CN112251421A - EZH2 variable shear body and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to an EZH2 alternative splice site and application thereof. The invention uses specific siRNA to knock down two subtypes, namely EZH2-L and EZH2-S, respectively, and establishes myocardial hypertrophy and heart failure models at a cell level and an animal level respectively. The results show that the expression level of the pathological gene of myocardial hypertrophy is obviously reduced, the area of myocardial cells is reduced, and the heart weight is reduced after the EZH2-L is knocked down; after the knockdown of EZH2-S, the expression level of pathological genes of myocardial hypertrophy is obviously increased, the area of myocardial cells is increased, and the weight of the heart is increased, which indicates that EZH2-L and EZH2-S respectively promote and inhibit myocardial hypertrophy and heart failure. Furthermore, tumor cell proliferation was inhibited following knockdown of EZH2-L, whereas knockdown of EZH2-S had no effect on tumor cell proliferation. The invention provides a new target and a new strategy for developing a therapeutic drug for diseases related to EZH2 gene.

Description

EZH2 variable shear body and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an EZH2 variable shear body and application thereof.

Background

Epigenetic modifications can regulate chromatin state and gene expression through DNA methylation, histone modification, and chromatin remodeling, among others, without altering DNA sequences. Polycomb group proteins (PcGs) are an important group of epigenetic regulatory proteins. The PcG protein contains two core complexes, the PRC1 complex (comb compressive complex 1) and the PRC2 complex (comb compressive complex 2), respectively. The PRC2 complex specifically catalyzes the monomethylation, dimethylation and trimethylation of the H3K27 site to regulate gene transcription. The catalytic subunit EZH2(enhancer of zeste homolog 2) of the PRC2 complex is a histone methyltransferase for histone H3 trimethylation at Lys27(H3K27me 3). EZH2 is a highly evolutionarily conserved gene with similar domains in different species. EZH2, a catalytic subunit of the PRC2 complex, has been shown to be a key regulator of a variety of biological processes, involved in various biological functions, such as cell proliferation, regulation of the transcriptional network in embryonic stem cells, cell cycle regulation, maintenance of protein homeostasis, cardiac development, and the like.

The pathological growth of the myocardial cells, the occurrence and development of which involve a plurality of biological processes from chromatin structure change to gene transcription regulation, RNA cleavage, protein translation, post-translational modification, signal transduction and the like in the cells, wherein the most critical link is reprogramming of pathological gene expression. Adult myocardial cells express structural proteins and contractile function proteins of subtypes different from those of embryonic periods, so that the requirement on the pump blood function is increased along with the development of human bodies; in the process of myocardial hypertrophy and heart failure, embryonic-stage genes are induced to be expressed again as a defense strategy of body stress response, and the process is called embryonic-stage gene expression reprogramming. Research shows that epigenetics plays an important role in regulating the reprogramming of gene expression in embryonic stage. Changes in PRC2 complex expression or function are closely related to the development of changes in cardiac pathology and play a key role in reprogramming gene expression profiles. Previous studies have shown that knockout of EZH2 can lead to fatal congenital heart malformations, including compressed myocardial dysplasia and ventricular septum defects. In an animal model of myocardial ischemia/reperfusion, EZH2 modulated apoptosis and proliferation of cardiomyocytes in the adult mouse heart, thereby protecting the cells from ischemia reperfusion injury. Studies with cardiomyocyte-specific EZH2 knockout mice have shown that EZH2 inhibits cardiac growth and embryonic gene expression while protecting the heart from oxidative damage.

EZH2 was found to be abnormally overexpressed in various malignancies, such as prostate, breast and ovarian cancers. H3K27me3, catalyzed by EZH2, is a key factor in promoting tumor growth and metastasis in many malignant tumor models. In addition, EZH2 functional mutations have also been found in various cancers. Studies have shown that inhibition by small molecule inhibitors or knockdown of EZH2 gene reduces cancer cell growth and tumor formation. In addition to acting as a histone modifier in a PCR 2-dependent manner, EZH2 also acts in an independent manner in cancer. EZH2 plays an important role in cell proliferation and is a key factor for abnormal gene expression during malignant transformation of tumors.

EZH2 is an important molecular target for cardiovascular diseases, metabolic diseases, tumors and other diseases. The invention focuses on the important regulation and control function of the variable shear body of EZH2 in the pathological myocardial hypertrophy, heart failure and tumorigenesis process.

Disclosure of Invention

The invention provides an EZH2 variable shear body and application thereof, aiming at solving part of problems in the prior art or at least alleviating part of problems in the prior art.

The invention is realized by that, an EZH2 variable splicing body, the splicing site is positioned at the position 27nt before the 3' end of the third exon of EZH2, and the difference of the two obtained variable splicing bodies is 27nt, and the two obtained variable splicing bodies are respectively called EZH2-L and EZH2-S with 27nt and deletion 27 nt; the 27nt sequence is gtgagctcattgcgcgggactagggag in mice and humans and gtgagctcattacgcgggactagggag in rats.

The EZH2 variant cutting body is used for preparing the medicine for treating at least one of myocardial hypertrophy, heart failure, cardiovascular diseases and tumors.

Further, the medicament comprises an inhibitor of EZH2-L and/or an agonist of EZH 2-S.

Further, the inhibitor of EZH2-L is preferably one of siRNA of EZH2-L gene, RNA interference vector of EZH2-L gene or antibody of EZH2-L and other inhibitors capable of inhibiting the expression of EZH 2-L; the agonist of the EZH2-S is preferably one of an overexpression plasmid of the EZH2-S gene and an agonist capable of promoting the expression of the EZH 2-S.

The EZH2 variant cutting body as a drug target or a target gene in gene therapy is applied to screening or preparing drugs for treating at least one of myocardial hypertrophy, heart failure, cardiovascular diseases and tumors.

The EZH2 variant splicing body is used for constructing an in vitro cell model or an animal model of EZH2-L and/or EZH2-S gene expression, and screening drugs for preventing, relieving and/or treating at least one of myocardial hypertrophy, heart failure, cardiovascular diseases and tumors.

Use of an inhibitor of EZH2-L and/or an agonist of EZH2-S for the preparation of a medicament for the treatment of at least one of myocardial hypertrophy, heart failure, cardiovascular disease and tumors. The inhibitor of EZH2-L is preferably siRNA of EZH2-L gene, and the sequence is shown in SEQ ID NO.2 and SEQ ID NO. 3.

Further, the tumor includes cervical cancer.

The invention firstly identifies a plurality of splice body subtypes of EZH2 in mammals, wherein the third exon is deleted for 27bp to form two variable splice bodies which are respectively named as EZH2-L and EZH2-S, the occurrence frequency of the variable splice bodies is higher, and the variable splice site at the 3' end of the third exon is highly conserved in the mammals. According to the application, newborn 1-3-day rat myocardial cells (NRVMs) are taken as experimental objects, siRNA is used for knocking down the transcription level of EZH2-L and EZH2-S respectively, and a myocardial cell hypertrophy model is established through phenylephrine (phenyleephrine) induction. The results show that compared with the control group, the siRNA can obviously reduce the expression level of the myocardial hypertrophy markers ANP and BNP of the phenylephrine-induced hypertrophic myocardial cells after knocking down EZH 2-L. Meanwhile, compared with a control group, the siRNA is used for knocking down EZH2-S, so that the increase of the expression levels of the myocardial hypertrophy markers ANP and BNP of the phenylephrine-induced hypertrophic myocardial cells can be obviously promoted. Mice were infected with EZH2-L and EZH2-S specific AAV9-shRNA (AAV9-shEZH2-L/AAV9-shEZH2-S) by tail vein injection, and three weeks later, aortic stenosis induced cardiac hypertrophy and heart failure, and 8 weeks after surgery observation showed that knocking down EZH2-L and EZH2-S had the effect of promoting and inhibiting cardiac hypertrophy and heart failure, respectively. In addition, the knocking-down of EZH2-L in tumor cells can obviously inhibit the proliferation of the tumor cells.

The results indicate that the variable shearing of EZH2 can regulate the occurrence of myocardial hypertrophy, heart failure and tumors, EZH2-L and EZH2-S respectively have the effects of promoting and inhibiting myocardial hypertrophy, heart failure and tumors, and provide theoretical basis and clinical basis for researching new targets and new strategies for preventing and treating myocardial hypertrophy, heart failure and tumors.

The EZH2 variable spliceosome EZH2-L and EZH2-S can be used as a drug target, an in vitro cell model or an animal model of EZH2-L and EZH2-S gene overexpression is constructed, and the in vitro cell model or the animal model is used for screening drugs for preventing, relieving and/or treating cardiovascular diseases and tumors; the EZH2 variable spliceosome EZH2-L and EZH2-S can also be used as a target gene in gene therapy, a medicament and/or a biological reagent for preventing, relieving and/or treating cardiovascular diseases and tumors is designed and prepared, and the purpose of preventing, relieving and/or treating the cardiovascular diseases and the tumors is achieved through a genetic engineering technology; the EZH2 variable shearing regulatory factor can also be used as a drug target or a target gene in gene therapy, is used for screening, designing and preparing drugs and/or biological reagents for preventing, relieving and/or treating cardiovascular diseases and tumors, and can achieve the purpose of preventing, relieving and/or treating myocardial hypertrophy, heart failure and tumors through a genetic engineering technology. For example, EZH2-L is used as a target gene, double-stranded siRNA capable of interfering the expression of EZH2-L is designed, is synthesized by a chemical method, is injected into a human body, and is used for treating myocardial hypertrophy, heart failure and tumor by down-regulating the expression of EZH2-L gene by an RNA interference method; and a small molecular compound inhibitor can be designed by taking EZH2-L as a target spot, and a molecule capable of specifically inhibiting EZH2-L is found by screening by using an in vitro cell model or an animal model of EZH2-L gene overexpression, so that a novel therapeutic molecule is provided for treating cardiovascular diseases and tumors. In addition, EZH2-S is used as a target gene, a plasmid capable of over-expressing EZH2-S is constructed, and the plasmid is injected into a human body to enable the expression of EZH2-S gene to be up-regulated through plasmid over-expression so as to treat cardiac hypertrophy, heart failure and tumor; and a small molecular compound agonist can be designed and synthesized by taking EZH2-S as a target spot, and a molecule capable of specifically exciting EZH2-S is found by screening in-vitro cell models or animal models with the EZH2-S gene knocked down, so that a novel therapeutic molecule is provided for treating cardiovascular diseases and tumors.

Aiming at the functions of the EZH2 variable splicing body, the application of the EZH2 variable splicing body as a drug target in screening drugs for treating cardiovascular diseases and tumors is provided.

The inhibitor of EZH2-L is preferably one of siRNA of EZH2-L gene, RNA interference vector of EZH2-L gene, antibody of EZH2-L and other inhibitors capable of inhibiting the expression of EZH 2-L. And the agonist of the EZH2-S is preferably one of an overexpression plasmid of the EZH2-S gene and an agonist capable of promoting the expression of the EZH 2-S.

In summary, the advantages and positive effects of the invention are:

1. the invention discovers a new function of the EZH2 gene, namely that EZH2 variable spliceosome EZH2-L and EZH2-S respectively have the effects of promoting and inhibiting cardiovascular diseases and tumors;

2. based on the functions of EZH2-L and EZH2-S in cardiovascular diseases and tumors, the method provides a target for developing drugs for treating cardiovascular diseases and tumors.

Inhibitors of EZH2-L and agonists of EZH2-S are useful for the preparation of medicaments for the prevention, alleviation and/or treatment of cardiovascular diseases and tumors.

Drawings

FIG. 1 shows 2 alternative splicing patterns of the 5' end of exon 3 of EZH2 identified in neonatal rat cardiomyocytes, with the retention of 27bp for EZH2-L and the absence of 27bp for EZH 2-S;

FIG. 2 is detection of EZH2 variable shears, and real-time fluorescent quantitative PCR (qPCR) validation of siEZH2-L and siEZH2-S knockdown efficiency; a is siRNA sequence specific to EZH2-L and EZH 2-S; b is an agarose gel electrophoresis picture of reverse transcription PCR (RT-PCR) after EZH2-L and EZH2-S in neonatal rat myocardial cells are respectively knocked down; c is the qPCR result of the mRNA level of each of EZH2-L and EZH2-S after being knocked down respectively in the myocardial cells of the newborn rats;

FIG. 3 is a graph of the effect of EZH2-L and EZH2-S knockdown on the cardiac myocyte hypertrophy markers ANP and BNP in vitro cultured neonatal rats; a and B are the levels of the myocardial cell hypertrophy markers ANP and BNP in a phenylephrine-induced group after the variable splicing form of EZH2-L is knocked down; c and D are the levels of the phenylephrine-induced myocardial cell hypertrophy markers ANP, BNP following knockdown of EZH2-S variable cleavage form;

FIG. 4 is a graph of the effect of EZH2-L and EZH2-S knockdown on cardiomyocyte area in neonatal rats cultured in vitro; a is representative WGA staining; b and C are cell area statistics results;

FIG. 5 is a graph of the effect of specific knockdown of EZH2-L and EZH2-S on aortic stenosis induced myocardial hypertrophy and heart failure; mice were infected with EZH2-L and EZH2-S specific AAV9-shRNA (AAV9-shEZH2-L/AAV9-shEZH2-S) by tail vein injection, three weeks later, aortic stenosis induced cardiac hypertrophy and onset of heart failure, 8 weeks after surgery, cardiac morphology was observed and cardiac weight was measured. A is a representative cardiac picture; b is the statistical result of the heart-weight-to-body ratio (mg/g); c is qPCR result of specific knock-down of EZH2-L and EZH2-S by AAV9-shRNA respectively.

FIG. 6 effects of specific knockdown of EZH2-L and EZH2-S on tumor cells; hela (A), SiHa (B), and CaSki (C).

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components defined, as these embodiments, as well as others described, are intended to be merely illustrative of particular aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be covered by the scope of the appended claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. In the present invention, "about" means within 10%, preferably within 5% of a given value or range.

The normal temperature in the following embodiments of the present invention refers to a natural room temperature condition in four seasons, and is not subjected to additional cooling or heating treatment, and is generally controlled at 10 to 30 ℃, preferably 15 to 25 ℃.

The invention discloses an EZH2 variable shear body and application thereof. The experimental animal of the present invention: species, sex, size and source of experimental animals: new born rats, male and female, can be purchased from the research center of experimental animals in Hubei province for 2-3 days. The present inventors identified in previous studies a conserved cryptic cleavage site of EZH2, which is located 27nt before the 3' end of exon III of EZH2, and the two resulting variable cleavants differ by 27nt (gtgagctcattgcgcgggactagggag, mouse and human, SEQ ID NO.1) or gtgagctcattacgcgggactagggag (rat, SEQ ID NO.28) and have 27nt and 27nt deletions, respectively, referred to as EZH2-L and EZH 2-S. Among them, human EZH2 is numbered 2146 in NCBI, 14056 for mouse and 312299 for rat. The human sequence with 27nt is shown in SEQ ID NO.18, and the sequence with 27nt deleted is shown in SEQ ID NO. 19; the sequence of the mouse with 27nt is shown in SEQ ID NO.20, and the sequence of the mouse with 27nt deleted is shown in SEQ ID NO. 21; the sequence of rat with 27nt is shown in SEQ ID NO.22, and the sequence of deletion 27nt is shown in SEQ ID NO. 23.

Example 1 isolation of Neonatal rat cardiomyocytes (NRVMs)

1. Myocardial tissue digestion

Taking out heart after the newborn rat cardiac muscle cell is sterilized and killed, washing blood with 1x Ads buffer solution, removing cardiac floor great vessels and auricle atria, and shearing cardiac muscle tissue to about 1mm²Adding a proper amount of mixed enzyme digestive juice of 0.1 percent collagenase and 0.075 percent pancreatin, digesting for 20 minutes, then discarding the supernatant, adding a proper amount of mixed enzyme digestive juice again, digesting for 20 minutes, then collecting the supernatant, adding a small amount of serum into the supernatant to terminate the mixed enzyme digestion reaction, repeating the digestion, collecting the supernatant, adding a small amount of serum into the supernatant for 5-6 times, then centrifuging the digestive juice at 2200rpm x 3min, then collecting cells, and adding a proper amount of 1x Ads to blow off the cells for later use.

2. Preparation of Percoll density gradient separation system

Three materials, 1x Ads, 10x Ads, and percoll, were required to formulate this system. Firstly, preparing a percoll stock, wherein the percoll stock comprises the following components: 10x Ads ═ 9: 1. Secondly, preparing a Top liquid and a Bottom liquid, wherein the Top comprises percoll stock: 1x Ads ═ 8:12, Bottom composition percoll stock: 1x Ads is 13: 7. Thirdly, preparing a percoll density gradient separation system: (1) adding 5ml of Top solution into a 15ml centrifuge tube; (2) adding 2ml of bottom solution into the bottom of a 15ml centrifuge tube by using a 1ml syringe; (3) 1ml of Top solution is added to the Top surface of the 15ml centrifuge tube.

3. Cardiomyocyte isolation

Adding the digested and collected cells into the upper part of a Percoll density gradient separation system, centrifuging at 3000rpm x 30min, collecting middle layer cells, namely the myocardial cells, adding a proper amount of 1x Ads to blow off the cells, centrifuging at 2200rpm x 3min, collecting the cells, adding a proper amount of 1x Ads to blow off the cells, and then culturing on a seed plate.

Example 2 siRNA transfection method and establishment of Phenylepinephrine-induced cardiomyocyte hypertrophy model

1. Cardiomyocyte culture

Cardiomyocytes were counted on day one and plated into six-well plates at approximately 0.5x 10 cells per well⁶The culture solution is 10% FBS, 1% penicillin-streptomycin solution and high-glucose DMEM culture medium. The culture medium was changed the next day to 1% ITS + 1% penicillin-streptomycin solution + high glucose DMEM medium.

2. siRNA transfection

And performing siRNA transfection on the third day, replacing a culture solution with 1% ITS + high-sugar DMEM culture medium before transfection, then respectively preparing an siRNA solution and a transfection reagent RNAIMAX solution, wherein the siRNA solution in each hole is 4ul of siRNA +200ul of Opti-MEM culture medium, the transfection reagent solution in each hole is 6ul of RNAIMAX +200ul of Opti-MEM culture medium, standing for 5 minutes at room temperature after preparation, then mixing the two, turning the two upside down and mixing the two evenly, and adding the two into a cell culture solution after standing for 15 minutes at room temperature. After 12 hours of siRNA transfection, the culture medium was changed to 1% ITS + 1% penicillin-streptomycin + high-sugar DMEM medium.

The results of screening target sequences that the siRNA can bind to EZH2-L are shown in table 1, wherein catgacttctgtgagctcattacgc is the best rat siRNA binding target selected, and the corresponding siRNA sequences are shown below (fig. 2A):

siEZH2-L:sense:5'-CAUGACUUCUGUGAGCUCAUUACGC-3',SEQ ID NO.2

antisense:5'-GCGUAAUGAGCUCACAGAAGUCAUGAU-3',SEQ ID NO.3

siEZH2-S:sense:5'-ACAUCAUGACUUCUUGUUCAGUGAC-3',SEQ ID NO.4

antisense:5'-GUCACUGAACAAGAAGUCAUGAUGUGC-3',SEQ ID NO.5。

TABLE 1

3. Establishing a model for inducing myocardial cell hypertrophy by phenylephrine

12 hours after siRNA transfection, the medium was changed to serum-containing DMEM medium and stimulated with Phenylephrine (PE), and cells were harvested after 36 hours.

Example 3 detection of two variable cleavage forms of the neonatal rat cardiomyocyte EZH2 EZH2-L and EZH2-S

1. RNA extraction

Rat cardiomyocytes were isolated and mRNA was extracted according to example 1. Adding 1ml of Trizol solution into the collected myocardial cells, repeatedly blowing on ice until the myocardial cells are fully lysed, standing for 5 minutes, adding 0.2ml of chloroform, violently shaking for 15-30 seconds, standing for 2-3 minutes, and centrifuging at 12000rpm x 15min at 4 ℃. The aqueous layer was pipetted into a fresh EP tube, 0.5ml isopropanol was added, the tube was gently mixed, allowed to stand at room temperature for 10 minutes, and centrifuged at 12000rpm x 10min at 4 ℃. The supernatant was discarded, 1ml of pre-cooled 75% ethanol was added to the pellet, the pellet was resuspended and washed thoroughly, and centrifuged at 12000rpm x 5min at 4 ℃. The supernatant was discarded, air dried, and an appropriate amount of DEPC water was added to promote RNA solubilization at 65 ℃. 2ul of RNA is taken for agarose gel electrophoresis to detect whether the RNA is successfully extracted, and the residual RNA is stored at the temperature of minus 80 ℃ when not used.

2. Reverse transcription PCR (RT-PCR)

Reverse transcription of mRNA into cDNA Using a reverse transcription kit from Thermo Fisher Scientific, Random primer was used as a primer. The reverse transcribed cDNA was diluted five times with ddH 2O. Reverse transcription PCR (RT-PCR) RT-PCR was performed using a primer EZH2-LS capable of simultaneously detecting EZH2-L and EZH2-S, using β -actin (β -actin) as an internal reference gene, followed by agarose gel electrophoresis. The detection primers are shown in Table 2. The results obtained are shown in FIG. 2B, two variable splicing forms EZH2-L and EZH2-S of EZH2 were detected in neonatal rat cardiomyocytes, and siEZH2-L and siEZH2-S knocked down the mRNA levels of EZH2-L and EZH2-S, respectively.

TABLE 2 RT-PCR primer sequences for EZH2-LS and beta-actin

mRNA levels were measured using Platinum II Taq hot start DNA polymerase reagent from Thermo Fisher Scientific, RT-PCR system as shown in Table 3.

TABLE 3 RT-PCR reaction System

Reaction conditions are as follows:

94℃4min；94℃20sec，60℃20sec，72℃20sec，35cycles，72℃5min。

example 4 real-time fluorescent quantitative PCR (qPCR) validation of EZH2-L and EZH2-S knockdown efficiency

The reverse transcribed cDNA was diluted five times with ddH 2O. Ezh2-L and Ezh2-S mRNA level detection primers are shown in Table 4. SYBR available from Thermo Fisher Scientific was used^TMThe Green reagent measures mRNA levels. The specific reaction system is shown in Table 5.

TABLE 4 qPCR primer sequences for EZH2-L and EZH2-S

TABLE 5 real-time fluorescent quantitative PCR reaction System

Reaction conditions are as follows:

10min at 95 ℃; dissolution curves were plotted at 95 ℃ for 10sec, 60 ℃ for 10sec, 72 ℃ for 10sec, 40cycles, 40 ℃ for 30sec, and the final data were expressed as 2^-△△CtAnd (6) carrying out analysis.

The expression level of mRNA of EZH2-L and EZH2-S is detected by a qPCR method, and the knocking efficiency of EZH2-L and EZH2-S is specifically knocked down by siRNA. As a result, as shown in FIG. 2C, EZH2-L and EZH2-S were knocked down by siEZH2-L and siEZH2-S, respectively, in neonatal rat cardiomyocytes.

Example 5 Effect of EZH2-L and EZH2-S knockdown on cardiomyocyte hypertrophy in neonatal rat cultured in vitro

After isolation of neonatal rat cardiomyocytes, mRNA levels of EZH2-L and EZH2-S were knocked down by cell transfection, respectively. Extracting myocardial tissues of each experimental group, extracting total RNA, and detecting myocardial hypertrophy and heart failure molecular markers by applying qPCR: atrial Natriuretic Peptide (ANP) and B-type natriuretic peptide (BNP), and the detection primers are shown in Table 6. Beta-actin (beta-actin) is used as an internal reference gene.

TABLE 6 qPCR primer sequences for ANP, BNP and beta-actin

As shown in fig. 3A and B, after the knockdown of EZH2-L variable splicing pattern, the levels of the phenylephrine-induced cardiomyocyte hypertrophy markers ANP, BNP were significantly reduced, indicating that EZH2-L variable splicing pattern can significantly reduce the level of cardiomyocyte hypertrophy. As shown in fig. 3C and D, the level of the markers ANP, BNP for the phenylephrine-induced myocardial cell hypertrophy in the group was significantly increased after the knock-down of the EZH2-S variable cleavage form, indicating that the EZH2-S variable cleavage form can significantly aggravate the level of myocardial cell hypertrophy. The above results indicate that the different spliced forms of EZH2, EZH2-L and EZH2-S, play important regulatory roles in the pathogenesis of cardiac hypertrophy and heart failure.

Example 6 Effect of EZH2-L and EZH2-S knockdown on cardiomyocyte area in neonatal rat cultured in vitro

After isolation of neonatal rat cardiomyocytes, mRNA levels of EZH2-L and EZH2-S were knocked down by cell transfection, respectively. Cell area of cardiomyocyte hypertrophy was detected by WGA staining. The cardiomyocytes treated in the six-well plate were washed once with PBS and fixed with tissue fixative for 10min at room temperature. The fixative was aspirated off, and gently rinsed three times with PBS for 5 min/time. Penetrate 5min at room temperature with 0.2% Triton X-100, stain with FITC-labeled Wheat germ agglutinin (Wheat germ aglutinin, WGA) for 15min at 37 deg.C, and stain nuclei with DAPI for 10 min. After the photographing, the myocardial cell cross-sectional area was calculated using an Image acquisition digital analysis system (Image J).

As shown in fig. 4, after knockdown of EZH2-L variable scission form, the area of cardiomyocytes in the phenylephrine-induced group was significantly reduced as shown in fig. 4A and B. As shown in fig. 4A and C, after EZH2-S variable shear form knockdown, the area of cardiomyocytes in the phenylephrine-induced group was significantly increased. The results show that the knockdown of EZH2-L and EZH2-S can affect the cell area of the myocardial cells of the new rat induced by phenylephrine to be fat. FIG. 4A is a representative WGA staining pattern; FIGS. 4B and C are statistics of cell area.

Example 7 Effect of specific knockdown of EZH2-L and EZH2-S on aortic stenosis induced myocardial hypertrophy and Heart failure

1. Adeno-associated virus packaging

The eukaryotic expression plasmid containing EZH2-L and EZH2-S fragments is constructed by using pHBAAV-CMV-MCS-3flag-T2A-ZsGreen plasmid vector by referring to EZH2-L and EZH2-S sequences of mice by Hancheng Biotech (Shanghai) Limited company, and the plasmid is packaged into adeno-associated virus AAV9-shEZH2-L and AAV9-shEZH2-S, while the unloaded pHBAAV-CMV-3 flag-T2A-ZsGreen plasmid is packaged into adeno-associated virus AAV9-shRNA as a control. At 8 weeks, mice were infected with EZH2-L and EZH2-S specific AAV9-shRNA (AAV9-shEZH2-L/AAV9-shEZH2-S) by tail vein injection. Aortic stenosis after three weeks induced myocardial hypertrophy and heart failure.

2. Aortic coarctation (TAC operation) for establishing mouse myocardial hypertrophy and heart failure model

The heart is most likely to induce the formation of ventricular hypertrophy under long-term pressure load, and compensatory myocardial hypertrophy appears. The mice were anesthetized with sodium pentobarbital, the trachea cannula was connected to a mouse ventilator, the thoracic cavity was opened horizontally along the 2 nd to 3 rd intercostal space, the thoracic aorta was isolated, the 27 th needle was ligated together with the aorta with 7-0 surgical suture, and then the needle was withdrawn, resulting in about 70% aortic stenosis. Sham control (Sham) was not ligated and other procedures were the same. Heart morphology was observed 8 weeks post-surgery and heart weight was measured.

As shown in the representative cardiac picture of FIG. 5A and the statistical results of the heart-to-weight ratio (mg/g) of FIG. 5B, the knock-down of EZH2-L can suppress the occurrence of myocardial hypertrophy and heart failure, while the knock-down of EZH2-S can promote the occurrence of myocardial hypertrophy and heart failure. FIG. 5C shows the qPCR validation results of the specific knockdown of EZH2-L and EZH2-S by AAV9-shRNA, respectively.

Example 8 Effect of specific knockdown of Ezh2-L and Ezh2-S on tumor cells

1. Tumor cell culture

Three cervical cancer cells Hela, SiHa, and CaSki were counted and seeded into six well plates at approximately 0.5X 10 cells per well⁶The culture solution is 10% FBS, 1% penicillin-streptomycin solution and high-glucose DMEM culture medium.

2. siRNA transfection

After overnight, siRNA transfection was carried out, each well of siRNA solution was 4ul siRNA +200ul Opti-MEM medium, each well of transfection reagent solution was 6ul RNAImax +200ul Opti-MEM medium, and after preparation, the two were allowed to stand at room temperature for 5 minutes, mixed and mixed upside down, and after standing at room temperature for 15 minutes, the mixture was added to the cell culture solution. After 8 hours of transfection, the medium was changed to 10% FBS + 1% penicillin-streptomycin solution + high-sugar DMEM medium. The plates were incubated in an incubator for 24, 48, 72 hours (at 37 ℃, 5% CO 2). The sequences of the selected siRNAs against the human EZH2 sequence are shown as follows:

siEZH2-L:sense:5'-CUGACUUCUGUGAGCUCAUUGCGCG-3',SEQ ID NO.24

antisense:5'-CGCGCAAUGAGCUCACAGAAGUCAGGA-3',SEQ ID NO.25

siEZH2-S:sense:5'-CCUGACUUCUUGUUCGGUGAC-3',SEQ ID NO.26

antisense:5'-CACCGAACAAGAAGUCAGGAU-3',SEQ ID NO.27。

3. CCK-8 detection

Proliferation of tumor cells was detected using CCK-8 Kit (CCK-8Cell Counting Kit, Solarbio). 100 μ L of siRNA transfected cell suspension was prepared in 96-well plates. To each well was added 10. mu.L of CCK8 solution. The plates were incubated in an incubator for 2 hours. Absorbance at 450nm was measured with a microplate reader.

As shown in FIG. 6, three cervical cancer cells Hela (A), SiHa (B) and CaSki (C) result that the knocking-down of EZH2-L can significantly increase the proliferation of tumor cells, while the knocking-down of EZH2-S has no obvious effect on the proliferation of tumor cells.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Wuhan university

<120> EZH2 variable shear body and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtgagctcat tgcgcgggac tagggag 27

<210> 2

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caugacuucu gugagcucau uacgc 25

<210> 3

<211> 27

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcguaaugag cucacagaag ucaugau 27

<210> 4

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acaucaugac uucuuguuca gugac 25

<210> 5

<211> 27

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gucacugaac aagaagucau gaugugc 27

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggaagcagcg aaggatacag 20

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctgttgtaa gggagaccaa gaa 23

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtgagctcat tacgcgggac t 21

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tatgggcacc gatgcgacag catt 24

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

catcatgact tcttgttcag tg 22

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gtgccatcct gatccagaac t 21

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atacagtgcg gtgtccaaca 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agccctcagt ttgcttttca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cagctctcaa aggaccaagg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gcagcttgaa ctatgtgcca 20

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

catcatgact tcttgttcag tg 22

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtgccatcct gatccagaac t 21

<210> 18

<211> 2654

<212> DNA

<213> Human

<400> 18

gtttggcgct cggtccggtc gcgtccgaca cccggtggga ctcagaaggc agtggagccc 60

cggcggcggc ggcggcggcg cgcgggggcg acgcgcggga acaacgcgag tcggcgcgcg 120

ggacgaagaa taatcatggg ccagactggg aagaaatctg agaagggacc agtttgttgg 180

cggaagcgtg taaaatcaga gtacatgcga ctgagacagc tcaagaggtt cagacgagct 240

gatgaagtaa agagtatgtt tagttccaat cgtcagaaaa ttttggaaag aacggaaatc 300

ttaaaccaag aatggaaaca gcgaaggata cagcctgtgc acatcctgac ttctgtgagc 360

tcattgcgcg ggactaggga gtgttcggtg accagtgact tggattttcc aacacaagtc 420

atcccattaa agactctgaa tgcagttgct tcagtaccca taatgtattc ttggtctccc 480

ctacagcaga attttatggt ggaagatgaa actgttttac ataacattcc ttatatggga 540

gatgaagttt tagatcagga tggtactttc attgaagaac taataaaaaa ttatgatggg 600

aaagtacacg gggatagaga atgtgggttt ataaatgatg aaatttttgt ggagttggtg 660

aatgcccttg gtcaatataa tgatgatgac gatgatgatg atggagacga tcctgaagaa 720

agagaagaaa agcagaaaga tctggaggat caccgagatg ataaagaaag ccgcccacct 780

cggaaatttc cttctgataa aatttttgaa gccatttcct caatgtttcc agataagggc 840

acagcagaag aactaaagga aaaatataaa gaactcaccg aacagcagct cccaggcgca 900

cttcctcctg aatgtacccc caacatagat ggaccaaatg ctaaatctgt tcagagagag 960

caaagcttac actcctttca tacgcttttc tgtaggcgat gttttaaata tgactgcttc 1020

ctacatcgta agtgcaatta ttcttttcat gcaacaccca acacttataa gcggaagaac 1080

acagaaacag ctctagacaa caaaccttgt ggaccacagt gttaccagca tttggaggga 1140

gcaaaggagt ttgctgctgc tctcaccgct gagcggataa agaccccacc aaaacgtcca 1200

ggaggccgca gaagaggacg gcttcccaat aacagtagca ggcccagcac ccccaccatt 1260

aatgtgctgg aatcaaagga tacagacagt gatagggaag cagggactga aacgggggga 1320

gagaacaatg ataaagaaga agaagagaag aaagatgaaa cttcgagctc ctctgaagca 1380

aattctcggt gtcaaacacc aataaagatg aagccaaata ttgaacctcc tgagaatgtg 1440

gagtggagtg gtgctgaagc ctcaatgttt agagtcctca ttggcactta ctatgacaat 1500

ttctgtgcca ttgctaggtt aattgggacc aaaacatgta gacaggtgta tgagtttaga 1560

gtcaaagaat ctagcatcat agctccagct cccgctgagg atgtggatac tcctccaagg 1620

aaaaagaaga ggaaacaccg gttgtgggct gcacactgca gaaagataca gctgaaaaag 1680

gacggctcct ctaaccatgt ttacaactat caaccctgtg atcatccacg gcagccttgt 1740

gacagttcgt gcccttgtgt gatagcacaa aatttttgtg aaaagttttg tcaatgtagt 1800

tcagagtgtc aaaaccgctt tccgggatgc cgctgcaaag cacagtgcaa caccaagcag 1860

tgcccgtgct acctggctgt ccgagagtgt gaccctgacc tctgtcttac ttgtggagcc 1920

gctgaccatt gggacagtaa aaatgtgtcc tgcaagaact gcagtattca gcggggctcc 1980

aaaaagcatc tattgctggc accatctgac gtggcaggct gggggatttt tatcaaagat 2040

cctgtgcaga aaaatgaatt catctcagaa tactgtggag agattatttc tcaagatgaa 2100

gctgacagaa gagggaaagt gtatgataaa tacatgtgca gctttctgtt caacttgaac 2160

aatgattttg tggtggatgc aacccgcaag ggtaacaaaa ttcgttttgc aaatcattcg 2220

gtaaatccaa actgctatgc aaaagttatg atggttaacg gtgatcacag gataggtatt 2280

tttgccaaga gagccatcca gactggcgaa gagctgtttt ttgattacag atacagccag 2340

gctgatgccc tgaagtatgt cggcatcgaa agagaaatgg aaatcccttg acatctgcta 2400

cctcctcccc cctcctctga aacagctgcc ttagcttcag gaacctcgag tactgtgggc 2460

aatttagaaa aagaacatgc agtttgaaat tctgaatttg caaagtactg taagaataat 2520

ttatagtaat gagtttaaaa atcaactttt tattgccttc tcaccagctg caaagtgttt 2580

tgtaccagtg aatttttgca ataatgcagt atggtacatt tttcaacttt gaataaagaa 2640

tacttgaact tgtc 2654

<210> 19

<211> 2627

<212> DNA

<213> Human

<400> 19

gtttggcgct cggtccggtc gcgtccgaca cccggtggga ctcagaaggc agtggagccc 60

cggcggcggc ggcggcggcg cgcgggggcg acgcgcggga acaacgcgag tcggcgcgcg 120

ggacgaagaa taatcatggg ccagactggg aagaaatctg agaagggacc agtttgttgg 180

cggaagcgtg taaaatcaga gtacatgcga ctgagacagc tcaagaggtt cagacgagct 240

gatgaagtaa agagtatgtt tagttccaat cgtcagaaaa ttttggaaag aacggaaatc 300

ttaaaccaag aatggaaaca gcgaaggata cagcctgtgc acatcctgac ttcttgttcg 360

gtgaccagtg acttggattt tccaacacaa gtcatcccat taaagactct gaatgcagtt 420

gcttcagtac ccataatgta ttcttggtct cccctacagc agaattttat ggtggaagat 480

gaaactgttt tacataacat tccttatatg ggagatgaag ttttagatca ggatggtact 540

ttcattgaag aactaataaa aaattatgat gggaaagtac acggggatag agaatgtggg 600

tttataaatg atgaaatttt tgtggagttg gtgaatgccc ttggtcaata taatgatgat 660

gacgatgatg atgatggaga cgatcctgaa gaaagagaag aaaagcagaa agatctggag 720

gatcaccgag atgataaaga aagccgccca cctcggaaat ttccttctga taaaattttt 780

gaagccattt cctcaatgtt tccagataag ggcacagcag aagaactaaa ggaaaaatat 840

aaagaactca ccgaacagca gctcccaggc gcacttcctc ctgaatgtac ccccaacata 900

gatggaccaa atgctaaatc tgttcagaga gagcaaagct tacactcctt tcatacgctt 960

ttctgtaggc gatgttttaa atatgactgc ttcctacatc gtaagtgcaa ttattctttt 1020

catgcaacac ccaacactta taagcggaag aacacagaaa cagctctaga caacaaacct 1080

tgtggaccac agtgttacca gcatttggag ggagcaaagg agtttgctgc tgctctcacc 1140

gctgagcgga taaagacccc accaaaacgt ccaggaggcc gcagaagagg acggcttccc 1200

aataacagta gcaggcccag cacccccacc attaatgtgc tggaatcaaa ggatacagac 1260

agtgataggg aagcagggac tgaaacgggg ggagagaaca atgataaaga agaagaagag 1320

aagaaagatg aaacttcgag ctcctctgaa gcaaattctc ggtgtcaaac accaataaag 1380

atgaagccaa atattgaacc tcctgagaat gtggagtgga gtggtgctga agcctcaatg 1440

tttagagtcc tcattggcac ttactatgac aatttctgtg ccattgctag gttaattggg 1500

accaaaacat gtagacaggt gtatgagttt agagtcaaag aatctagcat catagctcca 1560

gctcccgctg aggatgtgga tactcctcca aggaaaaaga agaggaaaca ccggttgtgg 1620

gctgcacact gcagaaagat acagctgaaa aaggacggct cctctaacca tgtttacaac 1680

tatcaaccct gtgatcatcc acggcagcct tgtgacagtt cgtgcccttg tgtgatagca 1740

caaaattttt gtgaaaagtt ttgtcaatgt agttcagagt gtcaaaaccg ctttccggga 1800

tgccgctgca aagcacagtg caacaccaag cagtgcccgt gctacctggc tgtccgagag 1860

tgtgaccctg acctctgtct tacttgtgga gccgctgacc attgggacag taaaaatgtg 1920

tcctgcaaga actgcagtat tcagcggggc tccaaaaagc atctattgct ggcaccatct 1980

gacgtggcag gctgggggat ttttatcaaa gatcctgtgc agaaaaatga attcatctca 2040

gaatactgtg gagagattat ttctcaagat gaagctgaca gaagagggaa agtgtatgat 2100

aaatacatgt gcagctttct gttcaacttg aacaatgatt ttgtggtgga tgcaacccgc 2160

aagggtaaca aaattcgttt tgcaaatcat tcggtaaatc caaactgcta tgcaaaagtt 2220

atgatggtta acggtgatca caggataggt atttttgcca agagagccat ccagactggc 2280

gaagagctgt tttttgatta cagatacagc caggctgatg ccctgaagta tgtcggcatc 2340

gaaagagaaa tggaaatccc ttgacatctg ctacctcctc ccccctcctc tgaaacagct 2400

gccttagctt caggaacctc gagtactgtg ggcaatttag aaaaagaaca tgcagtttga 2460

aattctgaat ttgcaaagta ctgtaagaat aatttatagt aatgagttta aaaatcaact 2520

ttttattgcc ttctcaccag ctgcaaagtg ttttgtacca gtgaattttt gcaataatgc 2580

agtatggtac atttttcaac tttgaataaa gaatacttga acttgtc 2627

<210> 20

<211> 2680

<212> DNA

<213> mouse

<400> 20

gcgtttggcg ctcggtccgg tcgcgtccga cacccagtgg gacatcgaag gcagtggagt 60

cccggcggcg gcggtggcgg tggcggcggg ttgggggcga cgcgcgggag aggcgcgggc 120

tggcgcgcgg gacgaagaat aatcatgggc cagactggga agaaatctga gaagggaccg 180

gtttgttggc ggaagcgtgt aaaatcagag tacatgagac tgagacagct caagaggttc 240

agaagagctg atgaagtaaa gactatgttt agttccaatc gtcagaaaat tttggaaaga 300

actgaaacct taaaccaaga gtggaagcag cggaggatac agcctgtgca catcatgact 360

tctgtgagct cattgcgcgg gactagggag tgttcagtca ccagtgactt ggattttcca 420

gcacaagtca tcccgttaaa gaccctgaat gcagtcgcct cggtgcctat aatgtactct 480

tggtcgccct tacaacagaa ttttatggtg gaagacgaaa ctgttttaca taacattcct 540

tatatggggg atgaagttct ggatcaggat ggcactttca ttgaagaact aataaaaaat 600

tatgatggaa aagtgcatgg tgacagagaa tgtggattta taaatgatga aatttttgtg 660

gagttggtaa atgctcttgg tcaatataat gatgatgatg atgacgatga tggagatgat 720

ccagatgaaa gagaagaaaa acagaaagat ctagaggata atcgagatga taaagaaact 780

tgcccacctc ggaaatttcc tgctgataaa atatttgaag ccatttcctc aatgtttcca 840

gataagggca ccgcagaaga actgaaagaa aaatataaag aactcacgga gcagcagctc 900

ccaggtgctc tgcctcctga atgtactcca aacatcgatg gaccaaatgc caaatctgtt 960

cagagggagc aaagcttgca ttcatttcat acgctcttct gtcgacgatg ttttaagtat 1020

gactgcttcc tacatcgtaa gtgcagttat tccttccatg caacacccaa cacatataag 1080

aggaagaaca cagaaacagc tttggacaac aagccttgtg gaccacagtg ttaccagcat 1140

ctggagggag ctaaggagtt tgctgctgct cttactgctg agcgtataaa gacaccacct 1200

aaacgcccag ggggccgcag aagaggaaga cttccgaata acagtagcag acccagcacc 1260

cccaccatca gtgtgctgga gtcaaaggat acagacagtg acagagaagc agggactgaa 1320

actgggggag agaacaatga taaagaagaa gaagagaaaa aagatgagac gtccagctcc 1380

tctgaagcaa attctcggtg tcaaacacca ataaagatga agccaaatat tgaacctcct 1440

gagaatgtgg agtggagtgg tgctgaagcc tccatgttta gagtcctcat tggtacttac 1500

tacgataact tttgtgccat tgctaggcta attgggacca aaacatgtag acaggtgtat 1560

gagtttagag tcaaggagtc cagtatcata gcacctgttc ccactgagga tgtagacact 1620

cctccaagaa agaagaaaag gaaacatcgg ttgtgggctg cacactgcag aaagatacaa 1680

ctgaaaaagg acggctcctc taaccatgtt tacaactatc aaccctgtga ccatccacgg 1740

cagccttgtg acagttcgtg cccttgtgtg atagcacaaa atttttgtga aaagttttgt 1800

caatgtagtt cagagtgtca aaaccgcttt cctggatgtc ggtgcaaagc acaatgcaac 1860

accaaacagt gtccatgcta cctggctgtc cgagagtgtg accctgacct ctgtctcacg 1920

tgtggagctg ctgaccattg ggacagtaaa aatgtatcct gtaagaactg tagcattcag 1980

cggggctcta aaaagcactt actgctggca ccgtctgatg tggcaggctg gggcatcttt 2040

atcaaagatc ctgtacagaa aaatgaattc atctcagaat actgtgggga gattatttct 2100

caggatgaag cagacagaag aggaaaagtg tatgacaaat acatgtgcag ctttctgttc 2160

aacttgaaca atgattttgt ggtggatgca acccgaaagg gcaacaaaat tcgttttgct 2220

aatcattcag taaatccaaa ctgctatgca aaagttatga tggttaatgg tgaccacagg 2280

ataggcatct ttgctaagag ggctatccag actggtgaag agttgttttt tgattacaga 2340

tacagccagg ctgatgccct gaagtatgtg ggcatcgaac gagaaatgga aatcccttga 2400

catctactac ctcttcccct tctctctgaa acagctgcct tagcttcagg aaccttgagt 2460

actgtgggca atttagaaaa cggaaatgca gtttgaaatt ctgaatttgc aaagtactgt 2520

aacagtaatt tatagtaatg ttttaaaatc aactttttat tgccttctca ccagctgcaa 2580

agtgttttgt accagtgagt ttttgcaata atgcagtatg gtacattttt caaatttgaa 2640

taaagaatac ttgaacttgt tgttgaaaaa aaaaaaaaaa 2680

<210> 21

<211> 2653

<212> DNA

<213> mouse

<400> 21

gcgtttggcg ctcggtccgg tcgcgtccga cacccagtgg gacatcgaag gcagtggagt 60

cccggcggcg gcggtggcgg tggcggcggg ttgggggcga cgcgcgggag aggcgcgggc 120

tggcgcgcgg gacgaagaat aatcatgggc cagactggga agaaatctga gaagggaccg 180

gtttgttggc ggaagcgtgt aaaatcagag tacatgagac tgagacagct caagaggttc 240

agaagagctg atgaagtaaa gactatgttt agttccaatc gtcagaaaat tttggaaaga 300

actgaaacct taaaccaaga gtggaagcag cggaggatac agcctgtgca catcatgact 360

tcttgttcag tcaccagtga cttggatttt ccagcacaag tcatcccgtt aaagaccctg 420

aatgcagtcg cctcggtgcc tataatgtac tcttggtcgc ccttacaaca gaattttatg 480

gtggaagacg aaactgtttt acataacatt ccttatatgg gggatgaagt tctggatcag 540

gatggcactt tcattgaaga actaataaaa aattatgatg gaaaagtgca tggtgacaga 600

gaatgtggat ttataaatga tgaaattttt gtggagttgg taaatgctct tggtcaatat 660

aatgatgatg atgatgacga tgatggagat gatccagatg aaagagaaga aaaacagaaa 720

gatctagagg ataatcgaga tgataaagaa acttgcccac ctcggaaatt tcctgctgat 780

aaaatatttg aagccatttc ctcaatgttt ccagataagg gcaccgcaga agaactgaaa 840

gaaaaatata aagaactcac ggagcagcag ctcccaggtg ctctgcctcc tgaatgtact 900

ccaaacatcg atggaccaaa tgccaaatct gttcagaggg agcaaagctt gcattcattt 960

catacgctct tctgtcgacg atgttttaag tatgactgct tcctacatcg taagtgcagt 1020

tattccttcc atgcaacacc caacacatat aagaggaaga acacagaaac agctttggac 1080

aacaagcctt gtggaccaca gtgttaccag catctggagg gagctaagga gtttgctgct 1140

gctcttactg ctgagcgtat aaagacacca cctaaacgcc cagggggccg cagaagagga 1200

agacttccga ataacagtag cagacccagc acccccacca tcagtgtgct ggagtcaaag 1260

gatacagaca gtgacagaga agcagggact gaaactgggg gagagaacaa tgataaagaa 1320

gaagaagaga aaaaagatga gacgtccagc tcctctgaag caaattctcg gtgtcaaaca 1380

ccaataaaga tgaagccaaa tattgaacct cctgagaatg tggagtggag tggtgctgaa 1440

gcctccatgt ttagagtcct cattggtact tactacgata acttttgtgc cattgctagg 1500

ctaattggga ccaaaacatg tagacaggtg tatgagttta gagtcaagga gtccagtatc 1560

atagcacctg ttcccactga ggatgtagac actcctccaa gaaagaagaa aaggaaacat 1620

cggttgtggg ctgcacactg cagaaagata caactgaaaa aggacggctc ctctaaccat 1680

gtttacaact atcaaccctg tgaccatcca cggcagcctt gtgacagttc gtgcccttgt 1740

gtgatagcac aaaatttttg tgaaaagttt tgtcaatgta gttcagagtg tcaaaaccgc 1800

tttcctggat gtcggtgcaa agcacaatgc aacaccaaac agtgtccatg ctacctggct 1860

gtccgagagt gtgaccctga cctctgtctc acgtgtggag ctgctgacca ttgggacagt 1920

aaaaatgtat cctgtaagaa ctgtagcatt cagcggggct ctaaaaagca cttactgctg 1980

gcaccgtctg atgtggcagg ctggggcatc tttatcaaag atcctgtaca gaaaaatgaa 2040

ttcatctcag aatactgtgg ggagattatt tctcaggatg aagcagacag aagaggaaaa 2100

gtgtatgaca aatacatgtg cagctttctg ttcaacttga acaatgattt tgtggtggat 2160

gcaacccgaa agggcaacaa aattcgtttt gctaatcatt cagtaaatcc aaactgctat 2220

gcaaaagtta tgatggttaa tggtgaccac aggataggca tctttgctaa gagggctatc 2280

cagactggtg aagagttgtt ttttgattac agatacagcc aggctgatgc cctgaagtat 2340

gtgggcatcg aacgagaaat ggaaatccct tgacatctac tacctcttcc ccttctctct 2400

gaaacagctg ccttagcttc aggaaccttg agtactgtgg gcaatttaga aaacggaaat 2460

gcagtttgaa attctgaatt tgcaaagtac tgtaacagta atttatagta atgttttaaa 2520

atcaactttt tattgccttc tcaccagctg caaagtgttt tgtaccagtg agtttttgca 2580

ataatgcagt atggtacatt tttcaaattt gaataaagaa tacttgaact tgttgttgaa 2640

aaaaaaaaaa aaa 2653

<210> 22

<211> 2809

<212> DNA

<213> mouse

<400> 22

gctgctgcgt ttggcgctcg gtccggtcgc gtccgacacc cagtgggaca tcgaaggcag 60

tggagtcccg gcggcggcgg cggcggcggc gcgttggggc ggcgcgcggg agaagcgcgg 120

gctggcgcgc gggacgaaga ataatcatgg gccagactgg gaagaaatct gagaagggac 180

cggtttgttg gcggaagcgt gtaaagtcag agtacatgag actgagacag ctcaagaggt 240

tcagaagagc tgacgaagta aagactatgt ttagttccaa tcgtcagaaa attttggaaa 300

gaactgaaac cttaaatcaa gaatggaagc agcgaaggat acagcctgtg cacatcatga 360

cttctgtgag ctcattacgc gggactaggg agtgttcagt gaccagtgac ttggattttc 420

cagcacaagt catcccgtta aagaccctaa atgctgtcgc atcggtgccc ataatgtatt 480

cttggtctcc cttacaacag aattttatgg tggaagatga aactgtttta cataacattc 540

cttatatggg ggatgaagtt ctggatcagg atggcacttt cattgaagaa ttaataaaaa 600

attatgatgg aaaagtgcat ggagacagag aatgtggatt tataaatgat gaaatttttg 660

tggagttggt aaatgctctt ggtcaatata atgatgatga cgatgatgat gatggagacg 720

atcctgatga aagagaagaa aaacagaaag atctagacga tagtcgagat gataaagaaa 780

cttgcccacc tcggaaattt cctgctgata aaatatttga agccatttcc tcaatgtttc 840

cagataaggg cacagcagaa gaactgaaag aaaagtataa agaactcacg gagcagcagc 900

tccccggtgc tctacctcct gaatgtaccc caaacatcga tggaccaaat gccaaatctg 960

ttcagaggga gcaaagttta cattcatttc atacgctctt ttgtcgacga tgttttaagt 1020

atgactgctt cctacatcgt aagtgcaatt attcctttca tgcaacaccc aacacatata 1080

agaggaagaa cacagaaaca gctctggaca acaagccttg tggaccacag tgttatcagc 1140

atctggaggg agctaaggag tttgctgctg cccttactgc tgagcggata aagacaccac 1200

ctaaacgtcc agggggccgc agaagaggaa gacttccgaa taacagtagc agacccagca 1260

cccccaccat cagtgtgctg gagtcaaagg atacagacag tgacagagaa gcagggactg 1320

aaaccggggg agagaacaac gataaagaag aagaagagaa aaaagatgag acttccagtt 1380

cctctgaagc aaattctcgg tgtcaaacac caataaagat gaagccaaat attgaacctc 1440

ctgagaatgt ggagtggagt ggtgctgaag cctccatgtt tagagtcctc attggtactt 1500

actacgataa cttttgtgcc attgctaggc taattgggac caaaacatgt agacaggtgt 1560

atgagtttag agtcaaagag tccagtatca tagcacctgt tcccactgag gatgtggaca 1620

ctcctccaag aaagaagaaa agaaaacatc ggttgtgggc tgcacactgc agaaagatcc 1680

aactgaaaaa ggacggctcc tctaaccatg tttacaacta tcaaccctgt gaccatccac 1740

ggcagccttg tgacagttcg tgcccttgtg tgatagcaca aaatttttgt gaaaagtttt 1800

gtcaatgtag ttcagagtgt caaaaccgct ttcctggatg ccggtgcaaa gcacaatgca 1860

acaccaagca gtgtccgtgc tacctggctg tccgagagtg tgatcctgac ctctgtctca 1920

cttgtggagc tgctgaccac tgggacagta aaaatgtgtc ctgcaagaac tgtagcattc 1980

agcggggctc taaaaagcac ttactgctgg caccgtctga tgtggcaggc tggggcatct 2040

ttatcaaaga tccagtacag aaaaatgaat tcatctcaga atactgtgga gagattattt 2100

ctcaggatga agcagacaga agagggaaag tgtatgacaa atacatgtgc agctttctgt 2160

tcaacttgaa caatgatttt gtggtggatg caacccgcaa gggcaacaaa attcgttttg 2220

ctaatcattc agtaaatcca aactgctatg caaaagttat gatggttaat ggtgaccaca 2280

ggataggcat ctttgctaag agagctatcc agactggtga agagttgttc tttgattaca 2340

gatacagcca ggctgatgcc ctgaagtatg tgggcatcga acgagaaatg gaaatccctt 2400

gaaatctact acctcttccc ctcctctcaa acagctgcct tagcttcagg aaccttgagt 2460

actgtgggca atttagaaaa aggaaatgca gtttgaaatt ttgaatttgc aaagtactgt 2520

aacagtaatt tatagtaatg agttttaaaa tcaacttttt attgccttct caccagctgc 2580

aaagtgtttt gtaccagtga atttttgcaa taatgcagta tggtacattt ttcaaatttg 2640

aataaagaat acttgaactt gttgttgagt cacttgttac agaacatcac caactgattc 2700

tagaaagact atatccagtg ggaaaacaca actcctcttt gtttttccag ctgtctgtga 2760

atatttaata actaataaac atactggcat agtgtttacc tagatccag 2809

<210> 23

<211> 2782

<212> DNA

<213> mouse

<400> 23

gctgctgcgt ttggcgctcg gtccggtcgc gtccgacacc cagtgggaca tcgaaggcag 60

tggagtcccg gcggcggcgg cggcggcggc gcgttggggc ggcgcgcggg agaagcgcgg 120

gctggcgcgc gggacgaaga ataatcatgg gccagactgg gaagaaatct gagaagggac 180

cggtttgttg gcggaagcgt gtaaagtcag agtacatgag actgagacag ctcaagaggt 240

tcagaagagc tgacgaagta aagactatgt ttagttccaa tcgtcagaaa attttggaaa 300

gaactgaaac cttaaatcaa gaatggaagc agcgaaggat acagcctgtg cacatcatga 360

cttcttgttc agtgaccagt gacttggatt ttccagcaca agtcatcccg ttaaagaccc 420

taaatgctgt cgcatcggtg cccataatgt attcttggtc tcccttacaa cagaatttta 480

tggtggaaga tgaaactgtt ttacataaca ttccttatat gggggatgaa gttctggatc 540

aggatggcac tttcattgaa gaattaataa aaaattatga tggaaaagtg catggagaca 600

gagaatgtgg atttataaat gatgaaattt ttgtggagtt ggtaaatgct cttggtcaat 660

ataatgatga tgacgatgat gatgatggag acgatcctga tgaaagagaa gaaaaacaga 720

aagatctaga cgatagtcga gatgataaag aaacttgccc acctcggaaa tttcctgctg 780

ataaaatatt tgaagccatt tcctcaatgt ttccagataa gggcacagca gaagaactga 840

aagaaaagta taaagaactc acggagcagc agctccccgg tgctctacct cctgaatgta 900

ccccaaacat cgatggacca aatgccaaat ctgttcagag ggagcaaagt ttacattcat 960

ttcatacgct cttttgtcga cgatgtttta agtatgactg cttcctacat cgtaagtgca 1020

attattcctt tcatgcaaca cccaacacat ataagaggaa gaacacagaa acagctctgg 1080

acaacaagcc ttgtggacca cagtgttatc agcatctgga gggagctaag gagtttgctg 1140

ctgcccttac tgctgagcgg ataaagacac cacctaaacg tccagggggc cgcagaagag 1200

gaagacttcc gaataacagt agcagaccca gcacccccac catcagtgtg ctggagtcaa 1260

aggatacaga cagtgacaga gaagcaggga ctgaaaccgg gggagagaac aacgataaag 1320

aagaagaaga gaaaaaagat gagacttcca gttcctctga agcaaattct cggtgtcaaa 1380

caccaataaa gatgaagcca aatattgaac ctcctgagaa tgtggagtgg agtggtgctg 1440

aagcctccat gtttagagtc ctcattggta cttactacga taacttttgt gccattgcta 1500

ggctaattgg gaccaaaaca tgtagacagg tgtatgagtt tagagtcaaa gagtccagta 1560

tcatagcacc tgttcccact gaggatgtgg acactcctcc aagaaagaag aaaagaaaac 1620

atcggttgtg ggctgcacac tgcagaaaga tccaactgaa aaaggacggc tcctctaacc 1680

atgtttacaa ctatcaaccc tgtgaccatc cacggcagcc ttgtgacagt tcgtgccctt 1740

gtgtgatagc acaaaatttt tgtgaaaagt tttgtcaatg tagttcagag tgtcaaaacc 1800

gctttcctgg atgccggtgc aaagcacaat gcaacaccaa gcagtgtccg tgctacctgg 1860

ctgtccgaga gtgtgatcct gacctctgtc tcacttgtgg agctgctgac cactgggaca 1920

gtaaaaatgt gtcctgcaag aactgtagca ttcagcgggg ctctaaaaag cacttactgc 1980

tggcaccgtc tgatgtggca ggctggggca tctttatcaa agatccagta cagaaaaatg 2040

aattcatctc agaatactgt ggagagatta tttctcagga tgaagcagac agaagaggga 2100

aagtgtatga caaatacatg tgcagctttc tgttcaactt gaacaatgat tttgtggtgg 2160

atgcaacccg caagggcaac aaaattcgtt ttgctaatca ttcagtaaat ccaaactgct 2220

atgcaaaagt tatgatggtt aatggtgacc acaggatagg catctttgct aagagagcta 2280

tccagactgg tgaagagttg ttctttgatt acagatacag ccaggctgat gccctgaagt 2340

atgtgggcat cgaacgagaa atggaaatcc cttgaaatct actacctctt cccctcctct 2400

caaacagctg ccttagcttc aggaaccttg agtactgtgg gcaatttaga aaaaggaaat 2460

gcagtttgaa attttgaatt tgcaaagtac tgtaacagta atttatagta atgagtttta 2520

aaatcaactt tttattgcct tctcaccagc tgcaaagtgt tttgtaccag tgaatttttg 2580

caataatgca gtatggtaca tttttcaaat ttgaataaag aatacttgaa cttgttgttg 2640

agtcacttgt tacagaacat caccaactga ttctagaaag actatatcca gtgggaaaac 2700

acaactcctc tttgtttttc cagctgtctg tgaatattta ataactaata aacatactgg 2760

catagtgttt acctagatcc ag 2782

<210> 24

<211> 25

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

cugacuucug ugagcucauu gcgcg 25

<210> 25

<211> 27

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cgcgcaauga gcucacagaa gucagga 27

<210> 26

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ccugacuucu uguucgguga c 21

<210> 27

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caccgaacaa gaagucagga u 21

<210> 28

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gtgagctcat tacgcgggac tagggag 27

Claims (7)

1. An EZH2 variable shear body, comprising: the splicing site is positioned at the first 27nt of the 3' end of the third exon of EZH2, so that the two variable spliceosomes obtained differ by 27nt, and the two variable spliceosomes with 27nt and deletion of 27nt are called EZH2-L and EZH2-S respectively; the 27nt sequence is gtgagctcattgcgcgggactagggag in mice and humans and gtgagctcattacgcgggactagggag in rats.

2. Use of the EZH2 variant clip of claim 1 in the manufacture of a medicament for the treatment of at least one of myocardial hypertrophy, heart failure, cardiovascular disease and tumors.

3. Use according to claim 2, characterized in that: the medicament comprises an inhibitor of EZH2-L and/or an agonist of EZH 2-S.

4. Use according to claim 3, characterized in that: the inhibitor of EZH2-L is preferably one of siRNA of EZH2-L gene, RNA interference vector of EZH2-L gene or antibody of EZH2-L and other inhibitors capable of inhibiting the expression of EZH 2-L; the agonist of the EZH2-S is preferably one of an overexpression plasmid of the EZH2-S gene and an agonist capable of promoting the expression of the EZH 2-S.

5. Use of the EZH2 variant splice of claim 1 as a drug target or a target gene in gene therapy for screening or preparing a medicament for the treatment of at least one of myocardial hypertrophy, heart failure, cardiovascular disease and tumors.

6. The use of the EZH2 variant splice of claim 1 to construct an in vitro cell or animal model of EZH2-L and/or EZH2-S gene expression for screening a medicament for preventing, ameliorating and/or treating at least one of myocardial hypertrophy, heart failure, cardiovascular disease and tumors.

Use of an inhibitor of EZH2-L and/or an agonist of EZH2-S for the preparation of a medicament for the treatment of at least one of myocardial hypertrophy, heart failure, cardiovascular disease and tumors.

Images