CN103656673B - The purposes and its related drugs of people's YWHAQ genes - Google Patents
The purposes and its related drugs of people's YWHAQ genes Download PDFInfo
- Publication number
- CN103656673B CN103656673B CN201210313878.1A CN201210313878A CN103656673B CN 103656673 B CN103656673 B CN 103656673B CN 201210313878 A CN201210313878 A CN 201210313878A CN 103656673 B CN103656673 B CN 103656673B
- Authority
- CN
- China
- Prior art keywords
- ywhaq
- genes
- sequence
- plko
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses the purposes of people's YWHAQ genes and its related drugs.The invention discloses purposes of the people YWHAQ genes in oncotherapy, diagnosing tumor and medicine preparation.The present invention also further constructs people's YWHAQ genes small molecules interference RNA, people's YWHAQ gene RNAs construct, people YWHAQ genes interference slow virus and discloses their purposes.The siRNA that the present invention is provided or the nucleic acid construct comprising the siRNA sequence, slow virus are capable of the expression of specificity suppression people's YWHAQ genes, especially slow virus, target cell can efficiently be infected, expeditiously suppress the expression of YWHAQ genes in target cell, and then suppress the growth of tumour cell, promote apoptosis of tumor cells, it is significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to the purposes and its related drugs of people's YWHAQ genes.
Background technology
The RNA interference（RNA interference,RNAi）Phenomenon refers to work as and endogenous mRNA code areas section sequence
The homologous double-stranded RNA of row（dsRNA）Import after cell, selective degradation occurs for the mRNA, and causes the silence of the gene expression.
Research shows, length can cause RNAi transcription and post-transcriptional level are specific for 21-23nt double-stranded RNA（Tuschl
T,Zamore PD,Sharp PA,Bartel DP.RNAi:double-stranded RNA directs the ATP-
dependent cleavage of mRNA at 21to 23nucleotide intervals.Cell 2000;101:25-
33.）.Tumour is the principal disease for threatening human health.Though tumor patient is through chemotherapy, radiotherapy and complex treatment, survive within 5 years
Rate is still very low, if the gene relevant with progress to tumor invasion is intervened, and will be able to be that new way is opened up in the treatment of tumour.Closely
The available strategy of Nian Lai, the RNAi gene therapy as tumour.It can suppress proto-oncogene, the suppression being mutated using RNAi technology
The expression of oncogene, Cell cycle-related genes, anti-apoptotic related gene etc. suppresses the occurrence and development of tumour
（Uprichard,Susan L.The therapeutic potential of RNA interference.FEBS Letters
2005;579:5996-6007.）.
14-3-3 albumen is a highly conserved protein family, be one can be with self-assemble into the multi-functional of dimer
Albumen（Aitken A.14-3-3proteins:a historic overview.Semin Cancer Biol 2006;16:
162–72.）.14-3-3 albumen is distributed widely in from plant to mammal etc. in all eucaryotes, initially in cerebrospinal fluid
The relative high abundance expression of 14-3-3 albumen is detected in extract.The 14-3-3 protein families of people include 7 hypotypes, beta,
Gamma, epsilon, sigma, zeta, theta and eta, by 7 kinds of different gene codes, these gene outcomes participate in being permitted
Many cells process, such as signal are changed, stimulation responses, Apoptosis, transcriptional control, regulation cell adherence and motion（Zha J,
Harada H,Yang E,Jockel J,Korsmeyer SJ.Serine phosphorylation of death agonist
BAD in response to survival factor results in binding to 14-3-3not BCL-X(L)
.Cell.1996;87:619-28.Nufer O,Hauri HP.ER export:call 14-3-3.Curr Biol.2003;
13:R391–3.DoughertyMK,Morrison DK.Unlocking the code of 14-3-3.J Cell
Sci.2004;117:1875–84.）.14-3-3 albumen plays important pivotal role in cell cycle regulating, its exception table
Up to may cause a variety of diseases, in addition malignant tumour generation（Hermeking H.The 14-3-3cancer
connection.Nat Rev Cancer.2003;3(12):931-943.）.
YWHAQ gene encoding productions are a member in 14-3-3 protein families, are cloned from human myeloid's cDNA library
Obtain, also known as 14-3-3theta.YWHAQ genes are detected in the lumbar spinal cord of the patient of amyotrophic lateral sclerosis
Up-regulated expression, the gene 5 ' noncoding region is found that the 6bp of multiple series connection sequence, but the number and disease of repetitive sequence
Between be not in contact with（Malaspina A,Kaushik N,de Belleroche J.A 14-3-3mRNA is up-
regulated in amyotrophic lateral sclerosis spinal cord.J Neurochem.2000;75
(6):2511–20.）.Up to the present, YWHAQ is less in the research report of tumour association area, the report such as Sandra, in people
In cancerous lung tissue, by the method for reverse transcription PCR and Western blot, the expression of 7 kinds of 14-3-3 genes can be detected, and
In people normal lung tissue, only two kinds genes epsilon, zeta have expression (Qi W, Liu X, Qiao D, Martinez
JD.Isoform-specific expression of 14-3-3proteins in human lung cancer
tissues.Int J Cancer.2005;113:359–63.).But detected in the biological tissue of adenocarcinoma of lung and squamous cell carcinoma
In, it can also detect beta, gamma, sigma, theta expression (Pereira-faca AR, Kuick R, Puravs E, et
al.Identification of 14-3-3θas an Antigen that Induces a Humoral Response in
Lung Cancer.Cancer Res.2007;67(24):12000-6.).Meanwhile, Liu etc., which is reported in mankind's meningioma, to be examined
The specific expressed of 14-3-3epsilon, zeta and theta is measured, and expression increases with the pathological grade of meningioma
Plus and increase（Liu Y,Tian RF,Liu WP,Cao L,Cao WD and Zhang X.The expression of
seven 14-3-3isoforms in human meningioma.Brain Res.2010;1336:98-102.）.
Research prompting, 14-3-3theta above（YWHAQ）May take part in the occurrence and development of some tumours, but its
Role in tumour does not illustrate.Therefore, it is necessary to further investigate regulatory functions of the YWHAQ in tumour generation, the present invention chooses
Lung cancer and glioma cell model, using effects of the RNAi as means research YWHAQ in lung cancer and glioma occurrence and development.
The content of the invention
It is an object of the invention to open and people YWHAQ（tyrosine 3-monooxygenase/tryptophan5-
monooxygenase activation protein,theta polypeptide）The treatment method and medicine of gene-correlation,
Disturbed with RNA（RNAi）For effect of the means research YWHAQ genes in the survival and apoptotic process of tumour cell.
First aspect present invention, using RNA interference as means, have studied work of the YWHAQ genes in tumour occurrence and development
With, disclose it is a kind of suppress or reduction growth of tumour cell, propagation, differentiation and/or the method survived, this method includes：To swollen
Oncocyte is capable of transcription or translation that specificity suppresses YWHAQ genes using a kind of, or is capable of specificity suppression YWHAQ albumen
Expression or the molecule of activity, suppress growth, propagation, differentiation and/or the survival of tumour cell with this.
The tumour cell is selected from expression or active related tumour cell of its growth to YWHAQ albumen.Preferably, institute
State tumour cell be selected from lung cancer, glioma it is any.
In suppression or the reduction growth of tumour cell, propagation, differentiation and/or the method for survival, the administration of the molecule
Measure as the transcription or translation of reduction YWHAQ genes enough, or the dosage of the expression of reduction YWHAQ albumen or activity enough.Enter
One step, the expression of the YWHAQ genes is at least lowered 50%, 80%, 90%, 95% or 99%.
The molecule may be selected from but be not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine,
Polypeptide, albumen or interference slow virus.
The nucleic acid includes but is not limited to：ASON, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence or YWHAQ genes of YWHAQ genes
Information sequence.
Further, the double-stranded RNA is siRNA（siRNA）.The siRNA includes the first chain and second
Chain, first chain and the second chain complementation are collectively forming RNA dimers, and the sequence and YWHAQ bases of first chain
15-27 continuous nucleotide sequences are essentially identical because in.The small molecules interference RNA can be specifically bound coded by target sequence
MRNA fragments, and the expression of specific silence people's YWHAQ genes.
Further, the first chain-ordering of the siRNA and target sequence in YWHAQ genes are essentially identical.It is more excellent
, the target sequence in the YWHAQ genes contains SEQ ID NO:Any sequence in 1-16.
Target sequence in the YWHAQ genes is the specific silence YWHAQ gene expressions of the small molecules interference RNA
When, with described small molecules interference RNA it is complementary with reference to mRNA fragments corresponding to YWHAQ genes in fragment.
Preferably, the YWHAQ gene sources are in people.
The people YWHAQ genes that first aspect present invention also discloses a kind of separation are preparing or screened anti-tumor medicine,
Or the purposes in diagnosing tumor medicine is prepared.
Further, the tumour is selected from lung cancer or glioma.
The YWHAQ genes by separation include both sides content for preparing or screening anti-tumor medicine：First,
It is applied to prepare anti-tumor medicine or preparation for the action target of tumour cell using YWHAQ genes as medicine or preparation；
Second, using YWHAQ genes as medicine or preparation for the action target of tumour cell be applied to screening anti-tumor medicine or
Preparation.
It is described to be applied to prepare oncotherapy for the action target of tumour cell using YWHAQ genes as medicine or preparation
Medicine or preparation are specifically referred to：Using YWHAQ genes as RNA interference effects target, to develop the medicine for tumour cell
Or preparation, so as to reduce the expression of YWHAQ genes in tumour cell.
It is described that YWHAQ genes are applied to screening oncotherapy as medicine or preparation for the action target of tumour cell
Medicine or preparation are specifically referred to：Using YWHAQ genes as effective object, medicine or preparation are screened, can be pressed down with finding
System promotes the medicine of people's YWHAQ gene expressions to be used as oncotherapy drug candidate.Small point of YWHAQ genes as described in the present invention
Sub- RNA interfering（siRNA）It is that screening is obtained by effective object of people YWHAQ genes, can be used as that there is suppression tumour cell
The medicine of proliferation function.In addition, such as antibody drug, small-molecule drug etc. also can using YWHAQ genes and its albumen as
Effective object.
It is described to be used to YWHAQ genes prepare diagnosing tumor medicine, refer to swollen using YWHAQ gene expression products as one
Knurl diagnosis index is applied to the preparation of diagnosing tumor medicine.
The anti-tumor medicine is to be capable of transcription or translation that specificity suppresses YWHAQ genes, or specific can be pressed down
The expression of YWHAQ albumen processed or the molecule of activity, so as to reduce the expression of YWHAQ genes in tumour cell, reach suppression
Propagation, growth, differentiation and/or the purpose of survival of tumour cell.
The anti-tumor medicine or diagnosing tumor medicine bag that prepared by the YWHAQ genes by separation or screening is obtained
Include but be not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine, polypeptide, albumen or the slow disease of interference
Poison.
The nucleic acid includes but is not limited to：ASON, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The amount of application of the anti-tumor medicine is reduces the transcription or translation of people's YWHAQ genes enough, or drops enough
The expression of low people YWHAQ albumen or the dosage of activity.Expression to make one YWHAQ genes is at least lowered 50%, 80%, 90%,
95% or 99%.
The method that tumour is treated using forgoing neoplasms medicine, mainly by reducing the expression water of people's YWHAQ genes
The propagation of tumour cell processed is stabilized to reach the purpose for the treatment of.Specifically, during treatment, can effectively reduce people's YWHAQ gene tables
Up to horizontal administering substances in patient.
Second aspect of the present invention discloses a kind of nucleic acid molecules of the separation of YWHAQ gene expressions in reduction tumour cell,
The nucleic acid molecules are included：
A) in double-stranded RNA, the double-stranded RNA containing can be under stringent condition with YWHAQ gene recombinations nucleotides sequence
Row；Or
B) in shRNA, the shRNA containing can be under stringent condition with YWHAQ gene recombinations nucleotide sequence.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary common
Form RNA dimers, and the sequence of first chain and 15-27 in the YWHAQ genes basic phases of continuous nucleotide sequence
Together.Preferably, the sequence of first chain and 19-23 in YWHAQ genes continuous nucleotide sequences are essentially identical；More preferably
, the sequence of first chain with 19 in YWHAQ genes, 20 or 21 continuous nucleotide sequences it is essentially identical.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain complementation are altogether
With forming RNA dimers, and the sequence of first chain and target sequence in YWHAQ genes are essentially identical.
Further, the shRNA includes positive-sense strand fragment and antisense strand fragment, and connect the positive-sense strand fragment and
The sequence of the loop-stem structure of antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and the positive-sense strand
The sequence of fragment and 15-27 in YWHAQ genes continuous nucleotide sequences are essentially identical.Can be into after the shRNA is processed
For siRNA（siRNA）And then play a part of endogenous YWHAQ gene expressions in specific silence tumour cell.
Further, the shRNA includes positive-sense strand fragment and antisense strand fragment, and connect the positive-sense strand fragment and
The sequence of the loop-stem structure of antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and the positive-sense strand
The sequence of fragment and target sequence in YWHAQ genes are essentially identical.
First chain of the double-stranded RNA or the positive-sense strand fragment of the shRNA and the basic phase of target sequence in YWHAQ genes
Together, when the target sequence of the YWHAQ genes is that siRNA is used for specific silence YWHAQ gene expressions, known by the siRNA
Not and silence mRNA fragments corresponding to YWHAQ genes in fragment.
Preferably, the target sequence in the YWHAQ genes contains SEQ ID NO:1-16 any sequence.
Further, the YWHAQ gene sources are in people.
The length of the chain of double-stranded RNA first and the second chain is 15-27 nucleotides；Preferably, length is 19-23
Individual nucleotides；Optimal, length is 19,20 or 21 nucleotides.
Further, the double-stranded RNA is siRNA（siRNA）.Further, the chain of siRNA first
Sequence such as SEQ ID NO：Shown in 28, specially 5 '-GCCCUAUGUAACAGCAGAGUA-3 '.
SEQ ID NO：SiRNA shown in 28 is with SEQ ID NO:Sequence shown in 16 is RNA interference target sequence designs
, a chain of siRNA for people's YWHAQ genes, another chain is that the sequence and the first chain-ordering of the second chain are complementary,
The siRNA can play a part of endogenous YWHAQ gene expressions in specific silence tumour cell.
Further, the sequence of the loop-stem structure of the shRNA may be selected from following any：UUCAAGAGA、AUG、CCC、
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of the shRNA such as SEQ ID NO:Shown in 29, it is specially：5’-
GCCCUAUGUAACAGCAGAGUAUUCAAGAGAUACUCUGCUGUUACAUAGGGC-3’。
ShRNA can turn into siRNA after being processed through digestion, and then play endogenous people in specific silence tumour cell
The effect of YWHAQ gene expressions.
The interference slow virus carrier for encoding shRNA of the present invention genetic fragment contains SEQ ID NO:Appointing in 1-16
One sequence and its complementary series.
Third aspect present invention, discloses a kind of YWHAQ genes RNA construct, containing coding of the present invention point
From nucleic acid molecules in shRNA genetic fragment, the shRNA can be expressed
Described people's YWHAQ gene RNA constructs can be by the foregoing people YWHAQ genes shRNA of coding gene
Fragment is cloned into known carrier acquisition.Further, the YWHAQ genes RNA construct is that the interference of YWHAQ genes is slow
Viral vector.
The YWHAQ genes interference slow virus carrier of the present invention is by the foregoing YWHAQ genes shRNA of coding DNA fragmentation gram
It is grand enter known carrier obtain, the known carrier is generally slow virus carrier, and YWHAQ genes interference slow virus carrier is by disease
Poison packaging turns into after infectious virion, infected tumor's cell, and then transcribes out shRNA of the present invention, passes through enzyme
The steps such as processing are cut, the siRNA are finally obtained, the expression for specific silence YWHAQ genes.
Further, the YWHAQ genes interference slow virus carrier also contains promoter sequence and/or codes for tumor cell
In the nucleotide sequence of label that can be detected；Preferably, the label the being detected such as green fluorescent protein
（GFP）.
Further, the slow virus carrier can be selected from：pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
The people YWHAQ genes interference slow virus that the embodiment of the present invention specifically lists using pGCSIL-GFP as vector construction carries
Body, is named as pGCSIL-GFP-YWHAQ-siRNA.
The nucleic acid molecules that the present invention is separated can be used for the medicine for preparing prevention or treatment tumour, and the tumour is lung cancer or glue
Matter knurl.
The YWHAQ gene siRNAs of the present invention can be used for the propagation for suppressing tumour cell, further may be used as treatment swollen
The medicine or preparation of knurl.YWHAQ genes interference slow virus carrier then can be used for preparing the YWHAQ gene siRNAs.When as controlling
It is that the nucleic acid molecules of safe and effective amount are applied to mammal when treating the medicine or preparation of tumour.Specific dosage should also
Method of administration, the factor such as patient health situation are considered, within the scope of these are all skilled practitioners technical ability.
Fourth aspect present invention, discloses a kind of YWHAQ genes interference slow virus, slow disease is disturbed by foregoing YWHAQ genes
Poisonous carrier is formed under slow virus packaging plasmid, the auxiliary of cell line by virus packaging.The slow virus can infected tumor's cell
And the small molecules interference RNA for being directed to YWHAQ genes is produced, so as to suppress the propagation of lung cancer or glioma tumor cell.The YWHAQ
Gene interference slow virus can be used for the medicine for preparing prevention or treatment tumour.
Fifth aspect present invention, discloses a kind of pharmaceutical composition for being used to preventing or treating tumour, and its active principle contains
There are the nucleic acid molecules of foregoing separation, YWHAQ gene RNA constructs, and/or YWHAQ genes interference slow virus.
Further, described pharmaceutical composition contains double-stranded RNA described in 1~99wt%, shRNA, YWHAQ gene interference core
Acid con-struct or YWHAQ genes interference slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositions, generally active component is mixed with excipient, or uses figuration dilution agent, or Bao Ke
In the carrier existed with capsule or sachet.When excipient plays diluent, it can be solid, semi-solid or liquid
Material as excipient, carrier or active component medium.Therefore, composition can be tablet, pill, pulvis, solution, sugar
Starch agent, sterilizing injecting solution etc..The example of suitable excipient includes:Lactose, glucose, sucrose, sorbierite, mannitol, shallow lake
Powder, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, etc..Preparation may also include:Wetting agent, emulsifying agent, preservative
(such as methyl hydroxybenzoate and propyl ester), sweetener.
Any anti-tumor medicine for the treatment of lung cancer, glioma is being prepared the invention also discloses described pharmaceutical composition
In application.
The application of the pharmaceutical composition provides a method that for the treatment of tumour, is specially a kind of prevention or treatment target
The method of in-vivo tumour, including the pharmaceutical composition described in effective dose is applied in object.Further, the tumour
Selected from lung cancer or glioma.
Described pharmaceutical composition is used to prevent or during treatment target in-vivo tumour, it is necessary to by the medicine described in effective dose
Composition is applied in object.Using this method, growth, propagation, recurrence and/or the transfer of the tumour are suppressed.Further
, the growth of the tumour, propagation, at least the 10% of recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%th, 95% or 99% part is suppressed.
Sixth aspect present invention, discloses a kind of kit for reducing the YWHAQ gene expressions in tumour cell, institute
Stating kit includes：It is present in the nucleic acid molecules of the separation in container, YWHAQ gene RNA constructs, and/or institute
The YWHAQ genes interference slow virus stated.
In summary, the present invention devises 16 RNAi target sequences for people's YWHAQ genes, builds corresponding
YWHAQRNAi carriers, wherein coded sequence SEQ ID NO：16 RNAi carrier pGCSIL-GFP-YWHAQ-siRNA can show
Write the expression for lowering YWHAQ genes in mRNA level in-site and protein level.Use slow virus（Lentivirus, is abbreviated as Lv）As
Genetic manipulation instrument carry RNAi carrier pGCSIL-GFP-YWHAQ-siRNA can target by for the RNAi of YWHAQ genes
Sequence efficiently imports human lung cancer H1299 cells and glioma U87 cells, reduces the expression of YWHAQ genes, significantly inhibits
State the multiplication capacity of tumour cell.Therefore the YWHAQ gene silencings of lentivirus mediated are the potential clinical No operations of malignant tumour
Therapeutic modality.
The siRNA that the present invention is provided or the nucleic acid construct comprising the siRNA sequence, slow virus being capable of specificity suppression
The expression of people's YWHAQ genes, especially slow virus, can efficiently infect target cell, expeditiously suppress YWHAQ bases in target cell
The expression of cause, and then suppress the growth of tumour cell, promote apoptosis of tumor cells, it is significant in oncotherapy.
Brief description of the drawings
Fig. 1：PGCSIL-GFP Plasmid diagrams
Fig. 2：YWHAQ-RNAi slow virus infected human lung cancer H1299 cells and glioma U87 cells after 5 days, YWHAQ
MRNA expression is significantly reduced
Fig. 3：YWHAQ-RNAi slow virus infected human lung cancer H1299 cells after 5 days, caused cell inhibitory effect
Fig. 4：YWHAQ-RNAi slow virus infected people glioma U87 cells after 5 days, caused cell inhibitory effect
Embodiment
Research of the present invention based on YWHAQ high expression in mankind's meningioma, it is believed that YWHAQ is adjusted as a kind of cell cycle
Control GAP-associated protein GAP may take part in the occurrence and development of malignant tumour.
The present invention relates to the small molecules interference RNA that one group is directed to people's YWHAQ genes（siRNA）Sequence, rna interference vector
Slow virus is disturbed with RNA.People's YWHAQ mRNA coding region sequences are chosen as siRNA target site, according to continuous in target site
10-30（It is preferred that 15-27, more preferably 19-23）Individual base sequence designs siRNA target sequences.By gene cloning, table is built
Up to above-mentioned siRNA nucleic acid construct, the above-mentioned siRNA of packaging expression slow virus.Cell experiment proves, above-mentioned siRNA sequence
Can in specific silence human tumor cells endogenous YWHAQ genes expression.
Inventor is had found, tumour cell can be effectively suppressed after the expression using YWHAQ genes of being transferred person under RNAi methods
Propagation, this achievement in research shows that YWHAQ genes are proto-oncogenes, can as oncotherapy target spot.Inventor further closes
Into with test a variety of siRNA for YWHAQ genes, filtered out the expression that can effectively suppress YWHAQ and then suppressed people's lung
Cancer H1299 cells and glioma U87 cells propagation and the siRNA of growth, complete the present invention on this basis.
The invention provides a series of siRNA of interference people's YWHAQ genes（siRNA）Sequence, constructing can be special
The slow virus of property silence YWHAQ gene expressions.The present invention research find, for people YWHAQ genes design siRNA and
RNAi slow virus, expression that is stable and specifically lowering YWHAQ genes, and effectively suppress the propagation of human tumor cells.This hair
It is bright to show that YWHAQ genes promote growth of tumour cell, it is expected to turn into the target spot of early diagnosis of tumor and treatment.Moreover, passing through
The expression of RNAi mode silence YWHAQ genes, can be used as the effective means for suppressing tumor development.
The present invention mentality of designing be：
The present invention is screened by the following method obtains a kind of people YWHAQ gene RNAi slow virus：Transferred from Genbank
People's YWHAQ gene orders；Predict siRNA sites；Synthesis is for the effective siRNA sequence of YWHAQ genes, and two ends are containing digestion position
The double-stranded DNA Oligo of point cohesive end；It is connected after slow virus carrier double digestion with double-stranded DNA Oligo, construction expression YWHAQ genes
The RNAi plasmids of siRNA sequence；The assistant carrier that RNAi plasmids and slow virus packaging are needed（Packing Mix, Sigma-
Aldrich companies）Cotransfection human embryonic kidney cells 293T, produces recombinant slow virus particle, you can efficient silence YWHAQ genes are made
Slow virus.
Based on the above method, the invention provides the Effective target site of 16 interference YWHAQ genes（Specific such as SEQ ID NO：
Shown in 1-16）, construct the slow virus of special interference people's YWHAQ genes.
Invention additionally discloses a kind of people YWHAQ gene RNAi slow virus simultaneously（YWHAQ-RNAi）And its preparation and application.
The study find that, using the RNAi methods of lentivirus mediated, in expression of the reduction YWHAQ genes in tumour cell
Afterwards, the propagation of tumour cell can effectively be suppressed.The study show that, YWHAQ genes are a proto-oncogenes, tumour can be promoted thin
Born of the same parents breed, and have important biological function in tumour occurrence and development, and YWHAQ genes can be the target of oncotherapy,
The YWHAQ gene specifics silence of lentivirus mediated can as oncotherapy a kind of new tool.
The present invention is expanded on further with reference to embodiment.It should be understood that embodiment is merely to illustrate the present invention, and it is unrestricted
The scope of the present invention.The reagent of the experimental method of unreceipted actual conditions and undeclared formula is according to conventional strip in embodiment
Part, such as ［ beautiful ］ Sambrook.J write；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing：Science Press
The condition of condition or manufacturer's suggestion described in 2002 is carried out or configured.
Embodiment 1 is directed to the preparation of people YWHAQ gene RNAi slow virus
1. screening is for the effective siRNA target spots of people's YWHAQ genes
YWHAQ is transferred from Genbank（NM_006826）Gene information；Utilize the lucky triumphant limited public affairs of chemical gene technology in Shanghai
Effective siRNA target spot of the design software Genechem designs of department for YWHAQ genes.In the coded sequence of YWHAQ genes
（CDS）In region, the sequence of 21 bases is obtained every a base starting, table 1 lists wherein 16 and is directed to YWHAQ genes
Effective siRNA target sequences.
Table 1 targets the siRNA target sequences of people's YWHAQ genes
| SEQ ID NO. | TargetSeq | Initiation site |
| 1 | GACACCTCCGACAAGAAGTTG | 327 |
| 2 | AGCCAATGCAACTAATCCAGA | 437 |
| 3 | TGCAACTAATCCAGAGAGTAA | 443 |
| 4 | TACCTTGCTGAAGTTGCGTGT | 501 |
| 5 | TGCTGAAGTTGCGTGTGGTGA | 506 |
| 6 | TGCGTGTGGTGATGATCGAAA | 515 |
| 7 | CAAACGATAGATAATTCCCAA | 537 |
| 8 | AAGGAGCTTACCAAGAGGCAT | 556 |
| 9 | GCTGAACTTGATACACTGAAT | 720 |
| 10 | TACACTGAATGAAGACTCATA | 731 |
| 11 | CACTGAATGAAGACTCATACA | 733 |
| 12 | CAGTTGCTTAGAGACAACCTA | 774 |
| 13 | GCTTAGAGACAACCTAACACT | 779 |
| 14 | TAGAGACAACCTAACACTTTG | 782 |
| 15 | AACCTAACACTTTGGACATCA | 789 |
| 16 | GCCCTATGTAACAGCAGAGTA | 1826 |
2. the preparation of slow virus carrier
For siRNA target spots（With SEQ ID NO：Exemplified by 16）Synthesize two ends restriction enzyme site cohesive end containing AgeI and EcoRI
Double-stranded DNA Oligo sequences（Table 2）；PGCSIL-GFP carriers are acted on Age I and EcoRI restriction enzymes（Shang Haiji
Triumphant chemical gene Technology Co., Ltd. provides, Fig. 1）, linearize it, agarose gel electrophoresis identification endonuclease bamhi.
The double-stranded DNA Oligo of two ends I containing Age and EcoRI the restriction enzyme site cohesive end of table 2
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | GCCCTATGTAACAGCAGAGTA | TTCAAGAGA | TACTCTGCTGTTACATAGGGC | TTTTTG | 17 |
| Antisense strand | AATTCAAAAA | GCCCTATGTAACAGCAGAGTA | TCTCTTGAA | TACTCTGCTGTTACATAGGGC | 18 |
Double digestion is linearized by T4DNA ligases（Digestion system as shown in table 4,37 DEG C, reacts 1h）Carrier DNA
With purified double-stranded DNA Oligo connections, in appropriate buffer system（Linked system is as shown in table 5）In connected in 16 DEG C
At night, reclaim connection product.Connection product is converted into fresh competent escherichia coli cell prepared by calcium chloride（Conversion operation is joined
Examine：55-56 pages of the Molecular Cloning:A Laboratory guide second edition）.
Bacterium clone surface is grown in connection converted product to be stained with, is dissolved in 10 μ l LB culture mediums, mixing takes 1 μ l as mould
Plate；The upstream and downstream of RNAi sequences in slow virus carrier, designs general PCR primer（Upstream primer sequence：5’-
CCTATTTCCCATGATTCCTTCATA-3’（SEQ ID NO：21）；Downstream primer sequence：5’-
GTAATACGGTTATCCACGCG-3’（SEQ ID NO：22）, enter performing PCR identification experiment（PCR reaction systems such as table 6-1, reaction
Condition such as table 6-2）.Positive clone, which is sequenced and compared analysis, to be identified to PCR, it is to successfully construct to compare correct clone
Be directed to SEQ ID NO：16 expression RNAi carrier, is named as pGCSIL-GFP-YWHAQ-siRNA.
Build pGCSIL-GFP-Scr-siRNA negative control plasmids, negative control siRNA target sequences be 5 '-
TTCTCCGAACGTGTCACGT-3’（SEQ ID NO：23）.When building pGCSIL-GFP-Scr-siRNA negative control plasmids,
The double-stranded DNA Oligo sequences of two ends restriction enzyme site cohesive end containing AgeI and EcoRI are synthesized for Scr siRNA target spots（Table 3）, its
The same pGCSIL-GFP-YWHAQ-siRNA of remaining construction method, authentication method and condition.
The double-stranded DNA Oligo of the two ends of table 3 restriction enzyme site cohesive end containing AgeI and EcoRI
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 19 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 20 |
Double digestion is linearized by T4DNA ligases（Digestion system as shown in table 4,37 DEG C, reacts 1h）Carrier
The pGCSIL-GFP plasmid enzyme restriction reaction systems of table 4
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmids (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| AgeI(10U/μl) | 1.0 |
| EcoRI(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
The carrier DNA of table 5 and double-strand double-stranded DNA Oligo coupled reaction systems
| Reagent | Positive control (μ l) | From even control (μ l) | Connection group (μ l) |
| The carrier DNA (100ng/ μ l) of linearisation | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer solutions | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligases | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction systems
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Sense primer | 0.4 |
| Anti-sense primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program settings
3. pack YWHAQ-siRNA slow virus
RNAi plasmids pGCSIL-GFP-YWHAQ-siRNA DNA is extracted with the plasmid extraction kit of Qiagen companies,
It is configured to 100ng/ μ l storing liquids.24h before transfection, with the human embryonic kidney cells 293T cells of Trypsin Induced exponential phase,
Cell density is adjusted as 1.5 × 10 using the DMEM complete mediums containing 10% hyclone5Cell/ml, is inoculated in 6 orifice plates, 37
DEG C, 5%CO2Cultivated in incubator.Transfection is can be used to when cell density reaches 70%-80%.2h before transfection, suctions out original culture
Base, adds the fresh complete mediums of 1.5ml.According to the MISSION Lentiviral of Sigma-aldrich companies
The explanation of Packaging Mix kits, Packing Mix are added into a sterile centrifugation tube（PVM）20 12 μ l of μ l, PEI,
The μ l of plasma-free DMEM medium 400, take the DNA of the 20 above-mentioned extractings of μ l, add to above-mentioned PVM/PEI/DMEM mixed liquors.Will be upper
State transfection mixture and be incubated 15min at room temperature, in the culture medium for being transferred to human embryonic kidney cells 293T cells, 37 DEG C, 5%CO2Training
Support culture 16h in case.The culture medium containing transfection mixture is discarded, PBS solution washing adds complete medium 2ml, continued
Cultivate 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration units（Millipore）Purifying and the slow disease of concentration
Poison, step is as follows：（1）4 DEG C, 4000g centrifugation 10min remove cell fragment；（2）0.45 μm of filter filtering supernatant is in 40ml
In ultracentrifugation pipe；（3）4000g is centrifuged, 10-15min, to the viral concentration volume needed；（4）After centrifugation terminates, it will filter
Cup and following filtered solution collection cups are separated, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than
1000g；（5）Centrifuge Cup is removed from sample collection cup, in sample collection cup is viral concentration liquid.By viral concentration liquid
Packing is after -80 degrees Celsius of preservations.The sequence such as SEQID NO of the chains of siRNA first contained in viral concentration liquid:Shown in 28.It is right
According to slow virus packaging process with YWHAQ-siRNA slow virus, pGCSIL- is only replaced with pGCSIL-GFP-Scr-siRNA carriers
GFP-YWHAQ-siRNA carriers.
The real-time fluorescence quantitative RT-PCR method of embodiment 2 detects the silence efficiency of YWHAQ genes
Human lung cancer H1299 cells and glioma U87 cells in exponential phase carry out pancreatin digestion, and cell is made and hangs
Liquid（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infecting plural number
（MOI, H1299:20, U87:20）Value, changes culture medium after adding virus prepared by the embodiment 1 of Sq, culture 24h, treats
Time of infection was reached after 5 days, collected cell.According to the Trizol operational manuals of Invitrogen companies, extracted total RNA.Root
According to the M-MLV operational manuals of Promega companies, RNA reverse transcriptions are obtained into cDNA（Reverse transcription reaction system is shown in Table 7,42 DEG C instead
1h is answered, then water-bath 10min inactivates reverse transcriptase in 70 DEG C of water-baths）.
Using TP800 type Real time PCR instruments（TAKARA）Carry out Real_time quantitative detection.The primer of YWHAQ genes is such as
Under：- the ACAAAGACAGCACCCTCA-3 ' of sense primer 5 '（SEQ ID NO：24）With anti-sense primer 5 '-
GGATGACACCCTGTATGG-3’（SEQ ID NO：25）.Using house-keeping gene GAPDH as internal reference, primer sequence is as follows：Draw upstream
- the TGACTTCAACAGCGACACCCA-3 ' of thing 5 '（SEQ ID NO：26）With anti-sense primer 5 '-
CACCCTGTTGCTGTAGCCAAA-3’（SEQ ID NO：27）.By the proportional arrangement reaction system in table 8.
The reverse transcription reaction system of table 7
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPCH2O | 3.5 |
| Total | 11.0 |
Table 8Real-time PCR reaction systems
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Sense primer（2.5μM）： | 0.5 |
| Anti-sense primer（2.5μM）： | 0.5 |
| cDNA | 1.0 |
| ddH2O | 8.0 |
| Total | 20.0 |
Setting program is two-step method Real-time PCR：95 DEG C of pre-degeneration, 15s；Each step is denatured 95 DEG C, 5s afterwards；Move back
60 DEG C of fire extension, 30s；45 circulations are carried out altogether.Every time light absorption value is read in the extension stage.After PCR terminates, 95 DEG C of denaturation
1min, is subsequently cooled to 55 DEG C, DNA double chain is fully combined.To 95 DEG C since 55 DEG C, each step increases by 0.5 DEG C, keeps
4s, while reading light absorption value, makes melting curve.Using 2-ΔΔCtAnalytic approach calculates the gene expression abundance for having infected YWHAQ mRNA.
Infect comparison virus（Lv-Scr-siRNA）Cell be used as control.Experimental result（Fig. 2）Show, human lung cancer H1299 cells and
YWHAQ mRNA expression has lowered 91.1% and 83.7% in glioma U87 cells.
Embodiment 3 detects the multiplication capacity for the tumour cell for infecting YWHAQ-siRNA slow virus
Human lung cancer H1299 cells and glioma U87 cells in exponential phase carry out pancreatin digestion, and cell is made and hangs
Liquid（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infecting plural number
（MOI, H1299:20, U87:20）, culture medium is changed after adding the virus of Sq, culture 24h, treats that time of infection reaches 5 days
Afterwards, each experimental group cell in exponential phase is collected.Cell suspension is resuspended into complete medium（2×104/ml）, with thin
Born of the same parents' density is about 2000/hole, is inoculated with 96 orifice plates.Every group of 5 multiple holes, per the μ l of hole 100.Complete after plate, put 37 DEG C, 5%CO2Training
Support case culture.Since after bed board second day, Cellomics instruments are used daily（Thermo Fisher）Detect read plate once, even
Continuous detection read plate 5 days.By adjusting Cellomics arrayscan input parameter, scanning orifice plate every time is calculated exactly
In the cell with green fluorescence quantity, to data carry out statistics drawing, draw cell growth curve（As a result such as Fig. 3-Fig. 4
It is shown）.As a result show, slow virus infects each tumour of group after cell injuring model 5 days, and growth rate is significantly slowed, and is far below
The growth rate of control group tumour cell, vigor cell number have dropped 97.3% and 82.9% respectively, show YWHAQ gene silencings
Tumor cell proliferation ability is caused to be suppressed.
It is described above, only presently preferred embodiments of the present invention, it is not any to the present invention in form and substantial limitation,
It should be pointed out that for those skilled in the art, on the premise of the inventive method is not departed from, can also make
Some improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are the equivalent embodiment of the present invention；Meanwhile, all substantial technologicals pair according to the present invention
The variation, modification and evolution for any equivalent variations that above-described embodiment is made, still fall within the scope of technical scheme
It is interior.
Claims (7)
1. a kind of purposes of the people YWHAQ genes of separation in preparing or screening lung cancer or Treatment for Glioma medicine；By separation
YWHAQ genes include both sides content for preparing or screening anti-tumor medicine：First, regarding YWHAQ genes as medicine
Or preparation is applied to prepare anti-tumor medicine or preparation for the action target of tumour cell；Second, using YWHAQ genes as
Medicine or preparation are applied to screening anti-tumor medicine or preparation for the action target of tumour cell；Using YWHAQ genes as
Medicine or preparation are applied to prepare anti-tumor medicine for the action target of tumour cell or preparation is specifically referred to：By YWHAQ
Gene as RNA interference effects target, to develop medicine or preparation for tumour cell, so as to reduce in tumour cell
The expression of YWHAQ genes；YWHAQ genes are applied to screening as medicine or preparation for the action target of tumour cell
Anti-tumor medicine or preparation are specifically referred to：Using YWHAQ genes as effective object, medicine or preparation are screened, to look for
To the medicine of people's YWHAQ gene expressions can be suppressed as oncotherapy drug candidate；The sequence of the action target of YWHAQ genes
As shown in SEQ ID NO.16.
2. a kind of purposes of pharmaceutical composition in the anti-tumor medicine for the treatment of lung cancer or glioma is prepared, the drug regimen
The active principle of thing contains following any：Reduce nucleic acid molecules, the YWHAQ of the separation of YWHAQ gene expressions in tumour cell
Gene RNA construct, YWHAQ genes interference slow virus, the nucleic acid molecules are included：
A) in double-stranded RNA, the double-stranded RNA containing can be under stringent condition with YWHAQ gene recombinations nucleotide sequence, institute
State double-stranded RNA and include the first chain and the second chain, first chain and the second chain complementation are collectively forming RNA dimers, and
The sequence of first chain and the target sequence in YWHAQ genes are essentially identical, and the target sequence of the YWHAQ genes contains SEQ ID
NO:Sequence shown in 16；Or
B) in shRNA, the shRNA containing can be under stringent condition with YWHAQ gene recombinations nucleotide sequence, it is described
ShRNA includes positive-sense strand fragment and antisense strand fragment, and the connection positive-sense strand fragment and antisense strand fragment loop-stem structure,
The sequence of the positive-sense strand fragment and the antisense strand fragment is complementary, and the sequence and YWHAQ genes of the positive-sense strand fragment
In target sequence it is essentially identical, the target sequence of the YWHAQ genes contains SEQ ID NO:Sequence shown in 16；
The YWHAQ genes RNA construct, the gene piece containing the shRNA in the nucleic acid molecules for encoding the separation
Section, can express the shRNA；The YWHAQ genes interference slow virus is by the gene fragment clone for encoding the shRNA is entered slowly
Obtained after viral vector.
3. purposes as claimed in claim 2, it is characterised in that the double-stranded RNA is siRNA, the siRNA first
The sequence of chain such as SEQ ID NO：Shown in 28.
4. purposes as claimed in claim 2, it is characterised in that the sequence of the shRNA such as SEQ ID NO：Shown in 29.
5. purposes as claimed in claim 2, it is characterised in that the YWHAQ genes RNA construct is the slow disease of interference
Poisonous carrier.
6. purposes as claimed in claim 2, it is characterised in that the slow virus carrier is selected from：pLKO.1-puro、pLKO.1-
CMV-tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、
pLKO.1-puro-CMV-TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-
puro-CMV-TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-
puro-IPTG-1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/
BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/
Any in V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
7. purposes as claimed in claim 2, it is characterised in that the YWHAQ genes disturb slow virus, by the slow disease of the interference
Poisonous carrier is formed under slow virus packaging plasmid, the auxiliary of cell line by virus packaging.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313878.1A CN103656673B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's YWHAQ genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313878.1A CN103656673B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's YWHAQ genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103656673A CN103656673A (en) | 2014-03-26 |
| CN103656673B true CN103656673B (en) | 2017-10-13 |
Family
ID=50296227
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210313878.1A Active CN103656673B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's YWHAQ genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103656673B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115006422A (en) * | 2022-06-17 | 2022-09-06 | 西安交通大学 | Application of si-Ywhaq in promoting liver cell regeneration and proliferation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008104543A2 (en) * | 2007-02-26 | 2008-09-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Method for predicting the occurrence of metastasis in breast cancer patients |
| CN101889205A (en) * | 2007-07-27 | 2010-11-17 | 卡瓦迪斯有限责任公司 | The protein markers that is used for cardiovascular event |
-
2012
- 2012-08-29 CN CN201210313878.1A patent/CN103656673B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008104543A2 (en) * | 2007-02-26 | 2008-09-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Method for predicting the occurrence of metastasis in breast cancer patients |
| CN101889205A (en) * | 2007-07-27 | 2010-11-17 | 卡瓦迪斯有限责任公司 | The protein markers that is used for cardiovascular event |
Non-Patent Citations (8)
| Title |
|---|
| 14-3-3 proteins as potential oncogenes;Guri Tzivion 等;《Seminars in Cancer Biology》;20060630;第16卷(第3期);第203-213页 * |
| Chemosensitivity profiles indentify polymorphisms in the p53 network genes 14-3-tau and CD44 that affect sarcoma incidence and survival;Vazquez A，等;《Cancer Research》;20100101;第70卷(第1期);第172页摘要 * |
| Isoform-specific expression of 14-3-3 proteins in human lung cancer tissues;Wenqing Qi 等;《Cancer Cell Biology》;20050120;第113卷(第3期);第359页摘要，表1，图2 * |
| Lung Cancer Signatures in Plasma Based on Proteome Profiling of Mouse Tumor Models;Ayumu Taguchi，等;《Cancer Cell》;20110913;第20卷(第3期);第289-299页 * |
| Novel Biomarkers for Prostate Cancer Including Noncoding Transcripts;Tammy L. Romanuik，等;《The American Journal of Pathology》;20091231;第175卷(第6期);第2264-2276页 * |
| Occurrence of autoantibodies to annexin I，14-3-3 theta and LAMR1 in prediagnostic lung cancer sera;Qiu J 等;《Journal of Clinical Oncology》;20081101;第26卷(第31期);第5060页摘要 * |
| Tamoxifen downregulation of miR-451 increases 14-3-3 zeta and promotes breast cancer cell survival and endocrine resistance;A. bergamaschi，B. S. Katzenellenbogen;《Oncogene》;20110613;第31卷;第39-47页 * |
| THE 14-3-3 CANCER CONNECTION;Heiko Hermeking;《Nature REVIEWS》;20031231;第3卷;第931-943页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103656673A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN104225619B (en) | The purposes and its related drugs of people's ILK gene therapy tumours | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN105779575A (en) | Application of human EIF3A gene and related drugs | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes | |
| CN104225618B (en) | Application of human NLK gene and EGFR gene in curing tumors and related drugs | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200610 Address after: 201203 room 101-7, No. 332, Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI JIBEI BIOTECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |