CN103157115B - The purposes of people RHBDD1 gene and related drugs thereof - Google Patents
The purposes of people RHBDD1 gene and related drugs thereof Download PDFInfo
- Publication number
- CN103157115B CN103157115B CN201210005126.9A CN201210005126A CN103157115B CN 103157115 B CN103157115 B CN 103157115B CN 201210005126 A CN201210005126 A CN 201210005126A CN 103157115 B CN103157115 B CN 103157115B
- Authority
- CN
- China
- Prior art keywords
- rhbdd1
- gene
- people
- plko
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses purposes and the related drugs thereof of people RHBDD1 gene.The invention discloses the purposes of people RHBDD1 gene in the preparation of oncotherapy, diagnosing tumor and medicine.The present invention also constructs people RHBDD1 gene small molecules interference RNA, people RHBDD1 Gene interfere nucleic acid construct, people RHBDD1 Gene interfere slow virus disclose their purposes further.SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus can suppress the expression of people RHBDD1 gene by specificity, especially slow virus, efficiently can infect target cell, suppress the expression of RHBDD1 gene in target cell expeditiously, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people RHBDD1 gene.
Background technology
RNA disturbs (RNAinterference, RNAi) be a conservative defense mechanism in biological evolution, first (FireA is found in 1998, XuS, MontgomeryMK, KostasSA, DriverSE, MelloCC.Potentandspecificgeneticinterferencebydouble-str andedRNAinCaenorhabditiselegans.Nature.1998; 391 (6669): 806-11.).Its essence is by the mRNA selective degradation of the homology with it of double chain RNA mediate, and then the process suppressing corresponding gene to be expressed.Due to its gene inhibition definite effect, there is the features such as tandem type enlarge-effect and high-penetrability, thus there is good application prospect (AngajiSA in the research of malignant tumor, HedayatiSS, PoorRH, MadaniS, PoorSS, PanahiS.ApplicationofRNAinterferenceintreatinghumandisea ses.JGenet.2010; 89 (4): 527-37.).Research shows, length is the siRNA (smallinterferingRNA of 21-23nt, siRNA) specificly with post-transcriptional level RNAi (TuschlT can be caused transcribing, ZamorePD, SharpPA, BartelDP.RNAi:double-strandedRNAdirectstheATP-dependentc leavageofmRNAat21to23nucleotideintervals.Cell2000; 101:25-33.).Therefore, produce specific siRNA by suitable technology and effectively can act on the mRNA of target gene, the object of gene silencing can be realized.
Exogenous DNA is imported eukaryotic cell and the mode of carrying out transcript and expression mainly comprises the cell transfecting of non-viral carrier systems and take virus as the cell infection mode of carrier.Slow virus carrier is the virus carrier system be transformed on human immunodeficiency virus (HIV-I) basis, efficiently genes of interest (or RNAi) can be imported primary cell or the cell line of animal and human.The gene expression of lentivirus mediated or RNAi effect lasts and stable, genes of interest can be incorporated in host cell gene group, divides with the division of cellular genome, and can effectively infect and be incorporated in Unseparated Cell.Exogenous gene in view of lentivirus-mediated can realize expression steady in a long-term in animal body, do not cause obvious immunoreation simultaneously, slow virus carrier has become the strong instrument (HeroldMJ of research gene function, vandenBrandtJ, SeiblerJ, ReichardtHM.Inducibleandreversiblegenesilencingbystablei ntegrationofanshRNA-encodinglentivirusintransgenicrats.P rocNatlAcadSciUSA.2008Nov25; 105 (47): 18507-12.).
Rhomboid family comprises multiple film albumen, it is a class serine protease, extensively guard between prokaryote and eukaryote, play important regulatory function (KooninEV, MakarovaKS, RogozinIB, DavidovicL, LetellierMC, PellegriniL.Therhomboids:anearlyubiquitousfamilyofintram embraneserineproteasesthatprobablyevolvedbymultipleancie nthorizontalgenetransfers.GenomeBiol.2003; 4 (3): R19.).At present, to the effect of fruit bat Rhomboid protease after deliberation more deep.Fruit bat Rhomboids1-3 has adjustment EGF receptor signal, control the function (LeeJR of g and D, UrbanS, GarveyCF, FreemanM.Regulatedintracellularligandtransportandproteol ysiscontrolEGFsignalactivationinDrosophila.Cell.2001; 107 (2): 161-71.UrbanS, LeeJR, FreemanM.Drosophilarhomboid-1definesafamilyofputativeint ramembraneserineproteases.Cell.2001; 107 (2): 173-82.).Fruit bat Rhomboid7 is found (McQuibbanGA relevant to spermatogenesis, LeeJR, ZhengL, JuusolaM, FreemanM.Normalmitochondrialdynamicsrequiresrhomboid-7an daffectsDrosophilalifespanandneuronalfunction.CurrBiol.2 006; 16 (10): 982-9.).The Rhomboid protease of yeast is found in mitochondrial membrane and reinvents middle performance critical function (McQuibbanGA, SauryaS, FreemanM.Mitochondrialmembraneremodellingregulatedbyacon servedrhomboidprotease.Nature.2003; 423 (6939): 537-41.).
Vertebrate Rhomboid gene can be divided three classes: the cell Rhomboid that (1) is active, comprises RHBDL2, RHBDL4 and RHBDD1; (2) the cell Rhomboid of non-activity, comprises RHBDD5 and RHBDD6; (3) mitochondrion Rhomboid, is also called PARL (UrbanS.Rhomboidproteins:conservedmembraneproteaseswithdi vergentbiologicalfunctions.GenesDev.2006; 20 (22): 3054-68.).These protease participate in important signal pathway, such as, RHBDL2 has the effect (LohiO of cracking thrombomodulin (thrombomodulin) and receptor tyrosine kinase part (ephrinB3), UrbanS, FreemanM.Diversesubstraterecognitionmechanismsforrhomboi ds; ThrombomoduliniscleavedbyMammalianrhomboids.CurrBiol.200 4; 14 (3): 236-41.PascallJC, BrownKD.IntramembranecleavageofephrinB3bythehumanrhomboi dfamilyprotease, RHBDL2.BiochemBiophysResCommun.2004Apr23; 317 (1): 244-52.).Mitochondrial inner membrane PARL (GottliebE.OPA1andPARLkeepalidonapoptosis.Cell.2006 relevant to apoptosis; 126 (1): 27-9.CipolatS, RudkaT, HartmannD, CostaV, SerneelsL, CraessaertsK, MetzgerK, FrezzaC, AnnaertW, D ' AdamioL, DerksC, DejaegereT, PellegriniL, D ' HoogeR, ScorranoL, DeStrooperB.MitochondrialrhomboidPARLregulatescytochrome creleaseduringapoptosisviaOPA1-dependentcristaeremodelin g.Cell.2006; 126 (1): 163-75.HillRB, PellegriniL.ThePARLfamilyofmitochondrialrhomboidprotease s.SeminCellDevBiol.2010; 21 (6): 582-92.).
People RHBDD1 gene (rhomboiddomaincontaining1) is a newfound Rhomboid family member, high expressed in testis, participates in the cracking of pro apoptotic protein BIK.Process LAN or strike and subtract RHBDD1 gene in the HEKC (HEK293T), causes the apoptosis of the BIK mediation reducing or strengthen respectively.Therefore, RHBDD1 regulates anti-apoptotic activity (WangY, the GuanX of BIK mediation as a kind of serine protease, FokKL, LiS, ZhangX, MiaoS, ZongS, KoideSS, ChanHC, WangL.AnovelmemberoftheRhomboidfamily, RHBDD1, regulatesBIK-mediatedapoptosis.CellMolLifeSci.2008; 65 (23): 3822-9.).The homologous genes of people RHBDD1 gene, mRHBDD1 and rRHBDD1 also finds high expressed in the ovary tissue of Mouse and rat.And, find that mRHBDD1 participates in by regulating the apoptosis of sperm regulating spermatogenesis (WangY, SongW, LiS, GuanX, MiaoS, ZongS, KoideSS, WangL.GC-1mRHBDD1knockdownspermatogoniacellslosetheirspe rmatogeniccapacityinmouseseminiferoustubules.BMCCellBiol .2009; 10:25.).But, people RHBDD1 gene whether with the apoptosis of tumor cell about and effect in tumor occurs and is in progress there is no bibliographical information.Old friend RHBDD1 gene acts on the further research that needs in tumor.
Summary of the invention
The object of the invention is to Therapeutic Method and the medicine of open and people RHBDD1 gene-correlation.
First aspect present invention, disclose by people RHBDD1 gene for the preparation of or screening anti-tumor medicine, or by people RHBDD1 gene for the preparation of diagnosing tumor medicine.
People RHBDD1 gene for the preparation of or screening anti-tumor medicine comprise the content of two aspects: one, to be applied to people RHBDD1 gene for the action target of tumor cell as medicine or preparation and to prepare anti-tumor medicine or preparation; Its two, people RHBDD1 gene is applied to screening anti-tumor medicine or preparation as medicine or preparation for the action target of tumor cell.
Described people RHBDD1 gene specifically to be referred to as action target for tumor cell of medicine or preparation: people RHBDD1 gene is produced the target of RNA interference effect as medicine or preparation for tumor cell, thus the expression of tumor cell people RHBDD1 gene can be reduced.
Describedly people RHBDD1 gene is applied to screening anti-tumor medicine as medicine or preparation for the action target of tumor cell or preparation specifically refers to: as effective object, medicine or preparation are screened by people RHBDD1 gene, can suppress or promote that the medicine of people RHBDD1 gene expression is as oncotherapy drug candidate to find.Namely people RHBDD1 gene small molecules interference RNA as described later obtains for effective object screening with people RHBDD1 gene, can be used as the medicine with inhibition tumor cell proliferation function.Such as antibody drug, small-molecule drug etc. also can using RHBDD1 gene as effective object.
Described by people RHBDD1 gene for the preparation of diagnosing tumor medicine, refer to preparation people RHBDD1 gene expression product being applied to diagnosing tumor medicine as a diagnosing tumor index.
Described tumor can be any one tumor that the propagation of its tumor cell is relevant to the expression of people RHBDD1 gene, further, is a kind of malignant tumor, such as, is selected from: hepatocarcinoma, squamous cell carcinoma of tongue, breast carcinoma, cancer of pancreas, gastric cancer and pulmonary carcinoma.
Described anti-tumor medicine can be small-molecule chemical medicine, antibody medicine, also can be nucleic acid drug.
Further, described anti-tumor medicine can reduce the expression of people RHBDD1 gene thus the propagation of inhibition tumor cell.
Adopt the method for forgoing neoplasms medicine treatment tumor, mainly reach therapeutic purposes by the propagation of the expression inhibition tumor cell reducing people RHBDD1 gene.
Concrete, during treatment, effectively can reduce the administering substances of people RHBDD1 gene expression dose in patient.
Further, the described material that effectively can reduce people RHBDD1 gene expression dose, comprising can the small molecules interference RNA (siRNA) of specificity reticent people RHBDD1 gene expression.This small molecules interference RNA (siRNA) can play the effect of the expression of endogenous RHBDD1 gene in the reticent tumor cell of specificity.
Further, described small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people RHBDD1 gene expression of SEQIDNO:1-33.
The target sequence of described small molecules interference RNA reticent people RHBDD1 gene expression using the arbitrary sequence being selected from SEQIDNO:1-33 as specificity refers to: this small molecules interference RNA can be combined by the mRNA fragments specific coded by any one sequence in SEQIDNO:1-33, and the expression of specificity silence people RHBDD1 gene.
Further, describedly can the small molecules interference RNA (siRNA) of specificity reticent people RHBDD1 gene expression to express via slow virus carrier.Specifically, this process comprises: the DNA fragmentation of the described people RHBDD1 gene small molecules interference RNA of coding is cloned into slow virus carrier and obtains people RHBDD1 Gene interfere slow virus carrier, and then utilizing this people RHBDD1 Gene interfere slow virus carrier after virus packaging becomes infectious virion, infected tumor's cell also finally expresses described siRNA.
People RHBDD1 Gene interfere slow virus carrier is obtain after the DNA fragmentation of the described people RHBDD1 gene small molecules interference RNA of coding is cloned into slow virus carrier, can produce people RHBDD1 gene small molecules interference RNA.
Further, described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, any one slow virus carrier in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ, it is carrier that the embodiment of the present invention specifically lists with pGCSIL-GFP.
Slow virus carrier can slow virus packaging plasmid, cell line auxiliary under, become infectious virion through virus packaging.
Second aspect present invention, discloses a kind of people RHBDD1 gene small molecules interference RNA (siRNA) target fragments of separation, and its sequence is any sequence in SEQIDNO:1-33.
People RHBDD1 gene small molecules interference RNA (siRNA) target fragments of described separation can be applicable to screening and the preparation of people RHBDD1 gene small molecules interference RNA.
Third aspect present invention, discloses a kind of people RHBDD1 gene small molecules interference RNA (siRNA), can the expression of specificity reticent people RHBDD1 gene.
Described people RHBDD1 gene small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people RHBDD1 gene expression of SEQIDNO:1-33.
Further, described people RHBDD1 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, and described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment contains the RNA of the arbitrary sequential coding in SEQIDNO:1-33.
Described just RNA fragment and antisense RNA fragment are present on two different RNA chains or are present on same RNA chain.
The length of described just RNA fragment and antisense RNA fragment is 15-27 nucleotide; Preferably, length is 19-23 nucleotide; Best, length is 19,20 or 21 nucleotide.
Further, described people RHBDD1 gene small molecules interference RNA is hair clip type single stranded RNA, comprises just RNA fragment, stem ring plate section and antisense RNA fragment, is separated in the middle of just RNA fragment and antisense RNA fragment by stem ring plate section; Wherein, just RNA fragment and antisense RNA fragment complementation, the sequence of just RNA fragment is selected from the arbitrary of SEQIDNO:1-33.
Described stem ring plate segment structure comprises 6 or 9 bases.The sequence of further described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.It is stem ring that the present invention specifically lists with UUCAAGAGA.
As embodiment is enumerated, the sequence of described people RHBDD1 gene small molecules interference RNA is SEQIDNO:34:GCUGGGAUUCUUGUUGGACUAUUCAAGAGAUAGUCCAACAAGAAU CCCAGC.
Fourth aspect present invention, discloses a kind of people RHBDD1 Gene interfere nucleic acid construct, comprises the genetic fragment of aforementioned people RHBDD1 gene small molecules interference RNA of encoding, can express aforementioned people RHBDD1 gene small molecules interference RNA.
Described people RHBDD1 Gene interfere nucleic acid construct can be the gene fragment clone of the aforementioned people RHBDD1 gene small molecules interference RNA of coding is entered known carrier obtain.
Further, described people RHBDD1 Gene interfere nucleic acid construct behaviour RHBDD1 Gene interfere slow virus carrier, obtain after the gene fragment clone of the described people RHBDD1 gene small molecules interference RNA of coding is entered slow virus carrier, people RHBDD1 gene small molecules interference RNA can be produced.
Described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people RHBDD1 Gene interfere nucleic acid construct of vector construction that the embodiment of the present invention specifically lists with pGCSIL-GFP, called after pGCSIL-GFP-RHBDD1-shRNA.
Further, the sequence of genetic fragment of described people RHBDD1 gene small molecules interference RNA of encoding contains arbitrary sequence in SEQIDNO:1-33 and complementary series thereof.
People RHBDD1 gene small molecules interference RNA of the present invention can be used for the propagation of inhibition tumor cell, can be used as medicine or the preparation for the treatment of or diagnosing tumour further.People RHBDD1 Gene interfere nucleic acid construct then can be used for preparing described people RHBDD1 gene small molecules interference RNA.
When being used as medicine or the preparation for the treatment of tumor, be that the people RHBDD1 gene small molecules interference RNA of safe and effective amount is applied to mammal.Certainly, concrete dosage also should consider the factor such as route of administration, patient health situation, and these are all within skilled practitioners skill.
Fifth aspect present invention, discloses a kind of people RHBDD1 Gene interfere slow virus, by aforementioned people RHBDD1 Gene interfere slow virus carrier slow virus packaging plasmid, cell line auxiliary under, form through virus packaging.This slow virus can infected tumor's cell produce people RHBDD1 gene small molecules interference RNA, thus the propagation of inhibition tumor cell.
Sixth aspect present invention, also discloses a kind of pharmaceutical composition, the people RHBDD1 gene small molecules interference RNA containing treatment effective dose or people RHBDD1 Gene interfere slow virus.
Further, described pharmaceutical composition contains 1 ~ 99wt% foregoing people RHBDD1 gene small molecules interference RNA or people RHBDD1 Gene interfere slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositionss, usually by active component and mixed with excipients, or with excipient dilution, or wrap in can in the carrier that exists of capsule or sachet.When excipient plays diluent effect, it can be solid, semisolid or the fluent material medium as excipient, carrier or active component.Therefore, compositions can be tablet, pill, powder, solution, syrup, sterilizing injecting solution etc.The example of suitable excipient comprises: lactose, glucose, sucrose, sorbitol, mannitol, starch, microcrystalline Cellulose, polyvinylpyrrolidone, cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, antiseptic (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In sum, the present invention devises 33 RNAi target sequences for people RHBDD1 gene, build corresponding RHBDD1RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-RHBDD1-shRNA of coded sequence SEQIDNO:21 significantly can lower the expression of RHBDD1 gene at mRNA level in-site and protein level.Use slow virus (lentivirus, be abbreviated as Lv) as genetic manipulation instrument, the shRNA sequence for RHBDD1 gene is efficiently led human hepatoma HepG2 cell, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell, reduce the expression of RHBDD1 gene, significantly suppress the multiplication capacity of above-mentioned tumor cell.Therefore the RHBDD1 gene silencing of lentivirus mediated is the potential clinical non-operative treatment mode of malignant tumor.
SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus can suppress the expression of people RHBDD1 gene by specificity, especially slow virus, efficiently can infect target cell, suppress the expression of RHBDD1 gene in target cell expeditiously, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Accompanying drawing explanation
Fig. 1 represents pGCSIL-GFP Plasmid diagram
Fig. 2 represents that RHBDD1-shRNA slow virus infected people hepatocarcinoma HepG2, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell after 5 days, compared with infecting group with contrast slow virus, the expression of RHBDD1mRNA significantly reduces.
Fig. 3 represents that RHBDD1-shRNA slow virus infected squamous cell carcinoma Tca8113 cell after 4 days, remarkable antiproliferative effect.
Fig. 4 represents that RHBDD1-shRNA slow virus infected human hepatoma HepG2 cell after 5 days, remarkable antiproliferative effect.
Fig. 5 represents that RHBDD1-shRNA slow virus infected people pulmonary carcinoma 95D cell after 5 days, remarkable antiproliferative effect.
Fig. 6 represents that RHBDD1-shRNA slow virus infected MCF-7 Human Breast Cancer Cells after 5 days, remarkable antiproliferative effect.
Fig. 7 represents that RHBDD1-shRNA slow virus infected people gastric cancer SGC7901 cell after 5 days, remarkable antiproliferative effect.
Fig. 8 represents that RHBDD1-shRNA slow virus infected human pancreas cancer Panc-1 cell after 5 days, remarkable antiproliferative effect.
Fig. 9 uses the SABC testing result of RHBDD1 antibody on tumor tissues sample
A, b breast carcinoma, d, c cancer of pancreas, e, f gastric cancer
Detailed description of the invention
The present invention is based on the research that Rhomboid family is relevant, think that RHBDD1 may take part in generation and the development of malignant tumor as a newfound Rhomboid family member.
The present invention relates to one group of small molecules interference RNA for people RHBDD1 gene (siRNA) sequence, rna interference vector and RNA and disturb slow virus.Choose the target site of people RHBDD1mRNA coding region sequence as siRNA, according to continuous print 10-30 in target site (preferred 15-27, more preferably 19-23) individual base sequence design siRNA target sequence.By gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the expression of endogenous RHBDD1 gene in the reticent human tumor cells of specificity.
Inventor finds, can the propagation of inhibition tumor cell effectively after the expression of RHBDD1 gene of transferring person under adopting RNAi method, and this achievement in research shows that RHBDD1 gene is proto-oncogene, can be used as the target spot of oncotherapy.Inventor synthesizes further and tests the multiple siRNA for RHBDD1 gene, filter out the expression that effectively can suppress RHBDD1 and then suppressed the siRNA of human hepatoma HepG2 cell, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell proliferation and growth, complete the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of interference people RHBDD1 gene, constructing can the slow virus of the reticent RHBDD1 gene expression of specificity.The present invention studies discovery, for the siRNA of people RHBDD1 gene design and the slow virus of expression people RHBDD1siRNA, and stable expression of also lowering RHBDD1 gene specifically, and effectively suppress the propagation of human tumor cells.The present invention shows that RHBDD1 gene can promote growth of tumour cell, is expected to the target spot becoming early diagnosis of tumor and treatment.And, by the expression of the reticent RHBDD1 gene of RNAi mode, can be used as the effective means of Tumor suppression development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people RHBDD1 (NM_032276) gene RNAi slow virus: from Genbank, transfer people RHBDD1 gene order; Prediction siRNA site; Synthesize the effective siRNA sequence for RHBDD1 gene, two ends are containing the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected with double-stranded DNA Oligo after slow virus carrier double digestion, the RNAi plasmid of construction expression RHBDD1 gene siRNA sequence; By assistant carrier (PackingMix, Sigma-aldrich company) the cotransfection HEKC 293T that RNAi plasmid and slow virus packaging need, packaging produces virion, can obtain the slow virus of efficient reticent RHBDD1 gene.
Based on said method, the invention provides the Effective target site (specifically as shown in SEQIDNO1-33) of 33 interference RHBDD1 genes, construct the slow virus of special interference people RHBDD1 gene.
The present invention simultaneously also discloses a kind of RNAi slow virus and preparation and application thereof of people RHBDD1 gene.
This research finds, utilizes the RNAi method of lentivirus mediated, after the expression reducing endogenous RHBDD1 gene in tumor cell, and can the effectively propagation of inhibition tumor cell and growth.This research shows, RHBDD1 gene is a proto-oncogene, tumor cell proliferation can be promoted, occur in tumor and in development, there is important biological function, RHBDD1 gene can be the target of oncotherapy, and the RHBDD1 gene specific silence of lentivirus mediated can be used as a kind of new tool of oncotherapy.
The present invention is set forth further below in conjunction with embodiment.Should be understood that embodiment only for illustration of the present invention, but not limit the scope of the invention.In embodiment, the experimental technique of unreceipted actual conditions and the reagent of undeclared formula are conveniently condition, as works such as [U.S.] Sambrook.J; Huang Peitang etc. translate.Molecular cloning texts guide, the third edition.Beijing: the condition of the condition described in Science Press 2002 or manufacturer's suggestion is carried out or configures.
Embodiment 1: for the preparation of people RHBDD1 gene RNAi slow virus
1. screening is for the effective siRNA target spot of people RHBDD1 gene
RHBDD1 (NM_032276) gene information is transferred from Genbank; Utilize the design software Genechem of Shanghai JiKai Gene Chemical Technology Co., Ltd design for the effective siRNA target spot of RHBDD1 gene.In coded sequence (CDS) region of RHBDD1 gene, every the sequence of an initial acquisition of base 33 bases, table 1 lists wherein 33 effective siRNA target sequences for RHBDD1 gene.
Table 1 targeting is in the siRNA target sequence of people RHBDD1 gene
Double-stranded DNA Oligo sequence (table 2) of two ends containing AgeI and EcoRI restriction enzyme site cohesive end is synthesized for siRNA target spot (for SEQIDNO:21); Act on pGCSIL-GFP carrier (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 1) with AgeI and EcoRI restricted enzyme, make its linearisation, agarose gel electrophoresis qualification endonuclease bamhi.
Table 2 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By T4DNA ligase, by double digestion linearisation, (enzyme action system is as shown in table 4,37 DEG C, reaction 1h) the carrier DNA double-stranded DNA Oligo good with purification be connected, spend the night in 16 DEG C of connections in suitable buffer system (linked system is as shown in table 5), reclaim and connect product.By fresh competent escherichia coli cell (conversion operation reference: Molecular Cloning: A Laboratory guide second edition 55-56 page) prepared by connection product conversion calcium chloride.Growing bacterium clone surface at connection converted product is stained with, and be dissolved in 10 μ lLB culture medium, mixing gets 1 μ l as template; The upstream and downstream of RNAi sequence, designs general PCR primer forward primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQIDNO:35) in slow virus carrier; Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQIDNO:36), carries out PCR identification experiment (, as table 6-1, reaction condition is as table 6-2 for PCR reaction system).The clone positive to PCR qualification checks order and compare of analysis, and the clone that comparison is correct is the RNAi carrier containing SEQIDNO:21 successfully constructed, called after pGCSIL-GFP-RHBDD1-shRNA.
Build pGCSIL-GFP-Control-shRNA negative control plasmids, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQIDNO:37).When building pGCSIL-GFP-Control-shRNA negative control plasmids, for double-stranded DNA Oligo sequence (table 3) of Scr (scramble) siRNA target spot synthesis two ends containing AgeI and EcoRI restriction enzyme site cohesive end, all same pGCSIL-GFP-RHBDD1-shRNA of all the other construction methods, authentication method and condition.
Table 3 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By the carrier of T4DNA ligase by double digestion linearisation (enzyme action system is as shown in table 4,37 DEG C, reaction 1h)
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
Reagent | Volume (μ l) |
PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
10×buffer | 5.0 |
100×BSA | 0.5 |
Age I(10U/μl) | 1.0 |
EcoR I(10U/μl) | 1.0 |
ddH 2O | 40.5 |
Total | 50.0 |
Table 5 carrier DNA and double-strand double-stranded DNA Oligo coupled reaction system
Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connecting groups (μ l) |
Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
10 × T4 phage DNA ligase buffer | 1.0 | 1.0 | 1.0 |
T4 phage DNA ligase | 1.0 | 1.0 | 1.0 |
ddH 2O | 16.0 | 17.0 | 16.0 |
Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
Reagent | Volume (μ l) |
10×buffer | 2.0 |
dNTPs(2.5mM) | 0.8 |
Forward primer | 0.4 |
Downstream primer | 0.4 |
Taq polymerase | 0.2 |
Template | 1.0 |
ddH 2O | 15.2 |
Total | 20.0 |
Table 6-2PCR reaction system program setting
2. build RHBDD1-shRNA slow virus
Extract the DNA of RNAi plasmid pGCSIL-GFP-RHBDD1-shRNA with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.24h before transfection, with the HEKC 293T cell of trypsinization exponential phase, with the DMEM complete medium adjustment cell density containing 10% hyclone for 1.5 × 10
5cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO
2cultivate in incubator.Transfection is can be used for when cell density reaches 70%-80%.2h before transfection, the original culture medium of sucking-off, adds the complete medium that 1.5ml is fresh.According to the explanation of the MISSIONLentiviralPackagingMix test kit of Sigma-aldrich company, PackingMix (PVM) 20 μ l is added in a sterile centrifugation tube, PEI12 μ l, plasma-free DMEM medium 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed liquor.Above-mentioned transfection mixture is at room temperature hatched 15min, is transferred in the culture medium of HEKC 293T cell, 37 DEG C, 5%CO
216h is cultivated in incubator.Discard the culture medium containing transfection mixture, PBS solution is washed, and adds complete medium 2ml, continues to cultivate 48h.Collecting cell supernatant, CentriconPlus-20 centrifugal ultrafiltration unit (Millipore) purification and concentrated slow virus, step is as follows: (1) 4 DEG C, the centrifugal 10min of 4000g, removing cell debris; (2) 0.45 μm of frit supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, 10-15min, to the viral concentration volume needed; (4), after centrifugal end, filter cup and filtered solution collection cups are below separated, tipped upside down on by filter cup on sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from sample collection cup, in sample collection cup, be viral concentration liquid.By after viral concentration liquid subpackage in-80 degrees Celsius of preservations.The siRNA sequence contained in viral concentration liquid is SEQIDNO:34.The packaging process of contrast slow virus control-shRNA, with RHBDD1-shRNA slow virus, only replaces pGCSIL-GFP-RHBDD1-shRNA carrier with pGCSIL-GFP-Control-shRNA carrier.
Embodiment 2: real-time fluorescence quantitative RT-PCR method detects the silence efficiency of RHBDD1 gene
Be in the human hepatoma HepG2 cell of exponential phase, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell and carry out trypsinization, (cell number is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach about 30%.According to infecting plural number, (MOI of Tca8113, HepG2 cell, Panc-1 cell and 95D cell is 10, the MOI of SGC7901 cell and MCF-7 is 20) value, virus prepared by the embodiment 1 adding Sq, replaced medium after cultivation 24h, after time of infection reaches 4 days, collecting cell.According to the Trizol operating instruction of Invitrogen company, extracted total RNA.According to the M-MLV operating instruction of Promega company, RNA reverse transcription is obtained cDNA (in table 7,42 DEG C are reacted 1h to reverse transcription reaction system, and then water-bath 10min makes reverse transcriptase inactivation in 70 DEG C of water-baths).
TP800 type RealtimePCR instrument (TAKARA) is adopted to carry out Real_time quantitative detection.The primer of RHBDD1 gene is as follows: forward primer 5 '-GCAGGACTGAGTGAAGAAGAAC-3 ' (SEQIDNO:38) and downstream primer 5 '-GTGAGAGATGAAACCCGTAGG-3 ' (SEQIDNO:39).With house-keeping gene GAPDH for internal reference, primer sequence is as follows: forward primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQIDNO:40) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQIDNO:41).By the proportional arrangement reaction system in table 8.
Table 7 reverse transcription reaction system
Reagent | Volume (μ l) |
5×RT buffer | 4.0 |
10mM dNTPs | 2.0 |
RNasin | 0.5 |
M-MLV-RTase | 1.0 |
DEPC H 2O | 3.5 |
Total | 11.0 |
Table 8Real-timePCR reaction system
Reagent | Volume (μ l) |
SYBR premix ex taq: | 10.0 |
Forward primer (2.5 μMs): | 0.5 |
Downstream primer (2.5 μMs): | 0.5 |
cDNA | 1.0 |
ddH 2O | 8.0 |
Total | 20.0 |
Setting program is two-step method Real-timePCR: denaturation 95 DEG C, 15s; Each step degeneration 95 DEG C afterwards, 5s; Annealing extension 60 DEG C, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR terminates, 95 DEG C of degeneration 1min, are then cooled to 55 DEG C, and DNA double chain is fully combined.To 95 DEG C from 55 DEG C, each walks increase by 0.5 DEG C, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2-
Δ Δ Ctanalytic process calculates and has infected the gene expression abundance of RHBDD1mRNA.Infect the cell of contrast virus (Control-shRNA) in contrast.Experimental result (Fig. 2) shows, the RHBDD1mRNA expression of human hepatoma HepG2 cell, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell have dropped 59.6%, 60.6%, 65%, 89.5%, 79.9% and 68.8% (the results are shown in Figure 2) respectively.
Embodiment 3: detect the multiplication capacity infecting the tumor cell of RHBDD1-shRNA slow virus
Be in the human hepatoma HepG2 cell of exponential phase, squamous cell carcinoma Tca8113 cell, MCF-7 Human Breast Cancer Cells, human pancreas cancer Panc-1 cell, people gastric cancer SGC7901 cell and people pulmonary carcinoma 95D cell and carry out trypsinization, (cell number is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach about 30%.According to infecting plural number, (MOI of Tca8113, HepG2 cell, Panc-1 cell and 95D cell is 10, the MOI of SGC7901 cell and MCF-7 is 20), add the RHBDD1-shRNA slow virus of Sq, replaced medium after cultivation 24h, after time of infection reaches 4 days, collect each experimental group cell being in exponential phase.The resuspended one-tenth cell suspension (2 × 10 of complete medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Often organize 5 multiple holes, every hole 100 μ l.After completing plate, put 37 DEG C, 5%CO
2incubator is cultivated.From after bed board second day, every day was detected with Cellomics instrument (ThermoFisher) and reads plate once, and continuous detecting reads plate 5 days.By adjusting the input parameter of Cellomicsarrayscan, calculating the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, statistics being carried out to data and draws, draw cell proliferation curve (result is as shown in Fig. 3-Fig. 8).Result shows, each tumor of slow virus dip-dye group is after cell injuring model 4-5 days, and growth rate significantly slows down, and far below the growth rate of matched group tumor cell, shows that RHBDD1 gene silencing causes tumor cell proliferation ability suppressed.
The test of RHBDD1 gene overexpression in embodiment 4 tumor cell
Tissue samples: human pancreas cancer, the tissue samples RHBDD1 of breast carcinoma and gastric cancer
Antibody: available from Sigma
Test method:
Take out organization chip, organization chip is toasted 30 minutes in 60 DEG C of calorstats.Then to organization chip dewaxing, dewaxing process is: dimethylbenzene 15 minutes X2, dimethylbenzene: ethanol=1: in 1 mixed liquid, in dehydrated alcohol, in 95% ethanol, in 85% ethanol, in 75% ethanol, soak 10 minutes successively in distilled water; Then fresh 3%H is configured with distilled water or PBS
2o
2, room temperature closes 10 minutes; Organization chip is put into by antigen retrieval high fire heating 0.01M sodium citrate buffer (pH6.0) in microwave oven to boiling, and low fire maintains 20 minutes; After naturally cooling to room temperature, insert in distilled water and soak 10 minutes; 10% serum (TBS preparation) closes 30 minutes; Serum is abandoned in suction, does not wash and adds RHBDD1 antibody (1: 100 dilution) overnight incubation; TBS washes 2 times, each 5 minutes; The goat-anti rabbit two adding HRP labelling resists, incubated at room 60 minutes; TBS washes 4 times, each 5 minutes; Add DAB dyeing, until aobvious light yellow, put into distilled water cessation reaction; 30 seconds are soaked, clear water rinsing 7-8 time with Lignum Sappan; Dehydration mounting, in 75% ethanol, 85% ethanol, 95% ethanol, dehydrated alcohol, dimethylbenzene: ethanol=1: 1 mixed liquid, in dimethylbenzene, leaching puts 5 minutes successively; After taking-up, drip 30ul neutral gum, use coverslip mounting, dry, observed result, take pictures, result as shown in Figure 9.
Result shows:
Use RHBDD1 antibody to carry out Immunohistochemical Expression detection to different tumor tissues, found that, at human pancreas cancer, in the tissue samples of breast carcinoma and gastric cancer, the high expressed of RHBDD1 gene coded protein can be found.The representative of figure Oxford gray is expressed positive.
Inventor finds after interpretation, thinks to carry out auxiliary diagnosis cancer by the expression detecting histiocyte RHBDD1 gene.
Claims (11)
1. people RHBDD1 gene is as the purposes of single useful effect site in preparation or screening anti-tumor medicine, described tumor is the tumor that the propagation of its tumor cell is relevant to the expression of people RHBDD1 gene, and described tumor is selected from: hepatocarcinoma, squamous cell carcinoma of tongue, breast carcinoma, cancer of pancreas, gastric cancer and pulmonary carcinoma; Purposes in the anti-tumor medicine of described preparation hepatocarcinoma, squamous cell carcinoma of tongue, breast carcinoma, cancer of pancreas, gastric cancer and pulmonary carcinoma is specially and RHBDD1 gene is produced the target of RNA interference effect as medicine or preparation for tumor cell, target sequence is SEQIDNO:21, thus can reduce the expression of RHBDD1 gene in tumor cell; Purposes in the anti-tumor medicine of described screening hepatocarcinoma, squamous cell carcinoma of tongue, breast carcinoma, cancer of pancreas, gastric cancer and pulmonary carcinoma is specially screens people RHBDD1 gene medicine or preparation as action target, target sequence is SEQIDNO:21, can suppress or promote that the medicine of RHBDD1 gene expression is as oncotherapy drug candidate to find.
2. the people RHBDD1 gene small molecules interference RNA target fragments be separated, its sequence is SEQIDNO:21.
3. a people RHBDD1 gene small molecules interference RNA, can the expression of specificity reticent people RHBDD1 gene, the target sequence of described people RHBDD1 gene small molecules interference RNA reticent people RHBDD1 gene expression using SEQIDNO:21 as specificity, described people RHBDD1 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment contains the RNA of SEQIDNO:21 coding.
4. people RHBDD1 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, described people RHBDD1 gene small molecules interference RNA is hair clip type single stranded RNA, is separated in the middle of described just RNA fragment and described antisense RNA fragment by stem ring plate section.
5. people RHBDD1 gene small molecules interference RNA as claimed in claim 4, it is characterized in that, the sequence of described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.
6. people RHBDD1 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, the sequence of described people RHBDD1 gene small molecules interference RNA is SEQIDNO:34.
7. a people RHBDD1 Gene interfere nucleic acid construct, comprises the genetic fragment of people RHBDD1 gene small molecules interference RNA described in the arbitrary claim of coding claim 3-6, can express people RHBDD1 gene small molecules interference RNA.
8. people RHBDD1 Gene interfere nucleic acid construct as claimed in claim 7, is characterized in that, described people RHBDD1 Gene interfere nucleic acid construct behaviour RHBDD1 Gene interfere slow virus carrier.
9. people RHBDD1 Gene interfere nucleic acid construct as claimed in claim 8, it is characterized in that, described slow virus carrier is selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
10. a people RHBDD1 Gene interfere slow virus, by people RHBDD1 Gene interfere nucleic acid construct described in the arbitrary claim of claim 7-9 slow virus packaging plasmid, cell line auxiliary under, form through virus packaging.
11. 1 kinds of pharmaceutical compositions, people RHBDD1 Gene interfere slow virus described in people RHBDD1 gene small molecules interference RNA or claim 10 described in the arbitrary claim of claim 3-6 containing treatment effective dose, and pharmaceutically acceptable carrier, diluent or excipient.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210005126.9A CN103157115B (en) | 2011-12-19 | 2012-01-10 | The purposes of people RHBDD1 gene and related drugs thereof |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110425826 | 2011-12-19 | ||
CN201110425826.9 | 2011-12-19 | ||
CN201210005126.9A CN103157115B (en) | 2011-12-19 | 2012-01-10 | The purposes of people RHBDD1 gene and related drugs thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103157115A CN103157115A (en) | 2013-06-19 |
CN103157115B true CN103157115B (en) | 2016-01-06 |
Family
ID=48580977
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210005126.9A Active CN103157115B (en) | 2011-12-19 | 2012-01-10 | The purposes of people RHBDD1 gene and related drugs thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103157115B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109371102B (en) * | 2018-10-23 | 2021-11-05 | 中国医学科学院基础医学研究所 | Anti-tumor drug screening model with RHBDD1 as target and method thereof |
CN112899275B (en) * | 2021-02-02 | 2022-05-10 | 皖南医学院第一附属医院(皖南医学院弋矶山医院) | Application of circRHBDD1 in preparation of drugs for treating hepatocellular carcinoma |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102358754A (en) * | 2011-10-14 | 2012-02-22 | 中国医学科学院基础医学研究所 | Protein from RHBDD1 and use thereof in preparing monoclonal antibody for detecting colon and rectal cancer or breast cancer |
-
2012
- 2012-01-10 CN CN201210005126.9A patent/CN103157115B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102358754A (en) * | 2011-10-14 | 2012-02-22 | 中国医学科学院基础医学研究所 | Protein from RHBDD1 and use thereof in preparing monoclonal antibody for detecting colon and rectal cancer or breast cancer |
Non-Patent Citations (5)
Title |
---|
A novel member of the Rhomboid family, RHBDD1, regulates BIK-mediated apoptosis;Y.Wang等;《Cell. Mol. Life Sci.》;20081231;第65卷;3823页左栏第3段至右栏第1段,3824页左栏第3段至3828页右栏第3段 * |
BIK,the founding member of the BH3-only family proteins: mechanisms of cell death and role in cancer and pathogenic processes;G Chinnadurai等;《Oncogene》;20091231;第27卷;S20-S29 * |
Lentiviral Vector Mediated Delivery of RHBDD1 shRNA Down Regulated the Proliferation of Human Glioblastoma Cells;Wei X等;《Technology in Cancer Research & Treatment》;20140228;第13卷(第1期);87-93 * |
Lentivirus-mediated Silencing of Rhomboid Domain Containing 1 Suppresses Tumor Growth and Induces Apoptosis in Hepatoma HepG2 Cells;Xue-Ni Liu等;《Asian Pacific Journal of Cancer Prevention》;20130131;第14卷(第1期);5-9 * |
人睾丸组织高表达Rhomboid成员RHBDD1在肿瘤发生和细胞非经典通路分泌中的功能研究;万春华;《万方数据》;20120320;全文 * |
Also Published As
Publication number | Publication date |
---|---|
CN103157115A (en) | 2013-06-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
CN103305596A (en) | Application and related pharmaceuticals of human ubiquitin-protein ligase 138 (RNF138) gene | |
CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
CN105779575A (en) | Application of human EIF3A gene and related drugs | |
CN104225619A (en) | Application of human ILK gene in curing tumors and related drugs | |
CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
CN104225618B (en) | Application of human NLK gene and EGFR gene in curing tumors and related drugs | |
CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
CN105803056A (en) | Application of human IARS2 gene and related medicines thereof | |
CN103667422A (en) | Use and related medicament of human CUL4B gene | |
CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CP01 | Change in the name or title of a patent holder | ||
CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |