus (Herpes simplex virus, HSV) was used to treat murine glioblastoma, at least 10 oncolytic viruses belonging to the viral family have been entered into clinical trials, including adenoviruses (Adenovirus), coxsackie viruses (coxsackie viruses), herpes simplex viruses, measles viruses (Measles viruses), newcastle disease viruses (Newcastle disease virus), parvoviruses (parvoviruses), polioviruses (polioviruses), reoviruses (reoviruses), vaccinia viruses (vaccina viruses) and vesicular stomatitis viruses (Vesicular stomatitis virus). In general, oncolytic viruses exhibit considerable safety and efficacy in clinical trials.
Vaccinia virus is a double-stranded DNA virus with a coating, and is an ideal oncolytic virus vector because of its stability in systemic administration, rapid replication and spread within tumors, large capacity of foreign genes, and safety demonstrated by many years of use as a vaccine for smallpox elimination. Oncolytic vaccinia virus (oncolytic vacciniavirus, oncoVV) teams entering preclinical and clinical trials are growing.
Most of the common oncolytic vaccinia viruses at present are subjected to attenuation modification, including Thymine Kinase (TK) gene deletion or TK/vaccinia virus growth factor gene double deletion virus strains and the like. Deletion of the TK gene makes replication of vaccinia virus more dependent on intracellular TK levels, whereas cancer cells tend to have higher levels of TK than normal cells; in addition, vaccinia virus replication also relies on the driving of the EGFR/Ras pathway, which makes it highly selective for cancer cells. Several features of vaccinia viruses also contribute to their spread among cancer tissues, for example, the envelope of extracellular vaccinia viruses helps spread widely and resist attack by neutralizing antibodies, while the actin tail of intracellular vaccinia viruses helps the virus enter neighboring cancer cells. Oncolytic vaccinia viruses exhibit the ability to target aggregation to cancerous tissues in both experimental animals and humans.
Sponge lectin (Aphrocallistes vastus lectin, AVL) (GenBank: AJ 276450.1) is a calcium ion dependent C-type lectin having the ability to specifically bind D-galactose (Gundacker, D., S.P.Leys, et al (2001), "Isolation and cloning ofa C-type lectin from the hexactinellid sponge Aphrocallistes vastus: aputative aggregation factor.," Glycobiology 11 (1): 21-29.). Lectins found in sponges are found in anti-HIV application studies. At present, the related research of applying AVL to preparing anti-tumor drugs is not seen, and the research of recombining and synergizing the spongin gene and the oncolytic vaccinia virus to perform anti-tumor is not seen.
Disclosure of Invention
The application aims to solve the technical problems, and achieves better treatment effect on tumor-bearing mice by combining the sponge lectin gene with the oncolytic vaccinia virus, so as to provide the oncolytic vaccinia virus carrying the sponge lectin gene, and a construction method and application thereof.
In a first aspect, the application provides an oncolytic vaccinia virus carrying a spongy lectin gene, wherein the oncolytic vaccinia virus carries the spongy lectin gene, and the DNA sequence of the spongy lectin gene is shown as SEQ ID NO. 1:
atgaaagcactgctgattctgatcggaggcctggctatggcattcgcgatatcactggacacaaatgataaatatgcaaagatggagatggatatggcgactgacattgaggctgacattgaggctgatatcgagataaaatccaattataatatgactgctactcccctggaagacattgacctggaatatgttcacaaagagtgttttccttggggtgtacatgaatattgctacttccctcacataagcgttacatggggagatgctgaaacactttgccaacgttggggaggccatctagcttccatgaacagctatcatgagaggtgctttcttcaccaaaggttacacagacgtccatgttattggattggattcgtagataatagtggtacaaatactggataccaatggactgatgggagcggtggattcactttctggcatggtggacaaccagatcatcgtggaattcaaatgtgcaccagagtcattagtagacatggtacttgggataacattcattgttgggctggtcaaagggttctctgcaaaaagctcctgaggatataa
preferably, the vaccinia virus is the Western Reserve strain, the Tiantan strain, the Wyeth strain, the Copenhagen strain, the Lister strain or the NYCBH strain of vaccinia virus.
Experiments prove that the oncoVV-AVL has remarkable proliferation inhibition effect on breast cancer cells 4T1, liver cancer cells BEL-7404, colorectal cancer cells HCT116 and glioma cells U87MG in vitro (see example 2), and the replication level of the oncolytic vaccinia virus oncoVV-AVL in tumor cells is remarkably higher than that of the control virus oncoVV, which proves that the AVL has a certain promotion effect on the replication of the oncolytic vaccinia virus oncoVV in tumor cells, and the oncogenic cancer cells and the oncolytic cancer cells and the glioma cells cooperate to inhibit the proliferation of the tumor cells (see example 3). In animal experiments, oncoVV-AVL was able to significantly inhibit the growth of colorectal cancer cell mice subcutaneous transplants (see examples 4 and 5).
In a second aspect, the present application provides a method for constructing an oncolytic vaccinia virus carrying a spongosine gene, the method comprising the following two major steps: (A) Inserting the gene sequence of AVL into pCB plasmid through Xba I and Bgl II sites to obtain pCB-AVL plasmid; (B) The pCB-AVL plasmid and vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the sponge lectin gene.
Preferably, in the step (B), the oncoVV-AVL vaccinia virus is obtained by recombination of a vaccinia virus Western Reserve strain and a pCB-AVL plasmid.
In the construction method of the present application, both of the step (A) and the step (B) may be operated by a conventional operation method. In the step (B), during recombination, the vaccinia virus Western Reserve (WR) strain and the pCB-AVL plasmid are recombined in 293A cells, and cell transfection is performed according to the instruction of a kit (Effectene); during screening, screening recombinant virus liquid by taking xanthine, hypoxanthine and mycophenolic acid as screening medicaments, and separating the recombinant virus by a plaque experiment; in the identification, PCR identification is performed by using the characteristics that the wild type virus has an intact TK region but the recombinant virus does not, so as to obtain the purified oncolytic vaccinia virus oncoVV-AVL.
In a third aspect, the application provides the use of an oncolytic vaccinia virus carrying a sponge lectin gene for the manufacture of an antitumor agent.
Preferably, the antitumor drug is a drug for treating breast cancer, liver cancer, colorectal cancer or glioma. According to the description of the embodiments 2 and 3 of the present application, both the sponge lectin gene and the oncolytic vaccinia virus synergistically inhibit proliferation of tumor cells, and the oncolytic vaccinia virus oncoVV-AVL has remarkable in vitro inhibition effect on breast cancer cells, liver cancer cells, colorectal cancer cells and glioma cells and is dose-dependent as detected by an MTT method. Animal experiments prove that the oncoVV-AVL has obvious treatment effect on various tumor animal models, and has obvious effect in animal experiments.
The antitumor drug referred to in the present application, which is a drug having the effect of inhibiting and/or treating tumors, may include a delay in the development of symptoms associated with tumor growth and/or a reduction in the severity of these symptoms, and it further includes a reduction in the symptoms associated with existing tumor growth and prevention of the occurrence of other symptoms, and also a reduction or prevention of metastasis.
In a fourth aspect, the application provides a pharmaceutical composition of oncolytic vaccinia virus carrying a sponge lectin gene, characterized by comprising a pharmaceutically acceptable pharmaceutical carrier.
The recombinant virus and pharmaceutically acceptable auxiliary materials form a pharmaceutical preparation composition, so that the pharmaceutical preparation composition can exert curative effects more stably, and the preparations can ensure the structural integrity of the amino acid core sequence of the bispecific antibody disclosed by the application, and also can protect the multifunctional groups of proteins from degradation (including but not limited to condensation, deamination or oxidation).
In general, liquid formulations can be stored at 2 ℃ to 8 ℃ for at least one year, and lyophilized formulations remain stable at 30 ℃ for at least six months. The preparation can be suspension, water injection, freeze-drying preparation and the like commonly used in the pharmaceutical field.
In the case of administering the recombinant virus and the composition thereof of the present application to animals including humans, the administration amount varies depending on the age and weight of the patient, the nature and severity of the disease, and the administration route, and the results and various conditions of animal experiments may be referred to, and the total administration amount may not exceed a certain range.
The application has the beneficial effects that:
the application provides an oncolytic vaccinia virus carrying a sponge lectin gene, a construction method and application thereof in preparing an anti-tumor medicament, and experiments prove that the oncolytic vaccinia virus oncovV-AVL has remarkable in-vitro inhibition effect on breast cancer cells, liver cancer cells, colorectal cancer cells and glioma cells, is dose-dependent, and has remarkable treatment effect on various tumor animal models. Therefore, the application obviously improves the anti-tumor capability of the oncolytic vaccinia virus in the tumor-bearing mice, is embodied in the aspects of inhibiting the growth of the tumor and prolonging the survival time of the tumor-bearing mice, provides a new target point for the virus treatment of the tumor, and has wide clinical application prospect.
In addition, the preparation method of the recombinant oncolytic vaccinia virus carrying the sponge lectin gene is mature, is suitable for large-scale standardized production, and provides a guarantee for future clinical application.
Drawings
FIG. 1 shows the construction map of pCB-AVL plasmid.
FIG. 2 shows the in vitro inhibition effect of oncoVV-AVL and control virus oncoVV on various tumor cells by MTT method, wherein A is the in vitro inhibition effect on breast cancer cell 4T1, B is the in vitro inhibition effect on liver cancer cell BEL-7404, C is the in vitro inhibition effect on colorectal cancer cell HCT116, and D is the in vitro inhibition effect on glioma cell U87MG.
FIG. 3 shows comparison of replication levels of oncoVV-AVL and control virus oncoVV in tumor cells, wherein A is breast cancer cell 4T1, B is hepatoma cell BEL-7404, C is colorectal cancer cell HCT116, and D is glioma cell U87MG.
FIG. 4 shows the results of comparison of efficacy of oncoVV-AVL and oncoVV-TTL against colorectal carcinoma cell HCT116 mice engraftment tumors, with PBS as a control.
FIG. 5 is a graph showing the comparison of the effects of oncoVV-AVL and oncoVV-GM-CSF on liver cancer cell BEL-7404 cell mice engraftment with PBS as a control.
FIG. 6 shows the result of conserved region analysis of AVL amino acid sequence using NCBI database.
Detailed Description
The following examples and experimental examples are provided to further illustrate the present application and should not be construed as limiting the present application. Examples do not include detailed descriptions of conventional methods, such as PCR methods, those used to construct the carrierMethods of inserting coding genes into such vectors and plasmids or methods of introducing plasmids into host cells. Such methods are well known to those having ordinary skill in the art and are described in numerous publications, including Sambrook, j., fritsch, e.f. and maniis, t. (1989) Molecular Cloning: a Laboratory Manual,2 nd edition，Cold spring Harbor Laboratory Press。
Percentages and parts are by weight unless otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application, and the preferred embodiments described herein are for illustration only.
Example 1: construction and identification of oncolytic vaccinia Virus oncovV-AVL
1. The gene sequence (SEQ ID NO: 1) of sponges lectin (Aphrocallistes vastus lectin, AVL) was inserted into pCB plasmid through Xba I and Bgl II sites to obtain pCB-AVL plasmid.
The plasmid map of pCB-AVL is shown in FIG. 1. Wherein vTK-L and vTK-R insert the foreign gene into the TK region by homologous recombination with the thymidine kinase TK region of the wild-type virus, while causing TK deletion. In addition, the plasmid also carries xanthine guanine phosphotransferase (xanthine-guanine phoshporibosyl transferase, gpt) gene as a screening gene, the gpt gene is derived from Escherichia coli, and in the presence of mycophenolic acid (MPA), viruses or cells die because MPA can block guanine synthesis, and thus the synthesis of nucleic acid of the viruses or cells cannot be normally performed. In the presence of gpt gene, the cell or virus can synthesize guanine by alternative routes using hypoxanthine (hypoxanthine) and xanthine (xanthine), so that nucleic acid synthesis is not limited.
2.The recombination of the Western Reserve (WR) strain vaccinia virus and pCB-AVL plasmid proceeds as follows:
(1) At an area of 6cm 2 Appropriate numbers of 293A cells were inoculated into the dishes of (E) to allow for 80-90% sheeting the next day.
(2) Removing the culture solution, gently adding 1mL of virus solution (0.05-0.1 MOI, diluting the virus solution with 2% serum-containing medium) along the side wall, standing at 37deg.C, and 5% CO 2 Culturing in an incubator for 2-4 hours, and shaking uniformly every 15min to prevent the cells from dying locally.
(3) Cell transfection was performed according to the kit (effect) instructions, as follows:
1. Mu.g of pCB-AVL was supplemented with buffer EC to 150. Mu.L, and 8. Mu.L of enhancement buffer was added, respectively, and the mixture was shaken for 1s and allowed to stand at room temperature for 5min. 25 mu L of Effectene buffer is added into the three mixtures respectively, the mixture is mixed for 5 times in a reverse way, the mixture is oscillated for 10s and kept stand for 5 to 10min at room temperature, and then 1mL of fresh culture solution (which can contain serum and antibiotics) is added into the mixture respectively, and the mixture is inverted for two times.
At the same time, the virus solution in step 2 was discarded, 4mL of 10% FBS fresh culture solution was added, and the mixed transfection solutions were added thereto, respectively, and then the culture dish was placed at 37℃with 5% CO 2 After culturing for 6-18 hours in the incubator, the culture solution is sucked, washed once by PBS, and 5mL of fresh culture solution is added for continuous culturing.
(4) After the cells are completely diseased, collecting virus liquid in a biosafety cabinet, subpackaging the virus liquid into a centrifuge tube, marking the centrifuge tube, repeatedly freezing and thawing the centrifuge tube for three times at-80 ℃ and 37 ℃, thoroughly lysing the cells to release the virus, centrifuging at 2000rmp for 5min, collecting the supernatant, and storing the supernatant in an ultralow temperature refrigerator at-80 ℃ for later use.
3. Screening recombinant viruses, comprising the following steps:
(1) 293A cells with good growth state are inoculated in a culture dish, and the next day cell density can reach about 80% -90%.
(2) Three screening drugs were prepared: xanthine, hypoxanthine, mycophenolic acid.
(3) 500. Mu.L of the previously packaged virus solution was carefully added to the side wall of each dish in (1), and the mixture was placed at 37℃with 5% CO 2 Culturing in an incubator for 2-4h; after about 2-4h, the suspended virus solution was removed and 3mL of fresh culture solution containing 7.5. Mu.L of (1X) mycophenolic acid, 75. Mu.L of (1X) xanthine and 7.5. Mu.L of (1X) xanthine was added) Hypoxanthine.
(4) And observing cytopathic conditions every day, collecting all cytopathic cell sap in a biosafety cabinet after about two or three days, repeatedly freezing and thawing for three times, and storing in an ultralow temperature refrigerator at-80 ℃ for standby.
(5) The virus liquid collected each time is screened repeatedly for 3-4 times according to the method.
4. Virus plaque and identification
(1) Preparing 5% low melting point glue: 0.25g of the low-melting-point glue is weighed and dissolved in 5mL of PBS, and the mixture is autoclaved for 20min at 121 ℃, and then stored in a refrigerator at 4 ℃ for standby.
(2) Inoculating 293A cells in good condition into six-hole plate, and when cell density reaches about 90% the next day, mixing virus liquid according to 10 -4 ～10 -6 Serial dilution is carried out in a gradient way, then old culture solution in a six-hole plate is discarded, 1mL of diluted virus solution is added into each hole to enable virus to be adsorbed, the mixture is placed into an incubator to be cultured for 2 to 4 hours, and then the boiled low-melting-point glue is placed into a water bath kettle with the temperature of 40 ℃ to be kept warm; then placing into an ultra clean bench, adding three times volume of DMEM culture solution to make its final concentration be 1.25%, quickly mixing uniformly by using a pipette and quickly sucking away the suspended virus solution in the plate by using a pipette, then carefully adding 2mL of culture solution containing 1.25% of low-melting-point glue along the side wall by using a pipette, taking care not to blow up the cells, then placing it at 37 deg.C and 5% CO 2 Is cultured in a cell culture box.
(3) Observing cytopathy condition under inverted microscope every day, if isolated virus plaque appears, picking it up and placing it in 12-well plate with 293A cells laid in advance, marking, placing it at 37deg.C, 5% CO 2 After the cell culture box is fully diseased, collecting the virus liquid in a 1.5mL centrifuge tube in a safety cabinet, and storing in an ultralow temperature refrigerator at-80 ℃ for further identification.
(4) PCR identification (self-identification) was performed using features of the wild-type virus with the complete TK region but not the recombinant virus, to obtain purified oncolytic vaccinia virus oncoVV-AVL.
Example 2: MTT method for detecting in vitro inhibition effect of oncoVV-AVL on various tumor cells
The experiment selects breast cancer cell 4T1, liver cancer cell BEL-7404, colorectal cancer cell HCT116 and glioma cell U87MG according to 5×10 respectively 3 The wells were inoculated into 96-well plates at a density of 90. Mu.L of cell culture medium per well for overnight incubation, 1, 2, 5 or 10MOI oncovV-AVL virus or control virus oncovV was added, 6 duplicate wells were set, experimental control was cells without virus, and blank was culture medium without cells.
37℃，5％CO 2 After 72 hours of incubation, 20. Mu.L of MTT solution (5 mg/mL) was added per well in the dark. The incubator was left to stand for 4 hours, after the culture liquid of each tissue was sucked off, 150. Mu.L of dimethyl sulfoxide was added to each well, and the mixture was put on a shaker for shaking for 10 minutes to sufficiently dissolve the crystals. And (3) measuring an OD value on an ELISA (enzyme-linked immunosorbent assay) with a detection wavelength of 490nm.
Cell viability was calculated from the OD values measured as: cell viability = (treatment OD value-zeroed OD value)/(control OD value-zeroed OD value) ×100%.
As shown in fig. 2, oncoVV-AVL significantly inhibited proliferation of various tumor cells in vitro, and the tumor-inhibiting effect was significantly better than that of the control virus oncoVV.
Example 3: replication levels of oncolytic vaccinia virus oncoVV-AVL in tumor cells were significantly higher than control virus oncoVV
Breast cancer cell 4T1, liver cancer cell BEL-7404, colorectal cancer cell HCT116 or glioma cell U87MG are prepared according to the ratio of 5×10 3 Density of wells/wells were seeded into 96-well plates, each well was incubated overnight with 90. Mu.L of cell culture broth, 5MOI oncoVV-AVL virus or control virus oncoVV, respectively, and 3 or more replicate wells were set per time gradient. Cells were collected together with culture medium and the replication efficiency of oncoVV-AVL and control virus oncoVV in tumor cells was examined by TCID50 method (half the amount of tissue culture infection).
The detection results are shown in fig. 3: compared with the control group, the replication efficiency of the oncoVV-AVL virus of the experimental group in tumor cells is obviously higher than that of the control virus oncoVV.
Example 4: oncoVV-AVL significantly inhibited the growth of colorectal cancer cell mice subcutaneously transplanted tumors
Female BALB/c nude mice of 4 weeks old were selected and injected subcutaneously at their forelimb axillary extremities with 8X 10 6 HCT116 colorectal cancer cells per 100. Mu.L, to a tumor volume greater than 100mm 3 When it is grouped uniformly by volume: PBS group, oncovV-TTL (an oncolytic vaccinia virus carrying the horseshoe crab lectin Tachypleus tridentatus Lectin gene constructed previously for this study group: li, G., J.Cheng, et al (2018), "Tachypleus tridentatus Lectin Enhances Oncolytic Vaccinia Virus Replication to Suppress In Vivo Hepatocellular Carcinoma growth.," Marine Drugs 16 (6)) group, oncovV-AVL group, each of 6-8 nude mice. After the grouping, the oncoVV-AVL group and the oncoVV-TTL group nude mice were injected intratumorally 1X 10 7 PFU virus, PBS control group was intratumorally injected with 100 μlpbs. Tumor volumes were measured periodically, calculated: tumor volume (mm) 3 ) = (length x width 2 )/2。
As shown in fig. 4: oncoVV-AVL treatment significantly inhibited tumor growth compared to PBS control and oncoVV-TTL. Furthermore, oncoVV-TTL did not show significant therapeutic effects on colorectal cancer animal models.
Example 5: oncoVV-AVL significantly inhibited the growth of subcutaneous transplantation tumor in hepatoma cell mice
Female BALB/c nude mice of 4 weeks old were selected and injected subcutaneously at their forelimb axillary extremities with 8X 10 6 BEL-7404 liver cancer cell of 100 mu L/100 mu L, when tumor volume is 120mm 3 When the method is used for left and right sides, the method is divided into groups according to the volume size uniformity: PBS group, oncovV-GM-CSF group, oncovV-AVL group, 6-8 nude mice each.
oncoVV-GM-CSF is similar to the oncolytic vaccinia virus drug Pexa-Vec (previously known as JX-594) that has entered clinical stage III, and is self-constructed according to literature reports (parao, K.A., C.J.Breitbach, et al 2012.The oncolytic poxvirus JX-594 selectively replicates in and destroys cancer cells driven by genetic pathways commonly activated in cancers.Mol Ther 20 (4): 749-758.). After the grouping, the nude mice of the oncoVV-AVL group and the oncoVV-GM-CSF group were injected intratumorally 1×10 7 PFU virus, PBS control group intratumorally injected with 100. Mu.L PBS. Tumor volumes were measured periodically, calculated: tumor volume (mm) 3 ) = (length x width 2 )/2。
As shown in fig. 5: oncoVV-AVL treatment significantly inhibited tumor growth compared to PBS control and was superior to oncoVV-GM-CSF.
Example 6: conserved domain analysis of AVL
The amino acid sequence of AVL was analyzed using the conserved domain database (Conserved Domain Database, CDD) of the national center for biotechnology information (National Center for Biotechnology Information, NCBI) to obtain conserved domain information of AVL.
The results are shown in FIG. 6: the AVL protein contains 1 conserved domain, a C-type lectin-like domain located at amino acids 77-187.
While the preferred embodiments of the present application have been described in detail, the present application is not limited to the embodiments, and various equivalent modifications and substitutions can be made by those skilled in the art without departing from the spirit of the present application, and these equivalent modifications and substitutions are intended to be included in the scope of the present application as defined in the appended claims.
Sequence listing
<110> Hangzhou Chao biotechnology Co., ltd
<120> oncolytic vaccinia virus harboring the spongy lectin gene, construction method and use
<130> claim specification
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 576
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atgaaagcac tgctgattct gatcggaggc ctggctatgg cattcgcgat atcactggac 60
acaaatgata aatatgcaaa gatggagatg gatatggcga ctgacattga ggctgacatt 120
gaggctgata tcgagataaa atccaattat aatatgactg ctactcccct ggaagacatt 180
gacctggaat atgttcacaa agagtgtttt ccttggggtg tacatgaata ttgctacttc 240
cctcacataa gcgttacatg gggagatgct gaaacacttt gccaacgttg gggaggccat 300
ctagcttcca tgaacagcta tcatgagagg tgctttcttc accaaaggtt acacagacgt 360
ccatgttatt ggattggatt cgtagataat agtggtacaa atactggata ccaatggact 420
gatgggagcg gtggattcac tttctggcat ggtggacaac cagatcatcg tggaattcaa 480
atgtgcacca gagtcattag tagacatggt acttgggata acattcattg ttgggctggt 540
caaagggttc tctgcaaaaa gctcctgagg atataa 576
Claims (6)
1. The application of the oncolytic vaccinia virus carrying the sponge lectin gene in preparing the antitumor drug is characterized in that the DNA sequence of the sponge lectin gene is shown as SEQ ID NO. 1, and the antitumor drug is a drug for treating breast cancer, liver cancer, colorectal cancer or glioma.
2. Use of an oncolytic vaccinia virus carrying a spongin gene according to claim 1 for the preparation of an antitumor drug, characterized in that:
wherein the vaccinia virus is a vaccinia virus Western Reserve strain, a vaccinia virus Tiantan strain, a vaccinia virus Wyeth strain, a vaccinia virus Copenhagen strain, a vaccinia virus Lister strain or a vaccinia virus NYCBH strain.
3. Use of an oncolytic vaccinia virus carrying a spongin gene according to claim 1 or 2 for the preparation of an antitumor drug, characterized in that the construction method comprises the steps of:
(A) Inserting the gene sequence of the sponge lectin into the pCB plasmid through Xba I and Bgl II sites to obtain pCB-AVL plasmid;
(B) The pCB-AVL plasmid and the vaccinia virus are subjected to intracellular recombination, screening and identification to obtain the oncolytic vaccinia virus carrying the spongy lectin gene.
4. Use of an oncolytic vaccinia virus carrying a spongin gene according to claim 3 for the preparation of an antitumor drug, characterized in that:
wherein, the step B is recombination of vaccinia virus Western Reserve strain and pCB-AVL plasmid, and the oncoVV-AVL vaccinia virus is constructed and obtained.
5. Use of an oncolytic vaccinia virus carrying a spongin gene according to claim 1 for the preparation of an antitumor drug, characterized in that:
wherein the antitumor drug is a pharmaceutical composition comprising an oncolytic vaccinia virus carrying a spongosine gene as the sole active ingredient or comprising an oncolytic vaccinia virus carrying a spongosine gene.
6. The pharmaceutical composition containing the oncolytic vaccinia virus carrying the sponge lectin gene is characterized by taking the oncolytic vaccinia virus carrying the sponge lectin gene as an active ingredient and further comprising a pharmaceutically acceptable pharmaceutical carrier, wherein the DNA sequence of the sponge lectin gene is shown as SEQ ID NO. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910441406.6A CN111979204B (en) | 2019-05-24 | 2019-05-24 | Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910441406.6A CN111979204B (en) | 2019-05-24 | 2019-05-24 | Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111979204A CN111979204A (en) | 2020-11-24 |
| CN111979204B true CN111979204B (en) | 2023-10-13 |
Family
ID=73436765
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910441406.6A Active CN111979204B (en) | 2019-05-24 | 2019-05-24 | Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111979204B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199628A (en) * | 2002-05-16 | 2011-09-28 | 巴法里安诺迪克有限公司 | Recombinant poxvirus expressing homologous genes inserted into the poxviral genome |
| WO2013038066A1 (en) * | 2011-09-16 | 2013-03-21 | Oncos Therapeutics Ltd. | Modified oncolytic vaccinia virus |
-
2019
- 2019-05-24 CN CN201910441406.6A patent/CN111979204B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199628A (en) * | 2002-05-16 | 2011-09-28 | 巴法里安诺迪克有限公司 | Recombinant poxvirus expressing homologous genes inserted into the poxviral genome |
| WO2013038066A1 (en) * | 2011-09-16 | 2013-03-21 | Oncos Therapeutics Ltd. | Modified oncolytic vaccinia virus |
Non-Patent Citations (3)
| Title |
|---|
| D Gundacker 等."Isolation and cloning of a C-type lectin from the hexactinellid sponge Aphrocallistes vastus: a putative aggregation factor".《Glycobiology》.2001,第11卷(第1期),摘要部分、图3B、第21页第2段. * |
| 段雪梅."溶瘤痘苗病毒携带SPL/PPA凝集素基因的抗癌研究".《中国优秀硕士学位论文全文数据库 医药卫生科技辑》.2015,第3页第1段至第6页最后1段，第8页第2行. * |
| 高亚军."细胞内表达人源C-型凝集素2A(CLEC2A)基因抗肿瘤的机制研究".《中国优秀硕士学位论文全文数据库 医药卫生科技辑》.2016,参见第1.2.1节、第3.3.2-3.3.3节、第3.5.1节、第2.1.5节、第2.2.4节、第3.5.1节. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111979204A (en) | 2020-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128550B (en) | Novel replicative oncolytic adenovirus capable of simultaneously blocking immune check points PD-L1 and TIGIT and application | |
| US11806374B2 (en) | Isolated recombinant oncolytic adenoviruses, pharmaceutical compositions, and uses thereof for drugs for treatment of tumors and/or cancers | |
| US20200289591A1 (en) | Isolated Recombinant Oncolytic Poxvirus, Pharmaceutical Composition, and Use Thereof in Treatment of Tumors and/or Cancer | |
| RO117861B1 (en) | Nucleic acid complex and composition for inserting the same into higher eukaryotic cells | |
| JP7374527B2 (en) | Genetically modified mesenchymal stem cells expressing α1-antitrypsin (AAT) | |
| CN110325200A (en) | Therapeutic agent and its application in the drug for the treatment of tumour and/or cancer | |
| CN111606999A (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signal pathway and blocking immune check point and application thereof | |
| EA012520B1 (en) | Process for producing cytotoxic lymphocytes | |
| JP2003531605A (en) | Viral clearance of neoplastic cells from mixed cellular compositions | |
| US20220275370A1 (en) | Striatin interacting protein inhibitor and use thereof in preparation of anti-tumor drug | |
| CN111979204B (en) | Oncolytic vaccinia virus carrying sponge lectin gene, construction method and application | |
| CN110564700B (en) | Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application | |
| Wang et al. | Thymosin beta-4 recombinant adeno-associated virus enhances human nucleus pulposus cell proliferation and reduces cell apoptosis and senescence | |
| US20060166924A1 (en) | Gene therapeutics | |
| US20200123204A1 (en) | Recombinant oncolytic viruses for treatment of metastatic cancers | |
| CN113755455B (en) | Oncolytic vaccinia virus carrying SIKE gene, construction method and application | |
| CN111979203B (en) | Oncolytic vaccinia virus carrying CTTNBP2NL gene, construction method and application in preparation of antitumor drugs | |
| CN1952160B (en) | Recombinant of intelligent adenovirus vector and khp53 gene and application thereof | |
| CN114712393B (en) | Application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer | |
| WO2017167209A1 (en) | Trail-secreting mesenchymal stem cells and use thereof to treat brain tumors | |
| CN1970774A (en) | Porcine alpha-interferon recombinant adenovirus and its construction method and application | |
| JP2022524379A (en) | Syncytial oncolytic herpes simplex mutant as a powerful cancer treatment | |
| TWI320056B (en) | Virus clearance of neoplastic cells from mixed cellular compositions | |
| JP2022541293A (en) | p21-expressing monocytes for cancer cell therapy | |
| CN114075573A (en) | Engineered hepatocytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |