CN112190712A

CN112190712A - Application of combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of drugs for treating liver cancer cells

Info

Publication number: CN112190712A
Application number: CN202011224281.0A
Authority: CN
Inventors: 孙嘉磊; 周海军
Original assignee: Zhongshan Hospital Fudan University
Current assignee: Zhongshan Hospital Fudan University
Priority date: 2020-11-05
Filing date: 2020-11-05
Publication date: 2021-01-08

Abstract

The invention provides an application of a combination of a hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of a liver cancer cell, wherein the hydrosulfuryl oxidase 1 agonist comprises lentivirus for over-expressing hydrosulfuryl oxidase 1 and recombinant hydrosulfuryl oxidase 1 protein, firstly, the lentivirus for over-expressing hydrosulfuryl oxidase 1 is constructed, then, a target cell is transfected, and the dosage form of the hydrosulfuryl oxidase 1 agonist comprises an oral preparation, an injection or a sustained release preparation and the like; according to the invention, the over-expression QSOX1 lentivirus and sorafenib are used for acting on the hepatoma cells, QSOX1 can inhibit the hepatoma cell activity, can obviously reduce the GSH content, and can increase the free ferrous ion and lipid peroxidation level in the cells, so that the cell iron death is promoted; therefore, the over-expressed QSOX1 lentivirus combined with sorafenib can synergistically promote the inhibition effect on the tumor growth, and has a stronger killing effect.

Description

Application of combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of drugs for treating liver cancer cells

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a combination of a hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of a drug for treating liver cancer cells.

Background

The liver cancer ranks sixth in new cases of malignant tumors and fourth in death cases worldwide in 2018, and is an aggressive malignant tumor of the digestive system. Although the early stage tumor patients, especially the patients with small liver cancer, can get better prognosis through surgical treatment, because liver cancer is hidden and is diagnosed at the middle and late stage, the patients lose the chance of radical operation, and the natural course of the disease lasts for about 3 to 6 months. In this group of patients, only palliative therapy and systemic chemotherapy can be performed, and the prognosis is very poor.

Sorafenib is a first-line drug recommended in the current liver cancer treatment guideline, is mainly used for patients with middle and late liver cancer, and is also used for receiving postoperative adjuvant therapy of patients with liver cancer resection. But the life cycle can be prolonged by about 2.8 months on average, and the treatment effect is still very limited. Therefore, if the liver cancer cells can be broken through the treatment resistance of sorafenib, the clinical treatment of the middle and late stage liver cancer is of great significance. Early researches find that the sorafenib can inhibit multi-target kinase and induce the death of tumor cells by iron so as to kill the tumor cells. The killing of tumors by the cell iron death mechanism is not a completely new concept, but the tumor cells often develop strong oxidation resistance, so the effect of treating tumors by iron death is not ideal.

Cell iron death is a newly discovered mode of cell death and is a hot spot of research in the field of cell death. Few studies have been conducted on how to enhance the therapeutic effect of sorafenib by enhancing iron death, and no preparation or method for enhancing the therapeutic effect of sorafenib by iron death has been reported. In addition, iron death depends on intracellular iron and a reduction in antioxidant capacity. In some tumors, it is proved that the induction of iron death of cancer cells is easier than the induction of other forms of death such as apoptosis and the like, and the clinical popularization is easy.

Hydrosulfooxidase 1 (QSOX 1) is an enzyme that catalyzes the formation of disulfide bonds from free thiols in protein molecules, and participates in post-translational folding of proteins to affect their biological functions. In recent years, more and more researches have found that QSOX1 protein is closely related to tumors. The research in the prior art proves that QSOX1 plays a role of a cancer suppressor in liver cancer, but the biological functions of QSOX1 participating in liver cancer cells are not completely clear, and no report of improving the treatment effect of liver cancer by using QSOX1 agonist and sorafenib in combination is available at present.

Disclosure of Invention

Aiming at the problems that the tumor growth and the disease progress are difficult to be effectively controlled by the existing treatment scheme for the middle and late stage liver cancer, and the effect of sorafenib on treating the liver cancer is very limited, the invention provides the application of the QSOX1 agonist and sorafenib in combination in improving the treatment effect of the liver cancer.

The killing of the liver cancer cells by the sorafenib is mainly realized by inducing iron death, and the liver cancer cells are tolerant to the iron death induced by the sorafenib, so that the liver cancer is insensitive to the treatment of the sorafenib. In vitro cell experiments and liver cancer transplantation animal models, QSOX1 is proved to enhance the sensitivity of liver cancer cells to sorafenib and the killing effect of liver cancer cells to tumors, so that QSOX1 gene transcription is improved by methods such as lentivirus transfection, and the tumor cells generate more QSOX1 proteins so as to increase the sensitivity of the tumor cells to sorafenib. Or use of recombinant QSOX1 protein in combination with sorafenib to increase the lethality of sorafenib on liver cancer. QSOX1 agonists of the invention are substances having QSOX1 protein activity, or substances capable of increasing QSOX1 gene transcription, such as human recombinant QSOX1 protein; the QSOX1 gene transcription is increased by methods such as lentivirus transfection. Because both the QSOX1 protein and the recombinant QSOX1 protein which are generated by lentivirus overexpression and translation are formed by protein folding in a eukaryotic cell, both have QSOX1 biological activity, and thus the protein can be used as an agonist.

In order to achieve the above purpose, the solution of the invention is as follows:

application of a combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of a drug for treating liver cancer cells.

Further, the sulfhydryl oxidase 1 agonist is selected from one or more of lentivirus over-expressing sulfhydryl oxidase 1 and recombinant sulfhydryl oxidase 1 protein.

Further, the transfection process of lentivirus overexpressing sulfhydryl oxidase 1 is:

(1) designing a primer of the hydrosulfuryl oxidase 1 gene;

(2) carrying out PCR amplification by using the primer in the step (1), and inoculating the PCR amplification into a no-load plasmid to obtain a plasmid-hydrosulfuryl oxidase 1 solution;

(3) adding the liposome into the culture medium to obtain a liposome solution;

(4) mixing the plasmid-hydrosulfuryl oxidase 1 solution with the liposome solution, washing by a buffer solution, adding the mixture into a culture medium for culture, and collecting supernate containing lentivirus over-expressing hydrosulfuryl oxidase 1;

(5) transfecting the target cell with lentivirus overexpressing hydrosulfuryl oxidase 1.

Further, in the step (1), the sequence of the hydrosulfuryl oxidase 1 gene is shown as SEQ ID NO. 1.

Further, in the step (1), in the sequences of the primers, the upstream primer is: TAGAGCTAGCGAATTCATGAGGAGGTGCAACAGC, SEQ ID NO. 2; the downstream primer is: TCGCGGCCGCGGATCCTCAAATAAGCTCAGGTCCC, SEQ ID NO. 3.

Wherein, the recombinant hydrosulfuryl oxidase 1 protein is purchased from the subrufa biotechnology limited (Abnova), and the product number is: H00005768-Q01.

Furthermore, the dosage form of the sulfhydryl oxidase 1 agonist comprises an oral preparation, an injection or a sustained release preparation and the like.

Due to the adoption of the scheme, the invention has the beneficial effects that:

according to the invention, the over-expression QSOX1 lentivirus and sorafenib are used for acting on the hepatoma cells, QSOX1 can inhibit the hepatoma cell activity, can also obviously reduce the GSH content, and increase the free ferrous ion and lipid peroxidation level in the cells, so that the cell iron death is promoted; therefore, the over-expressed QSOX1 lentivirus combined with sorafenib can synergistically promote the inhibition effect on the tumor growth, and has a stronger killing effect.

Drawings

FIG. 1 is a schematic diagram of the cleavage of a vector in example 1 of the present invention.

FIG. 2 is a graph showing the results of the effects of QSOX1 agonist in combination with sorafenib on the viability of hepatoma cells in example 1 of the present invention (Cell viability is the ordinate).

FIG. 3A is a graph showing the results of QSOX1 agonist in combination with sorafenib on GSH content in hepatoma cells in example 2 of the present invention.

FIG. 3B is a graph showing the results of QSOX1 agonist in combination with sorafenib on free ferrous ion in hepatoma cells in example 2 of the present invention.

FIG. 3C is a graph showing the results of QSOX1 agonist in combination with sorafenib on lipid peroxidation in hepatoma cells in example 2 of the present invention.

FIG. 4A is a graph showing the results of QSOX1 agonist in combination with sorafenib on hepatoma cell transplants in example 3 of the present invention.

FIG. 4B is a graph showing the results of inhibition of hepatoma intracellular transplants by QSOX1 agonist in combination with sorafenib in example 3 of the present invention.

Detailed Description

The invention provides an application of a combination of a hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of a drug for treating liver cancer cells.

Sorafenib (sorafenib), available from Cell Signaling Technology, cat # 8705.

The hepatoma cell line MHCC97H was stored by the liver cancer institute of the subsidiary Zhongshan hospital of the university of Fudan.

The present invention will be further described with reference to the following examples.

Example 1:

effects of QSOX1 agonist in combination with sorafenib on hepatoma cell viability:

the experimental method comprises the following steps: overexpression vector construction

1. Construction of lentiviruses overexpressing QSOX 1:

1.1, and the nucleotide sequence of QSOX1 gene is shown in SEQ ID NO. 1.

1.2, designing a QSOX1 gene amplification primer, wherein the primer sequence is as follows:

an upstream primer: TAGAGCTAGCGAATTCATGAGGAGGTGCAACAGC, respectively; SEQ ID No. 2;

a downstream primer: TCGCGGCCGCGGATCCTCAAATAAGCTCAGGTCCC, respectively; SEQ ID NO. 3.

Among them, the PCR reaction system for amplifying QSOX1 gene is shown in Table 1:

TABLE 1 PCR reaction System

H₂O	37.5μl
		10×PCR Buffer	5μl
25mM MgCl₂	3μl
		10mM dNTPs	1μl
10μM Forward or Reverse Primer	1/1μl
		MHCC97H bacterial strain cDNA	1μl
P husion	0.5μl
		Total	50μl

PCR amplification conditions: at 98 ℃ for 30 s; at 98 deg.C, 10s, 55 deg.C, 30s, 72 deg.C, 30s, 40 cycles, and after the cycle is finished, extending at 72 deg.C for 5 min.

1.3, PCR product recovery:

1) cutting gel under ultraviolet light, recovering PCR electrophoresis product, adding QG buffer solution with 3 times of gel weight into 1.5ml EP tube, water bathing at 50 deg.C to dissolve completely, adding isopropanol with one time of gel volume, mixing, loading onto column, and standing for 3 min.

2) Centrifuging for 1min at 12000rpm/min, discarding the supernatant, adding 0.5ml QG buffer solution, passing through the column, and centrifuging for 1min at 12000 rpm/min.

3) Discarding the solution, adding 0.75ml PE Wash Buffer, standing for 5min, centrifuging for 1min at 12000rpm/min, discarding the solution, and centrifuging for 1min at 12000 rpm/min.

4) The column was placed in a 1.5ml EP tube, and 30. mu.l of Elution Buffer was added to the column, and after standing for 5min, centrifugation was carried out for 1min at 15000 rpm/min. Taking a proper amount of the centrifugal product to carry out electrophoresis identification in 1.5% gel.

1.4, vector enzyme digestion: corresponding reagents are sequentially added according to the sequence shown in the following table to prepare an enzyme digestion system. The mixture is blown, evenly mixed, centrifuged for a short time and placed at 37 ℃ for reaction for 3 h.

BamH I	1.0μl
		Xba I	1.0μl
10×K buffer	4.0μl
		Plasmid DNA	2.0μl
10μM Forward or Reverse Primer	1/1μl
		dH₂O	32.0μl
Total	40.0μl

The cleavage results are shown in FIG. 1 (lanes from left to right are 1-8):

lane 1: DCE-puro no-load plasmid;

lane 2: carrying out no-load enzyme digestion on DCE-puro;

lane 3: the DCE-puro-h _ QSOX1 plasmid;

lane 4: enzyme digestion 1 of DCE-puro-h _ QSOX 1;

lane 5: enzyme digestion 2 of DCE-puro-h _ QSOX 1;

lane 6: enzyme digestion 3 of DCE-puro-h _ QSOX 1;

lane 7: DNA Marker 2000;

lane 8: DNA Marker 15000.

And (4) carrying out agarose gel electrophoresis on the vector enzyme digestion product, and recovering a target band.

1.5 cloning the PCR amplification product of the above sequence into pLenO-DCE-puro unloaded plasmid according to the conventional method of molecular biology, and the plasmid is named as pLenO-DCE-puro-QSOX 1. The empty-load plasmid and lentivirus packaging three-plasmid DNA solution is prepared according to the following system: the empty plasmid DNA solution contained pLenO-DCE-puro empty vector plasmid (8. mu.g), psPAX2 (6. mu.g) and pMD (2. mu.g), the lentiviral packaging three-plasmid DNA solution contained pLenO-DCE-puro-QSOX1 plasmid (8. mu.g), psPAX2 (6. mu.g) and pMD (2. mu.g), and the cell culture medium during packaging was opti-MEM (500. mu.l). Another sterile EP tube was filled with 20. mu.l of liposome lipo2000 and 450. mu.l of opti-MEM to prepare a liposome solution. Mixing the DNA solution and the liposome solution, culturing 293T cells for 6h, washing with PBS for three times, adding a DMEM medium containing 10% fetal calf serum, continuously culturing until the color of the medium turns yellow, and collecting the supernatant. The supernatants contained a lentivirus overexpressing QSOX1 and a no-load control lentivirus, respectively.

1.6, cell infection: MHCC97H cells were cultured at 10 ℃ C⁵Density per well was inoculated in 6 well plates, 2ml of the above lentivirus-containing supernatant was added, together with 2ml of DMEM medium containing 10% fetal bovine serum. After 8h of culture, washing the cells 3 times by PBS, replacing the cells with 4ml of DMEM medium containing 10% fetal calf serum, continuing to culture for 48h, adding 5 mu g/ml puromycin to screen positive cell strains, and finally obtaining cell strains MHCC97H-QSOX1 and no-load control MHCC97H-Vector which over-express QSOX1 protein.

The human liver cancer cell MHCC97H cell line (no-load control group (MHCC 97H-Vector)) and QSOX1 overexpression group (MHCC97H-QSOX1)]At 10, by⁴The cells were seeded in 96-well plates at a density of one cell per well. A total of 6 concentration gradients were set:

(1) DMEM medium containing 0.1% DMSO as a control group;

(2) DMEM medium containing 1 μ M sorafenib (sorafenib);

(3) DMEM medium containing 2.5 μ M sorafenib (sorafenib);

(4) DMEM medium containing 5 μ M sorafenib (sorafenib);

(5) DMEM medium containing 10 μ M sorafenib (sorafenib);

(6) DMEM medium containing 20 μ M sorafenib (sorafenib).

For each concentration gradient, 5 secondary wells were set for the empty control group and QSOX1 overexpression group. After the cells adhere to the wall, the original culture medium is sucked, and simultaneously 100 mu l of the culture medium containing DMSO or sorafenib with different gradients is added into each group of wells. After 24h, the medium was aspirated, 10% CCK-8 reagent (east Japanese Kernel) diluted with DMEM was added, incubation was continued for 2h at 37 ℃ in a cell incubator, absorbance at 450nm was measured with a microplate reader, and cell death rates of the remaining groups were calculated and plotted based on the absorbance of the DMSO group.

As can be seen from FIG. 2, the cells of QSOX1 overexpression group showed significantly increased cell death and concentration dependency after receiving sorafenib treatment at different concentrations compared with the cells of the no-load control group.

In conclusion, cell experiments prove that the cell activity of the hepatoma cells over-expressing QSOX1 protein is obviously reduced compared with that of cells of a control group after the hepatoma cells are treated by sorafenib with different concentrations, which indicates that QSOX1 can inhibit the hepatoma cell activity.

Example 2:

effects of QSOX1 agonist in combination with sorafenib on iron death of hepatoma cells:

the human liver cancer cell MHCC97H cell line (no-load control group (MHCC 97H-Vector)) and QSOX1 overexpression group (MHCC97H-QSOX1)]Seeded in 6-well plates, 10 per well⁵And (4) cells. Divide into 4 groups after the adherence, every group establishes 3 auxiliary orifices, and each group is respectively:

(1) no-load control cells + DMSO;

(2) QSOX1 overexpresses group cells + DMSO;

(3) no-load control group cells +5 μ M sorafenib (sorafenib);

(4) QSOX1 overexpressed group cells +5 μ M sorafenib (sorafenib).

(A) For detecting the content of the GSH in the cells, after 24 hours of treatment, the supernatant is sucked off, the GSH content in each group of cells is detected by using a GSH/GSSH detection kit (Biyun day), and the relative content of the GSH in the groups 2 to 4 is calculated and a histogram is drawn by taking the result of the first group as the reference.

(B) For detection of intracellular free ferrous ion levels, the supernatant was aspirated after 24h of treatment, the cells were trypsinized, resuspended in 1.5ml EP tube with PBS and centrifuged, and the supernatant aspirated, leaving a cell pellet. The prepared ferrous ion fluorescent probe (Ferrooorange, east Japan Kernel) was added to the precipitate-containing EP tube and the cells were resuspended, incubated at 37 ℃ in an incubator without light for 15min, and detected by an up-flow cytometer (model: analytical flow cytometer LX, trade company: Beckmann Kort).

(C) For detection of intracellular lipid peroxidation levels, the supernatant was aspirated after 24h of treatment, cells were trypsinized, resuspended in 1.5ml EP tube with PBS and centrifuged, and the supernatant aspirated, leaving a cell pellet. The prepared lipid peroxidation probe (BODIPY-C11, ThermoFisher) is added into an EP tube containing the precipitate, the cell is resuspended, incubated in an incubator at 37 ℃ for 15min in the absence of light, and detected by an up-flow cytometer.

3A to 3C in FIG. 3 show that, compared with sorafenib alone, after sorafenib treatment is performed on hepatoma carcinoma cells over-expressing QSOX1 protein, the content of intracellular reduced glutathione is obviously reduced compared with a control group, the content of GSH can be more obviously reduced, and the levels of intracellular free ferrous ions and lipid peroxidation are increased, so that QSOX1 can really promote sorafenib-induced cell iron death.

Example 3:

effects of QSOX1 agonist in combination with sorafenib on hepatocellular carcinoma orthotopic graft tumor size:

the human liver cancer cell MHCC97H cell line (no-load control group (MHCC 97H-Vector)) and QSOX1 overexpression group (MHCC97H-QSOX1)]At 75cm²The cells were grown in a flask to a sufficient density, trypsinized, and resuspended in 10 μ l PBS per 100 μ l PBS using PBS⁷And (4) cells. The above cell suspension was injected subcutaneously into the right axilla in an amount of 100. mu.l per BALB/c nude mouse. Mice were sacrificed 2 weeks later, subcutaneous tumors were removed, and tumor tissues were cut to 1mm with a scalpel³The cube of (4) is placed in sterile physiological saline for later use. Another BALB/c nude mouse for liver cancer orthotopic transplantation tumor is taken and injected with 80 μ l of 2% pentobarbital for anesthesia. Disinfecting abdomen, cutting into abdomen with ophthalmology to expose liver, inoculating the above cubic tumor tissue block in the middle of liver, and suturing. The transplanted tumor mice corresponding to the empty control group (MHCC97H-Vector) and the QSOX1 overexpression group (MHCC97H-QSOX1) are 12 mice each, and are divided into 4 groups to be treated as follows:

(1) no-load control group and normal saline are used for intragastric administration;

(2) QSOX1 overexpression group + saline gavage;

(3) performing intragastric administration once every other day by using the no-load control group plus 10mg/kg sorafenib;

(4) QSOX1 overexpression group +10mg/kg sorafenib gavage once every other day.

Taking the mice after 3 weeks for carrying out abdominal cavity nuclear magnetic resonance examination, then killing the mice, dissecting and separating tumor-bearing livers and measuring the sizes of the tumor-bearing livers, wherein the measurement formula of the sizes of the tumors is as follows: length x2 width x Π/6.

As shown in fig. 4A and 4B, QSOX1 overexpression combined with sorafenib was able to synergistically promote the inhibitory effect of sorafenib on tumor growth. Therefore, after the liver cancer transplantation tumor over-expressing QSOX1 protein is treated by sorafenib, the growth of the transplantation tumor is more obviously inhibited than that of the liver cancer transplantation tumor of a control group (without over-expressing QSOX1 protein), and the QSOX1 combined with sorafenib has stronger killing effect on liver cancer cells.

From the above, it is understood that, in patients with advanced liver cancer or patients after hepatoma resection, when postoperative adjuvant therapy is required, the combined use of QSOX1 agonist and sorafenib can improve the curative effect, and can also improve the curative effect of postoperative adjuvant therapy in patients after hepatoma resection.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments and the generic principles defined herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art should appreciate that many modifications and variations are possible in light of the above teaching without departing from the scope of the invention.

Sequence listing

<110> Zhongshan Hospital affiliated to Fudan university

Application of combination of <120> hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of drugs for treating liver cancer cells

<141> 2020-11-05

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1933

<212> DNA

<213> Artificial sequence ()

<400> 1

aggctcgttt agtgaccgtc agatcgcctg gagacgccat ccacgctgtt ttgacctcca 60

tagaagattc tagagctagc gaattcatga ggaggtgcaa cagcggctcc gggccgccgc 120

cgtcgctgct gctgctgctg ctgtggctgc tcgcggttcc cggcgctaac gcggccccgc 180

ggtcggcgct ctattcgcct tccgacccgc tgacgctgct gcaggcggac acggtgcgcg 240

gcgcggtgct gggctcccgc agcgcctggg ccgtggagtt cttcgcctcc tggtgcggcc 300

actgcatcgc cttcgccccg acgtggaagg cgctggccga agacgtcaaa gcctggaggc 360

cggccctgta tctcgccgcc ctggactgtg ctgaggagac caacagtgca gtctgcagag 420

acttcaacat ccctggcttc ccgactgtga ggttcttcaa ggcctttacc aagaacggct 480

caggagcagt atttccagtg gctggtgctg acgtgcagac gctgcgggag aggctcattg 540

acgccctgga gtcccatcat gacacgtggc ccccagcctg tcccccactg gagcctgcca 600

agctggagga gattgatgga ttctttgcga gaaataacga agagtacctg gctctgatct 660

ttgaaaaggg aggctcctac ctgggtagag aggtggctct ggacctgtcc cagcacaaag 720

gcgtggcggt gcgcagggtg ctgaacacag aggccaatgt ggtgagaaag tttggtgtca 780

ccgacttccc ctcttgctac ctgctgttcc ggaatggctc tgtctcccga gtccccgtgc 840

tcatggaatc caggtccttc tataccgctt acctgcagag actctctggg ctcaccaggg 900

aggctgccca gaccacagtt gcaccaacca ctgctaacaa gatagctccc actgtttgga 960

aattggcaga tcgctccaag atctacatgg ctgacctgga atctgcactg cactacatcc 1020

tgcggataga agtgggcagg ttcccggtcc tggaagggca gcgcctggtg gccctgaaaa 1080

agtttgtggc agtgctggcc aagtatttcc ctggccggcc cttagtccag aacttcctgc 1140

actccgtgaa tgaatggctc aagaggcaga agagaaataa aattccctac agtttcttta 1200

aaactgccct ggacgacagg aaagagggtg ccgttcttgc caagaaggtg aactggattg 1260

gctgccaggg gagtgagccg catttccggg gctttccctg ctccctgtgg gttcttttcc 1320

acttcttgac tgtgcaggca gctcggcaaa atgtagacca ctcacaggaa gcagccaagg 1380

ccaaggaggt cctcccagcc atccgaggct acgtgcacta cttcttcggc tgccgagact 1440

gcgctagcca cttcgagcag atggctgctg cctccatgca ccgggtgggg agtcccaacg 1500

ccgctgtcct ctggctctgg tctagccaca acagggtcaa tgctcgcctt gcaggtgccc 1560

ccagcgagga cccccagttc cccaaggtgc agtggccacc ccgtgaactt tgttctgcct 1620

gccacaatga acgcctggat gtgcccgtgt gggacgtgga agccaccctc aacttcctca 1680

aggcccactt ctccccaagc aacatcatcc tggacttccc tgcagctggg tcagctgccc 1740

ggagggatgt gcagaatgtg gcagccgccc cagagctggc gatgggagcc ctggagctgg 1800

aaagccggaa ttcaactctg gaccctggga agcctgagat gatgaagtcc cccacaaaca 1860

ccaccccaca tgtgccggct gagggacctg agcttatttg aggatccgcg gccgcaagga 1920

tctgcgatcg ctc 1933

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 2

tagagctagc gaattcatga ggaggtgcaa cagc 34

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence ()

<400> 3

tcgcggccgc ggatcctcaa ataagctcag gtccc 35

Claims

1. Application of a combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of a drug for treating liver cancer cells.

2. Use according to claim 1, characterized in that: the hydrosulfuryl oxidase 1 agonist is selected from one or more of lentivirus over-expressing hydrosulfuryl oxidase 1 and recombinant hydrosulfuryl oxidase 1 protein.

3. Use according to claim 1, characterized in that: the transfection process of the lentivirus over expressing the hydrosulfuryl oxidase 1 comprises the following steps:

(1) designing a primer of the hydrosulfuryl oxidase 1 gene;

(3) adding the liposome into the culture medium to obtain a liposome solution;

(4) mixing the plasmid-hydrosulfuryl oxidase 1 solution with a liposome solution, washing by a buffer solution, adding the mixture into a culture medium for culture, and collecting supernate containing lentiviruses over-expressing hydrosulfuryl oxidase 1;

(5) transfecting the lentivirus overexpressing hydrosulfuryl oxidase 1 into a target cell.

4. Use according to claim 3, characterized in that: in the step (1), the sequence of the hydrosulfuryl oxidase 1 gene is shown as SEQ ID NO. 1.

5. Use according to claim 3, characterized in that: in the step (1), in the sequences of the primers, an upstream primer is: SEQ ID No. 2; the downstream primer is: SEQ ID NO. 3.

6. Use according to claim 1, characterized in that: the dosage form of the hydrosulfuryl oxidase 1 agonist comprises an oral preparation, an injection or a sustained-release preparation.