CN114712393B

CN114712393B - Application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer

Info

Publication number: CN114712393B
Application number: CN202011501851.6A
Authority: CN
Inventors: 卫立辛; 宗晨; 韩志鹏; 杨雪; 叶菲
Original assignee: Third Affiliated Hospital Of Chinese People's Liberation Army Naval Medical University
Current assignee: Third Affiliated Hospital Of Chinese People's Liberation Army Naval Medical University
Priority date: 2020-12-18
Filing date: 2020-12-18
Publication date: 2024-01-19
Anticipated expiration: 2040-12-18
Also published as: CN114712393A

Abstract

The invention provides application of a hepatocyte nuclear factor-1 alpha (Hepatocyte nuclear factor, hnf-1 alpha) gene modified mesenchymal stem cell in preventing and treating liver cancer and other diseases. The modified cells have the functions of inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation; the inhibition includes prophylaxis or treatment. The invention provides a new clinical treatment way for preventing and treating diseases such as liver cancer, is hopeful to be used for preventing and treating postoperative recurrence of liver cancer patients, and has good development prospect.

Description

Application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer

Technical Field

The invention belongs to the field of biotechnology; more specifically, the invention relates to the application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver diseases such as liver cancer, and in particular provides a stem cell treatment scheme for preventing early postoperative recurrence and metastasis of liver cancer.

Background

Cancer remains a difficult disease to combat in humans. With advances in medicine, although surgery, chemotherapy, and radiation have been used with some success to cure (cure) cancers, new strategies are still needed.

Primary liver cancer (Primary hepatocellular carcinoma, PHC) is a common malignant tumor at position 5 and cancer cause of death at position 3 worldwide, the number of new liver cancer cases per year is about 55 ten thousand worldwide, and the incidence rate of the primary liver cancer has increased in recent years. China is a disaster area for liver cancer incidence, and the number of death caused by liver cancer is about 20 ten thousand per year. The best treatment means for early liver cancer is radical surgical excision. However, the postoperative recurrence and metastasis of liver cancer patients are very easy to occur, the recurrence rate of three years after the operation is about 40% -50%, and the recurrence rate of five years after the operation is 60% -70%.

Once recurrence of liver cancer occurs, a variety of follow-up means are clinically employed. Comprising the following steps: surgical excision is performed again, the operation can treat recurrent tumor, but the recurrent liver cancer focus is usually more than one, and the liver cancer can recur at multiple parts and liver segments; the liver is difficult to be resected in a large area in the secondary operation, and is also difficult to be resected cleanly; the second scheme is minimally invasive treatment, such as hepatic arterial chemoembolization, on the basis of which a chemotherapeutic drug is infused into the tumor by using iodized oil, and tumor cells are specifically killed; chemical ablation, usually under the guidance of B-ultrasonic or CT, is to inject absolute alcohol into the tumor to rapidly dehydrate the cells and denature and solidify proteins, so as to kill the tumor cells, but the current application of the method is relatively less; physical ablation, including radio frequency ablation and microwave ablation, kills tumor cells under the guidance of B ultrasonic or CT through the heat generation effect of the puncture needle; and more common radiotherapy and chemotherapy with different curative effects.

The above-mentioned conventional treatment schemes, although possibly improving the survival rate and quality of life of the patient to some extent, inevitably cause secondary wounds and damages to the patient; therefore, there is a need in the art to develop new treatments or adjuvant treatments that are intended to directly inhibit recurrence of liver cancer after surgery.

Disclosure of Invention

The invention aims to provide application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver diseases such as liver cancer.

In a first aspect of the invention there is provided the use of a recombinant mesenchymal stem cell or a culture thereof in the preparation of a composition for use in: inhibiting liver cancer, inhibiting liver fibrosis, repairing liver damage, and/or inhibiting inflammation, including prophylaxis or treatment; wherein the recombinant mesenchymal stem cell is a mesenchymal stem cell expressing exogenous hepatocyte nuclear factor 1 alpha (Hnf-1 alpha).

In a preferred embodiment, the expression is high or over-expression.

In another preferred embodiment, an expression construct comprising an expression cassette for hepatocyte nuclear factor 1 alpha is introduced into said mesenchymal stem cells.

In another preferred embodiment, the expression construct (expression vector) comprises: viral vectors, non-viral vectors.

In another preferred embodiment, the expression vector comprises a vector selected from the group consisting of: adenovirus vectors, lentiviral vectors or adeno-associated virus vectors.

In another preferred embodiment, the expression vector is an adenovirus vector.

In another preferred example, the mesenchymal stem cells include (but are not limited to) mesenchymal stem cells of a source selected from the group consisting of: bone marrow, umbilical cord, fat, cord blood, placenta, dental pulp, and endometrium.

In another preferred embodiment, the liver cancer comprises: primary liver cancer, liver cancer recrudescing after liver cancer operation, liver cancer with inflammation environment.

In another preferred embodiment, the composition is further used for: reduces hepatic stellate cell activation.

In another preferred embodiment, the composition is further used for: reducing infiltration of inflammatory cells in liver tissue.

In another preferred embodiment, the composition is further used for: reduce the level of pro-inflammatory factors in serum.

In another preferred embodiment, the pro-inflammatory factor comprises TNF- α, IFN- γ, IL-4 or IL-6.

In another preferred embodiment, the composition is further used for: an index of decreasing liver function in serum, the index comprising: glutamic pyruvic transaminase (ALT), glutamic oxaloacetic transaminase (AST), total Bilirubin (TBIL), and bound bilirubin (DBIL) content.

In another aspect of the invention, a recombinant mesenchymal stem cell or cell culture is provided, the cell comprising exogenous hepatocyte nuclear factor 1α.

In a preferred embodiment, introducing an expression construct comprising an expression cassette for hepatocyte nuclear factor 1 alpha into said mesenchymal stem cells to obtain said recombinant mesenchymal stem cells; preferably, the expression construct (expression vector) comprises: viral vectors, non-viral vectors; more preferably, the expression vector comprises a sequence selected from the group consisting of: adenovirus vectors, lentiviral vectors or adeno-associated virus vectors; more preferably, the expression vector is an adenovirus vector.

In another aspect of the present invention, there is provided a method for preparing a recombinant mesenchymal stem cell, comprising expressing exogenous hepatocyte nuclear factor 1α in the mesenchymal stem cell; the recombinant mesenchymal stem cells are cells for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation, and the inhibition comprises prevention or treatment.

In another aspect of the present invention, there is provided a composition for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver damage and/or inhibiting inflammation comprising the recombinant mesenchymal stem cells or cell culture described above, and a pharmaceutically acceptable carrier, said inhibiting comprising preventing or treating.

In another aspect of the present invention, there is provided the use of hepatocyte nuclear factor 1 alpha for the preparation of recombinant mesenchymal stem cells having the effect of inhibiting liver cancer, inhibiting liver fibrosis, repairing liver damage and/or inhibiting inflammation, said inhibition comprising prophylaxis or treatment.

In another aspect of the invention, there is provided a kit for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver damage and/or inhibiting inflammation, said inhibition comprising prophylaxis or treatment, said kit comprising said recombinant mesenchymal stem cells or cell culture, or said composition.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1 is a diagram showing the results of isolation and identification of primary mesenchymal stem cells of rat bone marrow and detection of successful preparation of Hnf-1 alpha over-expressed mesenchymal stem cells;

a: primary rat MSCs are isolated and cultured and identified by adipogenic osteogenic differentiation;

B-C: and (5) identifying the transfection efficiency and transfection effect of the Hnf-1 alpha over-expressed adenovirus in MSCs.

FIG. 2 is a study of the effect of Hnf-1 alpha gene modified MSCs on DEN-induced development of primary liver cancer in rats;

a: survival curves of DEN cancer-induced rats after different MSCs are dried;

b: tumor formation of rat liver and HE staining results;

c: number of liver tumors in rats of different treatment groups.

FIG. 3 is a graph showing the effect of Hnf-1. Alpha. Genetically modified mesenchymal stem cells on DEN-induced liver injury repair;

a: detecting serum transaminase and bilirubin of rats in different treatment groups in the tissue metamorphosis period before liver cancer occurs;

b: and detecting the expression of sirius red and alpha-SMA in the liver of rats in different treatment groups before the occurrence of liver cancer.

FIG. 4 shows the effect of Hnf-1 alpha gene modified mesenchymal stem cells on liver inflammatory response during liver cancer;

a: the HE staining results of the liver slices of the rats in different treatment groups in the tissue metamorphosis period before the liver cancer occurs;

b: detection of inflammatory factors in serum of rats of different treatment groups in the tissue metamorphosis period before liver cancer occurs.

FIG. 5 shows the effect of HNF-1A gene modified human umbilical cord derived MSCs infused at the early stage of DEN induced cancer on inhibiting the development of DEN induced liver cancer;

a: tumor formation of rat liver and HE staining results;

b: maximum tumor volume of liver of rats in different treatment groups.

Detailed Description

The present inventors have conducted intensive studies and have revealed that mesenchymal stem cells (mesenchymal stem cells, MSCs) modified with hepatocyte nuclear factor 1α (Hepatocyte nuclear factor, hnf-1α) have the effects of inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation, including prevention or treatment. The invention provides a new clinical treatment way for preventing and treating diseases such as liver cancer, is hopeful to be used for preventing and treating postoperative recurrence of liver cancer patients, and has good development prospect.

Terminology

As used herein, the term "exogenous" or "heterologous" refers to a relationship between two or more nucleic acid or protein (polypeptide) sequences from different sources, or a relationship between a nucleic acid or protein from different sources and a host cell. For example, if the combination of nucleic acid/protein and host cell is not normally naturally occurring, the nucleic acid is exogenous to the host cell. The particular sequence is "exogenous" to the cell or organism into which it is inserted.

As used herein, the term "expression cassette" refers to a gene expression system comprising all the necessary elements necessary for expression of a gene of interest, typically including the following elements: a promoter, a target gene sequence, and a terminator; in addition, signal peptide coding sequences and the like can be optionally included. These elements are operatively connected.

As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule that comprises a desired nucleic acid coding sequence, which may comprise one or more gene expression cassettes. The "construct" is typically contained in an expression vector.

As used herein, the terms "operably linked" or "operably linked" refer to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: the promoter region is placed in a specific position relative to the nucleic acid sequence of the gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region, whereby the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the term "comprising" means that the various ingredients may be applied together in a mixture or composition of the invention. Thus, the terms "consisting essentially of and" consisting of are encompassed by the term "containing. As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in and acceptable to a human and/or animal.

As used herein, a "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), commensurate with a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

Mesenchymal stem cells

Inflammation is one of the most important factors responsible for tumorigenesis or promoting tumor progression, and about 20% of malignant tumors are induced or promoted by inflammation. Hepatitis B virus carriers in China are nearly one hundred million, and most liver cancer patients develop from hepatitis. According to the "seed and soil" theory, the local microenvironment of the recurrent transfer target organ is one of the determining factors that influence whether recurrent transfer occurs.

The analysis of the present inventors proves that, after surgical excision of liver cancer in early stage, liver cancer is very susceptible to recurrent metastasis if the cause of liver injury is not removed and the liver is still in chronic inflammatory injury state. Such as weakening the inflammatory state of the target organ that favors metastasis formation, while the occurrence of metastasis can be reduced. The transfer recurrence after liver cancer operation mostly occurs in the residual liver after operation, so the inflammatory immune microenvironment state of the liver is a key factor affecting the prognosis of patients after liver cancer operation. The postoperative recurrence of liver cancer is caused by the selective expansion of disseminated tumor cells by residual liver after operation to form recurrent foci, or by the selective expansion of newly mutated cells to form new liver cancer foci. The inflammatory state of the residual liver after liver cancer operation is inversely related to the regeneration capacity, and the heavier the inflammatory response is, the worse the regeneration capacity is, and the more easily the tumor recurrence focus is formed. Thus, the inventors believe that treatment against liver inflammation helps to inhibit tumor recurrence and metastasis.

MSCs are a population of adult stem cells derived from mesoderm that have a high self-renewal capacity and multipotent differentiation potential. The method is relatively easy to obtain, the in vitro amplification culture technology is mature, and a certain research is clinically carried out at present, for example, the method is used for treating GvHD, autoimmune diseases, inflammation-related liver and kidney injury and other diseases.

Unlike traditional chemicals, MSCs are a living cell that interacts with the environment. Under certain conditions, MSCs may act as pro-inflammatory cells and cross-present soluble foreign antigens as part of their antigen presenting cell characteristics. Interferon-gamma stimulates bone marrow MSCs to up-regulate expression of MHC-II molecules and presents exogenous antigens to T cells. Pig experiments with acute liver failure have found that the severe inflammatory environment limits the effectiveness of MSCs because MSCs have a low survival rate in the severe inflammatory liver environment. MSCs fail to improve survival in patients with chronic acute liver failure with systemic inflammation, but reducing inflammation is clearly beneficial to improving the therapeutic effect of MSCs. In a multicenter clinical study of MSCs to treat childhood hormone refractory GVHD, MSCs are more effective in early intervention than in late treatment. These study data suggest that inflammatory microenvironment characteristics have a significant impact on the therapeutic efficacy of MSCs. More importantly, researches show that when dexamethasone hormone exists in the organism, the immunosuppressive property of MSCs is severely inhibited; the effect of MSCs treatment is also greatly compromised in this case as described above. The in vivo environment is complex, and the functions of MSCs show different effects in different environments. As such, although MSCs are becoming more and more important in clinical applications, most of the results of current clinical trials are not satisfactory for medical use.

In vivo experiments on MSCs show that the MSCs can be infused in early stage of cancer occurrence to relieve inflammatory reaction of liver tissues, and the MSCs have the effect of inhibiting tumor occurrence and development to a certain extent, but the effect is still not very remarkable.

In order to improve the inhibition of tumor by mesenchymal cells, the present inventors conducted extensive analytical studies to analyze a wide variety of genes and finally determined to modify MSCs with Hnf-1 a. MSCs have the characteristic of chemotaxis to the injury part, and under the stimulation of injury inflammation microenvironment, MSCs can play an immunosuppressive role to inhibit the inflammatory reaction of body overstimulation, and after Hnf-1 alpha modifies MSCs, the inhibition effect of MSCs on tumors can be remarkably improved.

In the present invention, MSCs include, but are not limited to, MSCs derived from bone marrow, fat, umbilical cord, cord blood, placenta, pulp, endometrium, etc. In a preferred embodiment of the invention, the MSCs are bone marrow derived MSCs.

Hepatocyte nuclear factor 1 alpha

The hepatocyte nuclear factor 1 alpha (Hepatocyte nuclear factor, hnf-1 alpha) is one of the members of the HNFs family, and plays an important role in promoting liver development and maintaining hepatocyte biological functions, including regulating liver function-related gene expression and participating in glycolipid metabolism and bile acid metabolism, in order to regulate transcription factors for the expression of many liver function genes. Recent studies indicate that HNF-1. Alpha. Exhibits low expression in human liver cancer tissues, but the cause of down-regulation of the expression is still unclear. Among the members of the HNFs family, there is also a class of members, namely HNF-4α. Although HNF-1. Alpha. And HNF-4. Alpha. Belong to the same large family, they are quite different in structure and function: HNF-4α is a zinc finger structural protein, and has the characteristics of a fat-soluble hormone receptor; reports prove that HNF-4 alpha is closely related to the occurrence and development of viral hepatitis; there are also studies that up-regulation of HNF-4 alpha expression is an important signaling event for gastric tumors, and antagonism of HNF-4 alpha has an anti-tumor effect (HNF 4 alpha is a therapeutic target that links AMPK to WNT signalling in early-stage gastric cancer, glut, 2014).

The Hnf-1. Alpha. Of the present invention may be naturally occurring, e.g., it may be isolated or purified from a mammal. In addition, the Hnf-1 alpha can also be artificially prepared, for example, the recombinant Hnf-1 alpha can be produced according to the conventional genetic engineering recombinant technology, so as to be applied to experiments or clinic. In application, recombinant Hnf-1 alpha may be used. The Hnf-1 alpha comprises the full-length Hnf-1 alpha or the biological activity fragment thereof.

In a preferred manner, the amino acid sequence of Hnf-1. Alpha. May be substantially identical to the sequence shown in NM-012669 (rat) and NM-001530 (human). The corresponding nucleotide coding sequence can be conveniently obtained according to the amino acid sequence of Hnf-1 alpha.

Amino acid sequences of Hnf-1 alpha that are formed by substitution, deletion or addition of one or more amino acid residues are also included in the present invention. Hnf-1 alpha or a biologically active fragment thereof comprises a replacement sequence of a portion of a conserved amino acid, said amino acid replaced sequence not affecting its activity or retaining a portion of its activity. Appropriate substitutions of amino acids are well known in the art, which can be readily performed and ensure that the biological activity of the resulting molecule is not altered. These techniques recognize to one skilled in the art that in general, altering individual amino acids in an unnecessary region of a polypeptide does not substantially alter biological activity. See Watson et al, molecular Biology of The Gene, fourth edition, 1987,The Benjamin/Cummings Pub.Co.P224.

Biologically active fragments of Hnf-1. Alpha. Can also be used in the present invention. As used herein, the term "biologically active fragment of Hnf-1α" refers to a polypeptide that retains all or part of the function of the full length Hnf-1α. Typically, the biologically active fragment retains at least 50% of the activity of full length Hnf-1. Alpha. Under more preferred conditions, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of full-length Hnf-1 alpha.

The present invention may also employ modified or improved Hnf-1 alpha, e.g., hnf-1 alpha modified or improved to promote its half-life, effectiveness, metabolism, and/or potency of the protein. The modified or improved Hnf-1 alpha may be a conjugate of Hnf-1 alpha, or it may comprise substituted or artificial amino acids. The modified or improved Hnf-1 alpha may be one that has little commonality with naturally occurring Hnf-1 alpha, but also has the effects of inhibiting (including preventing or treating) liver cancer, inhibiting liver fibrosis, repairing liver injury, and/or inhibiting inflammation. That is, some variants that do not affect the biological activity of Hnf-1. Alpha. Can be used in the present invention.

Hnf-1 alpha modified mesenchymal stem cells and application thereof

Based on the new findings of the present inventors, the present invention provides MSCs that are Hnf-1 α modified MSCs, or MSCs that overexpress Hnf-1 α. Preferred are MSCs over-expressed by Hnf-1 alpha.

In the present invention, polynucleotide sequences encoding over-expressed Hnf-1 alpha may be inserted into recombinant expression vectors to transform MSCs. A wide variety of plasmids and vectors can be used in the present invention, provided that they replicate and are stable within MSCs. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements. For example, the expression vector may include: viral vectors, non-viral vectors.

Methods well known to those skilled in the art can be used to construct expression vectors containing the polynucleotide sequence of Hnf-1 alpha and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The transformation vector also includes a ribosome binding site for translation initiation and a transcription terminator.

In some preferred embodiments, the expression vector includes (but is not limited to): adeno-associated virus, lentiviral vectors, adenoviral vectors, and the like. In a more preferred mode, the Hnf-1 alpha gene modified MSCs are obtained by transfecting MSCs with Hnf-1 alpha over-expressing adenovirus. For example, in the examples, the over-expressed adenovirus vector is named pAdeno-MCMV-Gene of interest-HA-P2A-EGFP. The invention adopts adenovirus vector to carry out the overexpression of target genes, and after the adenovirus transfects MSCs, hnf-1 alpha genes are highly expressed in the MSCs, thereby having high infection rate. Compared with other viral vectors, the adenovirus transduction efficiency is higher, stem cells in the division stage and the non-division stage can be efficiently infected, and the adenovirus transduction efficiency is higher because the adenovirus transduction efficiency is not integrated into chromosomes.

Based on the new findings of the invention, the invention also provides the application of the MSCs modified by the Hnf-1 alpha gene, which is used for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation, or is used for preparing a pharmaceutical composition for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation; the inhibition includes prevention and treatment. The liver cancer comprises: primary liver cancer, liver cancer recrudescing after liver cancer operation, liver cancer with inflammatory environment, etc.; particularly preferably, the liver cancer includes liver cancer that recurs after early liver cancer surgery. Different from the tumor implantation, the DEN cancer induction model can simulate primary liver cancer, and the liver cancer recrudesce after early liver cancer operation is relatively similar to the primary liver cancer in pathogenesis, so the invention uses a proper animal model to simulate the liver cancer recrudesce after early liver cancer operation, and demonstrates the technical effect of the Hnf-1 alpha modified mesenchymal stem cells.

Based on the novel discovery of the invention, the invention also provides the application of Hnf-1 alpha in preparing recombinant mesenchymal stem cells, wherein the recombinant mesenchymal stem cells have the effects of inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation.

Composition and method for producing the same

The invention also provides a composition comprising an effective amount (e.g., 10 ⁴ -10 ⁹ Individual cells/ML; preferred 10 ⁵ -10 ⁸ Individual cells/ML; more preferably, 10 ⁶ -10 ⁷ Individual cells/ML), said Hnf-1 alpha modified MSCs, and a pharmaceutically acceptable carrier.

Typically, the cells are formulated in a nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is typically about 5 to 8, preferably about 6 to 8.

Pharmaceutically acceptable carriers can include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In general, the pharmaceutical formulations should be compatible with the mode of administration, and the pharmaceutical compositions of the present invention may be formulated as injectable formulations, for example, using physiological saline or aqueous solutions containing glucose and other adjuvants, by conventional methods. The pharmaceutical compositions are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount. The pharmaceutical preparation of the invention can also be prepared into sustained release preparation.

The effective amount of Hnf-1 alpha modified MSCs described herein may vary depending on the mode of administration, the severity of the disease to be treated, and the like. The selection of the preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the Hnf-1 alpha modified MSCs, such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated in the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. Typically, separate doses may be administered several times per day, or the dose may be proportionally reduced, depending on the requirements of the therapeutic condition.

As a preferred mode of the invention, in a specific embodiment of the invention, a number of dosing regimens for animals such as mice are given. Conversion from an animal (e.g., murine) dosage to a dosage suitable for human administration is readily made by one skilled in the art. There have been some examples in the art of body surface area proportional relationships of laboratory animals and humans commonly used for dose scaling, such as those listed in table 1 below.

TABLE 1

As an example of the table look-up method of table 1, for example: dog dose is 10 mg/kg, total dog dose of 12 kg is 12×10 mg = 120 mg; looking up table 70 kg of human versus 12 kg of dog intersection is 3.1, so the dose of human (70 kg) = 120 mg x 3.1 = 372 mg. It should be understood that the manner of scaling between other species and humans can be analogized.

The invention also provides a kit for inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury and/or inhibiting inflammation, comprising: a container, and a recombinant mesenchymal stem cell or cell culture disposed in the container.

In addition, the kit/kit can also contain auxiliary materials, such as injection needle tubes and the like.

In addition, the kit/kit may further comprise instructions for use, describing methods of inhibiting liver cancer, inhibiting liver fibrosis, repairing liver injury, and/or inhibiting inflammation based on the combination of compounds of the present invention.

The invention has the beneficial effects that:

according to animal experiments, the gene modified MSCs related in the invention can achieve the effect of inhibiting the occurrence and development of liver cancer by remarkably relieving the inflammatory reaction of liver tissues after being infused before the mutation phase of DEN induced cancer, and have a certain curative effect on preventing early postoperative recurrence of liver cancer. Therefore, the application of the Hnf-1 alpha gene modified MSCs in preventing early liver cancer postoperative recurrence has good development prospect.

In the embodiment of the invention, the MSCs are subjected to modification transformation by using over-expression adenovirus transfection to enable the MSCs to express the Hnf-1 alpha gene. The Hnf-1 alpha gene modified MSCs have good immunity, and allogeneic MSCs can evade the elimination of an autoimmune system in vivo, so that allogeneic MSCs can replace self stem cells for tumor treatment; the Hnf-1 alpha gene modified MSCs have good tumor targeting property, can migrate and home to tumor tissues, and can transfer antitumor drugs or therapeutic genes to tumor cells and micrometastases thereof in a targeting manner, thereby playing a role in inhibiting the growth and proliferation of tumors. The invention solves the problem that tumor gene therapy can not be efficiently targeted and transferred and is safe.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1 isolation and identification of rat bone marrow Primary mesenchymal Stem cells and preparation of Hnf-1 alpha overexpressing mesenchymal Stem cells

In this example, mesenchymal stem cells derived from rat bone marrow (rBMSCs) were used as an example.

(1) Isolation and in vitro culture of rat bone marrow mesenchymal stem cells

And separating bone marrow MSCs from SD rat by using adherence culture method, and culturing in vitro. Male SD rats were anesthetized with 200-250g of 10% chloral hydrate, and after conventional sterilization, the femur was removed and placed in L-DMEM medium. In an ultra clean bench, the marrow cavity is flushed with L-DMEM medium, marrow suspension is collected, centrifuged for 5 minutes (1500 rpm), and discardedRemoving supernatant, collecting cell precipitate, adding L-DMEM+10% fetal calf serum+100U/mL penicillin+100U/mL streptomycin, and counting with a blood cell counting plate to 1×10 ⁵ /cm ² Inoculating into 10cm culture dish, inoculating into L-DMEM+10% foetal calf serum+l 00U/mL penicillin+l 00U/mL streptomycin, 37 ℃ and 5% CO ₂ And (5) standing and culturing the incubator. After 72h inoculation, the whole amount of the liquid is changed to remove suspended cells, and the liquid is changed every 2-3 days according to the growth condition of the cells.

(2) Subculture of rat bone marrow mesenchymal stem cells

After the cells grow to be full of 85-90% of the bottom area of the culture bottle, the culture solution is removed by the suction tube, and the PBS is washed for 2 times. About 1mL of 0.25% trypsin solution was added, digested for 2 minutes at 37℃and observed under a microscope, after which cells were retracted into a short round shape, the digestion was stopped by adding a culture solution containing 10% fetal bovine serum. Gently blowing the cells with a suction tube until the adherent cells fall off, sucking the cell suspension at 1000rpm, and centrifuging for 5 minutes; cell pellet was prepared as single cell suspension in complete medium containing 10% fetal bovine serum according to 1:2, the cells at this time were called passage 1 cells (P1).

In the same way, the number 2-4 generation cells were treated according to the procedure 1:2, subculturing.

(3) Differentiation of rat bone marrow mesenchymal stem cells into osteoblasts and adipogenic cells

MSCs were packed at 2X 10 ⁴ Individual/cm ² Inoculating the cells into a 24-well plate, and after the cells reach 80% fusion; inducing the cells by using an osteogenic inducing solution and a lipogenic inducing solution, respectively. For adipogenic induction, after the induction solution is treated for 20 days, the cells are subjected to Oil red O (Oil red O) staining identification; for osteogenesis, after 2-3 weeks of treatment with the induction solution, the cells were stained with alizarin red and photographed under a microscope.

The staining results observed under the microscope showed that the primary isolated mesenchymal stem cells can successfully differentiate into adipogenic cells and osteoblasts, with multipotent differentiation potential, as shown in fig. 1A.

(4) Hnf-1 alpha over-expression adenovirus transfected rat mesenchymal stem cell

Establishment of overexpression adenovirus Ad-Hnf-1 alpha: the present inventors inserted the whole genome sequence of rat Hnf-1α (GenBank ID: NM-012669) into the middle of EcoRI and BamHI cleavage sites of plasmid pAdeno-MCMV-HA-P2A-EGFP (obtained from Sundaku Biotechnology (Shanghai) Co., ltd.) expression plasmid to construct Hnf-1α over-expression adenovirus plasmid, and then transfected HEK293 cells to prepare Hnf-1α over-expression adenovirus. The primers MCMV-F and EGFP-N-3 were subsequently used for amplification verification.

MCMV-F：GGTATAAGAGGCGCGACCAG(SEQ ID NO:1)；

EGFP-N-3：CGTCGCCGTCCAGCTCGACCAG(SEQ ID NO:2)。

The third generation MSCs are prepared by the methods in the above (1) - (2) and are 12000/cm ² Individual cells MSCs were seeded in 24-well plates; after 24 hours of inoculation, the original medium was replaced with 0.5mL serum-free medium containing 6. Mu.g/mL Polybrene, and then the overexpressed adenovirus Ad-Hnf-1α (Ad-GFP as a control virus) was added at MOI=20 to transfect MSCs. After 12h, the virus solution was discarded, washed 2 times, and fresh complete medium was added for cultivation. 48 hours after transfection, MSCs were observed for green fluorescence expression using a fluorescence microscope.

The fluorescence microscope results show that the transfection efficiency of the control viruses Ad-GFP and Ad-Hnf-1 alpha can reach more than 80 percent, as shown in figure 1B.

(5) Hnf-1 alpha expression level detection

After transfection of MSCs with Ad-Hnf-1. Alpha. Cells were collected for protein extraction experiments. After the Ad-Hnf-1 alpha is transfected into MSCs by adopting a Western Blot method, the expression condition of Hnf-1 alpha in the MSCs is detected from the protein level.

Experimental results show that after transfection of MSCs with Ad-Hnf-1α, the protein expression level of Hnf-1α in the cells is significantly up-regulated, as shown in FIG. 1C.

EXAMPLE 2 research on the effects of Hnf-1 alpha Gene-modified MSCs on the development of DEN-induced primary liver cancer in rats

After 20 SD rats were adaptively fed for one week, they were randomly divided into 4 groups of 5 animals each, namely, PBS infusion group (Ctrl), ad-GFP-MSCs infusion group (Ad-GFP-MSCs), ad-Hnf-1α -MSCs infusion group (Ad-Hnf-1α -MSCs) and Ad-Hnf-1α infusion group, and all the experimental animals were fed DEN water (0.1% diethylnitrosamine)Animals of each experimental group were injected by tail vein from the 4 th week of DEN cancer induction (early stage of cancer induction, or referred to as "period of metaplasia"), 1.5X10 ⁶ Individual cells/individual/800 μl; control (Ctrl) infuses 800 μlpbs; the tail vein injection is carried out once every two weeks for three times. Then the DEN water is continuously fed until the period of 14 weeks is over, and the water is replaced by ordinary drinking water. Survival of rats in different treatment groups was recorded. At 16 weeks of DEN cancer induction, experimental animals were sacrificed and liver tissue was collected for general observation and HE staining.

Experimental results show that compared with a control MSCs group, the early infusion of Ad-Hnf-1 alpha-MSCs can remarkably improve the inhibition effect on the occurrence and development of liver cancer: from the survival of experimental animals, it can be seen that the survival time of rats infused with Ad-Hnf-1α -MSCs at an early stage far exceeded that of the blank control group, and there was also a significant difference compared with the Ad-GFP-MSCs group and Ad-Hnf-1α, as shown in FIG. 2A.

When the liver tissue specimens are obtained through general dissection, a plurality of obvious tumor blocks are visible to naked eyes in the liver of a rat in a control group DEN administration period of 16 weeks, but the liver of the rat infused with Ad-Hnf-1 alpha and Ad-GFP-MSCs still has visible tumor nodules, but the number and the size of the tumor nodules are smaller than those of the liver of the DEN group, and the liver of the rat infused with Ad-Hnf-1 alpha-MSCs almost has no macroscopic tumor blocks, so that the overall liver state is good; it was shown that infusion of Ad-Hnf-1. Alpha. -MSCs at the early stage of DEN induced cancer significantly inhibited the development of tumorigenesis, as shown in FIGS. 2B-C.

EXAMPLE 3 effect of Hnf-1 alpha Gene modified mesenchymal Stem cells on DEN-induced liver injury repair

After 15 SD rats were adaptively fed for one week, they were randomly divided into 3 groups of 5 animals each, namely, PBS infusion group (Ctrl), ad-GFP-MSCs infusion group (Ad-GFP-MSCs) and Ad-Hnf-1α -MSCs infusion group (Ad-Hnf-1α -MSCs), all experimental animals in the treatment group were fed DEN water (0.1% diethylnitrosamine), and each experimental animal was injected by tail vein from 3 weeks of DEN cancer induction, 1.5X10 ⁶ Individual cells/individual/800 μl; control group was infused with 800 μl PBS; the tail vein injection is carried out once every two weeks for three times. The experimental animals were sacrificed at week 8 of DEN treatment and animal serum and liver tissue were collected for related detection.

The biochemical analysis results show that compared with the Ctrl control group, the contents of liver function indexes such as ALT, AST, TBIL and DBIL in the serum of the animals in the Ad-GFP-MSCs and Ad-Hnf-1 alpha-MSCs infusion group are reduced, but the liver function condition of the Ad-Hnf-1 alpha-MSCs infusion group is better, as shown in figure 3A. The results demonstrate that Ad-Hnf-1. Alpha. -MSCs have a greater protective effect on injured livers than Ad-GFP-MSCs.

The sirius red staining and immunohistochemical staining results showed a significant decrease in fibrous tissue and hepatic stellate cell activation compared to Ctrl control and Ad-GFP-MSCs, ad-Hnf-1 a-MSCs infused groups, as shown in figure 3B. This result demonstrates that infusion of Ad-Hnf-1. Alpha. -MSCs can significantly slow down DEN-induced liver fibrosis.

Example 4 Effect of Hnf-1 alpha Gene-modified mesenchymal Stem cells on liver inflammatory response during liver cancer

The inflammatory response state of liver tissue was examined using the DEN cancer-inducing animal serum and liver tissue specimens collected in example 3 at week 8.

First, observation by H & E staining pictures revealed less infiltration of inflammatory cells in liver tissue of the Ad-Hnf-1. Alpha. -MSCs infused group compared to the Ctrl control group and Ad-GFP-MSCs, as shown in FIG. 4A.

At the same time, animal serum was subjected to inflammatory factor detection using a suspension chip system (Bioplex kit, biorad). The results of the study showed that the levels of pro-inflammatory factors such as TNF- α, IFN- γ, IL-4, and IL-6 in serum of animals of the infusion group of Ad-Hnf-1α -MSCs were significantly reduced compared to the Ctrl control group and Ad-GFP-MSCs (FIG. 4B), suggesting a greater ability of Ad-Hnf-1α -MSCs to inhibit inflammatory responses than Ad-GFP-MSCs.

EXAMPLE 5 Effect of human HNF-1A Gene-modified human umbilical cord-derived mesenchymal Stem cells on development and progression of DEN-induced rat primary liver cancer

A model of DEN-induced liver cancer occurrence was constructed with reference to example 2. The experimental animals were divided into 3 groups of 5 animals each. Infusion experiments were started on the fourth week of DEN dosing, where control group (Ctrl) was infused with 800 μl PBS; whereas the Ad-GFP-hMSCs and the Ad-HNF-1A-hMSCs were infused with the corresponding cells 1.5X10 s, respectively ⁶ mu.L of each cell/800 mu.L, and the injection is carried out once every two weeks for tail vein, and three timesAnd twice. Then the DEN water is continuously fed until the period of 14 weeks is over, and the water is replaced by ordinary drinking water. On week 16 of DEN treatment, experimental animals were sacrificed and liver tissue was collected for general observation and HE staining.

As shown in FIG. 5, the infusion of HNF-1A gene modified human umbilical cord-derived MSCs at the early stage of DEN induced cancer also has the effect of significantly inhibiting the development of DEN induced liver cancer compared with the control group, similar to the case of rat MSCs.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> third affiliated Hospital of the navy medical university of the free army of Chinese people

Application of <120> Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer

<130> 205279

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Primer (Primer)

<400> 1

ggtataagag gcgcgaccag 20

<210> 2

<211> 22

<212> DNA

<213> Primer (Primer)

<400> 2

cgtcgccgtc cagctcgacc ag 22

Claims

1. Use of recombinant mesenchymal stem cells in the preparation of a pharmaceutical composition for: inhibiting liver cancer, inhibiting liver fibrosis and inhibiting hepatitis; wherein the recombinant mesenchymal stem cell is a mesenchymal stem cell expressing exogenous hepatocyte nuclear factor 1 alpha and taking only the hepatocyte nuclear factor 1 alpha as an exogenous transcription factor.

2. The use according to claim 1, wherein an expression construct comprising an expression cassette for hepatocyte nuclear factor 1a is introduced into the mesenchymal stem cell, the expression construct comprising: viral vectors, non-viral vectors.

3. The use according to claim 1, wherein the expression construct is selected from the group consisting of: adenovirus vectors, lentiviral vectors or adeno-associated virus vectors.

4. The use according to claim 3, wherein the expression vector is an adenovirus vector.

5. The use according to claim 1, wherein the mesenchymal stem cells comprise mesenchymal stem cells of a source selected from the group consisting of: bone marrow, umbilical cord, fat, cord blood, placenta, dental pulp, and endometrium.

6. The use of claim 1, wherein the liver cancer comprises: primary liver cancer, liver cancer recrudescing after liver cancer operation, liver cancer with inflammation environment.

7. Use of a cell culture comprising recombinant mesenchymal stem cells expressing exogenous hepatocyte nuclear factor 1 alpha and having only hepatocyte nuclear factor 1 alpha as exogenous transcription factor for the preparation of a pharmaceutical composition for inhibiting liver cancer, inhibiting liver fibrosis and inhibiting hepatitis.

8. The use according to claim 7, wherein an expression construct comprising an expression cassette for hepatocyte nuclear factor 1a is introduced into the mesenchymal stem cell to obtain the recombinant mesenchymal stem cell, the expression construct comprising: viral vectors, non-viral vectors.

9. The use of claim 7, wherein said expression construct comprises a sequence selected from the group consisting of: adenovirus vectors, lentiviral vectors or adeno-associated virus vectors.

10. Use of a pharmaceutical composition comprising recombinant mesenchymal stem cells or cell cultures and a pharmaceutically acceptable carrier for the preparation of a kit for inhibiting liver cancer, inhibiting liver fibrosis and inhibiting hepatitis; the recombinant mesenchymal stem cell is a mesenchymal stem cell which expresses exogenous hepatocyte nuclear factor 1 alpha and takes only the hepatocyte nuclear factor 1 alpha as exogenous transcription factor.