CN102559895B - The purposes of people NOB1 gene and related drugs thereof - Google Patents
The purposes of people NOB1 gene and related drugs thereof Download PDFInfo
- Publication number
- CN102559895B CN102559895B CN201210005128.8A CN201210005128A CN102559895B CN 102559895 B CN102559895 B CN 102559895B CN 201210005128 A CN201210005128 A CN 201210005128A CN 102559895 B CN102559895 B CN 102559895B
- Authority
- CN
- China
- Prior art keywords
- nob1
- gene
- people
- plko
- small molecules
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses purposes and the related drugs thereof of people NOB1 gene.The invention discloses the purposes of people NOB1 gene in oncotherapy, diagnosing tumor and medicine preparation.The present invention also constructs people NOB1 gene small molecules interference RNA, people NOB1 Gene interfere nucleic acid construct, people NOB1 Gene interfere slow virus disclose their purposes further.SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus specificity can suppress the expression of people NOB1 gene, especially slow virus, efficiently can infect target cell, suppress the expression of NOB1 gene in target cell expeditiously, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people NOB1 gene.
Background technology
RNA interference (RNAinterference, RNAi) is by the sequence-specific PTGS phenomenon of double chain RNA mediate.RNAi technology has very high post-transcriptional silencing efficiency and specificity, RNAi technology is applied to focus (the IzquierdoM.ShortinterferingRNAsasatoolforcancergenethera py.CancerGeneTher.2005 that therapy of tumor is present stage research; 12 (3): 217-27.).General plasmid or virus vector handle the hairpin RNA (shorthairpinRNA of one section of 45-50nt; shRNA) expression in mammalian cell; shRNA can automatically be formed to siRNA (smallinterferingRNA in cell; thus cause gene silencing or expression inhibiting siRNA).Have and carry that gene fragment capacity is large, transfection efficiency is high, nontoxicity, not easily bring out host immune response, somatoblast and terminally differentiated cells and Unseparated Cell, Absorbable organic halogens can be infected suppress the advantages such as the expression of target gene, field (the AngajiSA such as gene therapy, production of vaccine and scientific research are widely used in, HedayatiSS, PoorRH, MadaniS, PoorSS, PanahiS.ApplicationofRNAinterferenceintreatinghumandisea ses.JGenet.2010; 89 (4): 527-37.KettingRF.ThemanyfacesofRNAi.DevCell.2011; 20 (2): 148-61.).
Zinc finger protein is protein family maximum in human body, is to identify the modal structural element of nucleic acid.1% of research finder genoid belongs to zinc finger protein gene family.Zinc finger protein can fix on the expression of gene promoter region and regulatory gene by target, all play an important role in histiocytic growth, propagation and differentiation, its unconventionality expression may cause numerous disease to comprise the generation (YajimaI of malignant tumour, KumasakaM, ThangND, YanagishitaT, OhgamiN, KallenbergD, NaitoY, YoshikawaT, SakashitaN, KatoM.Zincfingerprotein28asanovelmelanoma-relatedmolecul e.JDermatolSci.2009; 55:68-70.OyanagiH, TakenakaK, IshikawaS, KawanoY, AdachiY, UedaK, WadaH, TanakaF.ExpressionofLUNgenethatencodesanovelRINGfingerpr oteiniscorrelatedwithdevelopmentandprogressionofnon-smal lcelllungcancer.LungCancer.2004; 46:21-28.Witkiewicz-KucharczykA, BalW.DamageofzincfingersinDNArepairproteins, anovelmolecularmechanismincarcinogenesis.ToxicolLett.200 6; 162:29-42.VendrellJA, GhayadS, Ben-LarbiS, DumontetC, MechtiN, CohenPA.A20/TNFAIP3, anewestrogen-regulatedgenethatconferstamoxifenresistance inbreastcancercells.Oncogene.2007; 26:4656-4667.).
Zinc ribbon protein (zincribbonprotein) is the one that zinc refers to proteinoid, structural domain as transcription factor bind nucleic acid is the important component part of general transcription factor in rna plymerase ii, at Growth of Cells, play a role in breeding, and and leukemia, mammary cancer, multidrug resistance and the relevant (HongL of canceration progress of gastrointestinal cancer, PiaoY, HanY, WangJ, ZhangX, DuY, CaoS, QiaoT, ChenZ, FanD.Zincribbondomain-containing1 (ZNRD1) mediatesmultidrugresistanceofleukemiacellsthroughregulat ionofP-glycoproteinandBcl-2.MolCancerTher.2005, 4 (12): 1936-42.ShiY, ZhangY, ZhaoY, HongL, LiuN, JinX, PanY, FanD.OverexpressionofZNRD1promotesmultidrug-resistantphe notypeofgastriccancercellsthroughupregulationofP-glycopr otein.CancerBiolTher.2004, 3 (4): 377-81.WangLH, YangXY, ZhangX, MihalicK, FanYX, XiaoW, HowardOM, AppellaE, MaynardAT, FarrarWL.Suppressionofbreastcancerbychemicalmodulationof vulnerablezincfingersinestrogenreceptor.NatMed.2004, 10 (1): 40-7.HongL, ChenZ, ZhangX, XiaL, HanZ, LuY, JinH, SongJ, QiaoT, FanD.Zincribbondomaincontaining1protein:modulatorofmulti drugresistance, tumorigenesisandcellcycle.ExpOncol.2006, 28 (4): 258-62.).
NOB1p (Ninonebindingprotein) is as a kind of zinc ribbon protein, utilize the 19S of 26S proteasome to regulate subunit p31 (26Sproteasomeregulatorysubunitp31 the earliest, Rpn12) found in yeast by yeast two-hybrid method, assemble at lysosome, play a significant role in the forming process of maturation and ribosome-RNA(rRNA) (ToneY, TanahashiN, TanakaK, FujimuroM, YokosawaH, Toh-eA.Nob1p, anewessentialprotein, associateswiththe26Sproteasomeofgrowingsaccharomycescere visiaecells.Gene.2000, 243 (1-2): 37-45.).The homologous gene NOB1 of Nob1p in the mankind and coded product thereof were cloned from the cDNA library of people's kidney in 2005.This assignment of genes gene mapping, in human chromosome 16q22.1, comprises nine exons and eight introns, cDNA total length 174bp.NOB1 encode 412 aminoacid sequences, molecular weight is the rna binding protein of 46675Da, the aminoterminal of this albumen is containing PIN (PilTaminoterminus) structural domain of a RNase activity, and carboxyl terminal contains conservative zinc ribbon protein structural domain, for being combined (ZhangY with RNA, NiJ, ZhouG, YuanJ, RenW, ShanY, TangW, YuL, ZhaoS.Cloning, expressionandcharacterizationofthehumanNOB1gene.MolBiolR ep.2005; 32 (3): 185-9.).By detecting the expression level of NOB1mRNA in adult Normal human tissue, find that NOB1 is mainly distributed in the tissues such as liver, lung, spleen; The detected result display Nin one binding protein of mammalian cell strain is positioned nucleus.The yeast homologous albumen of NOB1 participates in the synthesis of small subunit ribosome and 26S proteasome, vital role in the proteolysis process that ubiquitin relies on (FaticaA, OeffingerM,
m, TollerveyD.Nob1pisrequiredforcleavageofthe3 ' endof18SrRNA.MolCellBiol.2003; 23:1798-807.ToneY., Toh-eA.Nob1pisrequiredforbiogenesisofthe26Sproteasomeand degradeduponitsmaturationinSaccharomycescerevisiae.Genes Dev.2002; 16:3142-57.).Find that the degraded of proto-protein in the cores such as c-myc, c-fos, p53 and E1A relies on Ubiquitin-Proteasome Pathway (CiechanoverA at present, FinleyD, VarshavskyA.Ubiquitindependenceofselectiveproteindegrada tiondemonstratedinthemammaliancellcyclemutantts85.Cell.1 984; 37:57-66.CiechanoverA, DiGiuseppeJA, BercovichB, OrianA, RichterJD, SchwartzAL, BrodeurGM.Degradationofnuclearoncoproteinsbytheubiquitin systeminvitro.ProcNatlAcadSciUSA.1991; 88:139-43.).Therefore infer that NOB1 may participate in the degraded of some proto-protein.And the generation of the change of small subunit ribosome and 26S proteasome and tumour, development, transfer are relevant with tumor suppression.Therefore, NOB1 and tumour there is certain relation, be expected to the novel targets becoming therapy of tumor.Studies have found that the expression of NOB1p in ovarian cancer tissue is obviously raised at present, NOB1siRNA effectively can suppress the growth activity of ovarian cancer cell SKOV3 and HEY, multiplication capacity and blocks cellular division, significantly suppress the one-tenth knurl ability of nude mice simultaneously, prompting NOB1 occurs to ovarian cancer and develops relevant (LinY, PengS, YuH, TengH, CuiM.RNAi-mediateddownregulationofNOB1suppressesthegrowt handcolony-formationabilityofhumanovariancancercells.Med Oncol.2011.PMID:21287298.).But, not yet there is NOB1 to regulate the correlative study of other tumor cell proliferations beyond ovarian cancer at present.
Summary of the invention
The object of the invention is to methods for the treatment of and the medicine of open and people NOB1 (Ninonebindingprotein) gene-correlation.In order to further investigate the regulatory function of NOB1 in tumour occurs, it is model that the present invention chooses SGC-7901gastriccarcinomacellline, SMMC-7721 liver cancer cells, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 cell, take RNAi as the effect of means research NOB1 in the survival and apoptosis destiny of above-mentioned tumour cell.
First aspect present invention, disclose by people NOB1 gene for the preparation of or screening anti-tumor medicine, or by people NOB1 gene for the preparation of diagnosing tumor medicine.
People NOB1 gene for the preparation of or screening anti-tumor medicine comprise the content of two aspects: one, to be applied to people NOB1 gene for the action target of tumour cell as medicine or preparation and to prepare anti-tumor medicine or preparation; Its two, people NOB1 gene is applied to screening anti-tumor medicine or preparation as medicine or preparation for the action target of tumour cell.
Described people NOB1 gene specifically to be referred to as action target for tumour cell of medicine or preparation: people NOB1 gene is produced the target of RNA interference effect as medicine or preparation for tumour cell, thus the expression level of tumour cell people NOB1 gene can be reduced.
Describedly people NOB1 gene is applied to screening anti-tumor medicine as medicine or preparation for the action target of tumour cell or preparation specifically refers to: as effective object, medicine or preparation are screened by people NOB1 gene, can suppress or promote that the medicine of people NOB1 genetic expression is as oncotherapy drug candidate to find.Namely people NOB1 gene small molecules interference RNA as described later obtains for effective object screening with people NOB1 gene, can be used as the medicine with inhibition tumor cell proliferation function.Such as antibody drug, small-molecule drug etc. also can using NOB1 gene as effective object.
Described by people NOB1 gene for the preparation of diagnosing tumor medicine, refer to preparation people NOB1 gene expression product being applied to diagnosing tumor medicine as a diagnosing tumor index.
Described tumour can be any one tumour that the propagation of its tumour cell is relevant to the expression of people NOB1 gene, further, is a kind of malignant tumour, such as, is selected from: cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and carcinoma of the pancreas.
Described anti-tumor medicine can be small-molecule chemical medicine, antibody medicine, also can be nucleic acid drug.
Further, described anti-tumor medicine can reduce the expression level of people NOB1 gene thus the propagation of inhibition tumor cell.
Adopt the method for forgoing neoplasms medicine treatment tumour, mainly reach therapeutic purpose by the propagation of the expression level inhibition tumor cell reducing people NOB1 gene.
Concrete, during treatment, effectively can reduce the administering substances of people NOB1 gene expression dose in patient.
Further, the described material that effectively can reduce people NOB1 gene expression dose, comprising can the small molecules interference RNA (siRNA) of specificity reticent people NOB1 genetic expression.This small molecules interference RNA (siRNA) can play the effect of the expression of endogenous NO B1 gene in the reticent tumour cell of specificity.
Further, described small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people NOB1 genetic expression of SEQIDNO:1-20.
The target sequence of described small molecules interference RNA reticent people NOB1 genetic expression using the arbitrary sequence being selected from SEQIDNO:1-20 as specificity refers to: this small molecules interference RNA can be combined by the mRNA fragments specific coded by any one sequence in SEQIDNO:1-20, and the expression of specificity silence people NOB1 gene.
Further, describedly can the small molecules interference RNA (siRNA) of specificity reticent people NOB1 genetic expression to express via lentiviral vectors.Specifically, this process comprises: the DNA fragmentation of the described people NOB1 gene small molecules interference RNA of coding is cloned into lentiviral vectors and obtains people NOB1 Gene interfere lentiviral vectors, and then utilizing this people NOB1 Gene interfere lentiviral vectors after virus packaging becomes infectious virion, infected tumor's cell also finally expresses described siRNA.
People NOB1 Gene interfere lentiviral vectors is obtain after the DNA fragmentation of the described people NOB1 gene small molecules interference RNA of coding is cloned into lentiviral vectors, can produce people NOB1 gene small molecules interference RNA.
Further, described lentiviral vectors can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, any one lentiviral vectors in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ, it is carrier that the embodiment of the present invention specifically lists with pGCSIL-GFP.
Lentiviral vectors can slow virus packaging plasmid, clone auxiliary under, become infectious virion through virus packaging.
Second aspect present invention, discloses a kind of people NOB1 gene small molecules interference RNA (siRNA) target fragments of separation, and its sequence is any sequence in SEQIDNO:1-20.
People NOB1 gene small molecules interference RNA (siRNA) target fragments of described separation can be applicable to screening and the preparation of people NOB1 gene small molecules interference RNA.
Third aspect present invention, discloses a kind of people NOB1 gene small molecules interference RNA (siRNA), can the expression of specificity reticent people NOB1 gene.
Described people NOB1 gene small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people NOB1 genetic expression of SEQIDNO:1-20.
Further, described people NOB1 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, and described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment contains the RNA of the arbitrary sequence encoding in SEQIDNO:1-20.
Described just RNA fragment and antisense RNA fragment are present on two different RNA chains or are present on same RNA chain.
The length of described just RNA fragment and antisense RNA fragment is 15-27 Nucleotide; Preferably, length is 19-23 Nucleotide; Best, length is 19,20 or 21 Nucleotide.
Further, described people NOB1 gene small molecules interference RNA is hair clip type single stranded RNA, comprises just RNA fragment, stem ring plate section and antisense RNA fragment, is separated in the middle of just RNA fragment and antisense RNA fragment by stem ring plate section; Wherein, just RNA fragment and antisense RNA fragment complementation, the sequence of just RNA fragment is selected from the arbitrary of SEQIDNO:1-20.
Described stem ring plate segment structure comprises 6 or 9 bases.The sequence of further described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.It is stem ring that the present invention specifically lists with UUCAAGAGA.
As embodiment is enumerated, the sequence of described people NOB1 gene small molecules interference RNA is SEQIDNO:21:CCUGGAGCCAAUCUUCAAGAAUUCAAGAGAUUCUUGAAGAUUGGC UCCAGG.
Fourth aspect present invention, discloses a kind of people NOB1 Gene interfere nucleic acid construct, comprises the gene fragment of aforementioned people NOB1 gene small molecules interference RNA of encoding, can express aforementioned people NOB1 gene small molecules interference RNA.
Described people NOB1 Gene interfere nucleic acid construct can be the gene fragment clone of the aforementioned people NOB1 gene small molecules interference RNA of coding is entered known carrier obtain.
Further, described people NOB1 Gene interfere nucleic acid construct behaviour NOB1 Gene interfere lentiviral vectors, obtain after the gene fragment clone of the described people NOB1 gene small molecules interference RNA of coding is entered lentiviral vectors, people NOB1 gene small molecules interference RNA can be produced.
Described lentiviral vectors can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people NOB1 Gene interfere nucleic acid construct of vector construction that the embodiment of the present invention specifically lists with pGCSIL-GFP, called after pGCSIL-GFP-siNOB1.
Further, the sequence of gene fragment of described people NOB1 gene small molecules interference RNA of encoding contains arbitrary sequence in SEQIDNO:1-20 and complementary sequence thereof.
People NOB1 gene small molecules interference RNA of the present invention can be used for the propagation of inhibition tumor cell, can be used as medicine or the preparation for the treatment of or diagnosing tumour further.People NOB1 Gene interfere nucleic acid construct then can be used for preparing described people NOB1 gene small molecules interference RNA.
When being used as medicine or the preparation for the treatment of tumour, be that the people NOB1 gene small molecules interference RNA of safe and effective amount is applied to Mammals.Certainly, concrete dosage also should consider the factor such as route of administration, patient health situation, and these are all within skilled practitioners skill.
Fifth aspect present invention, discloses a kind of people NOB1 Gene interfere slow virus, by aforementioned people NOB1 Gene interfere lentiviral vectors slow virus packaging plasmid, clone auxiliary under, form through virus packaging.This slow virus can infected tumor's cell produce people NOB1 gene small molecules interference RNA, thus suppresses the propagation of cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and human pancreatic carcinoma cell.
Sixth aspect present invention, also discloses a kind of pharmaceutical composition, the people NOB1 gene small molecules interference RNA containing treatment significant quantity or people NOB1 Gene interfere slow virus.
Further, described pharmaceutical composition contains 1 ~ 99wt% foregoing people NOB1 gene small molecules interference RNA or people NOB1 Gene interfere slow virus, and pharmaceutically acceptable carrier, thinner or vehicle.
When preparing these compositions, usually by activeconstituents and mixed with excipients, or with vehicle dilution, or wrap in can in the carrier that exists of capsule or sachet.When vehicle plays thinner effect, it can be solid, semisolid or the fluent material medium as vehicle, carrier or activeconstituents.Therefore, composition can be tablet, pill, pulvis, solution, syrup, sterilizing injecting solution etc.The example of suitable vehicle comprises: lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, Microcrystalline Cellulose, polyvinylpyrrolidone, Mierocrystalline cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, sanitas (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In sum, the present invention devises 20 RNAi target sequences for people NOB1 gene, build corresponding NOB1RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-siNOB1 of encoding sequence SEQIDNO:20 significantly can lower the expression of NOB1 gene at mRNA level in-site and protein level.Use slow virus (lentivirus, be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-siNOB1 as genetic manipulation instrument the RNAi sequence for NOB1 gene can efficiently be imported SGC-7901gastriccarcinomacellline, SMMC-7721 liver cancer cells, colorectal carcinoma RKO cell, lung carcinoma cell H1299 and carcinoma of the pancreas Panc-1 cell target, reduce the expression level of NOB1 gene, significantly suppress the multiplication capacity of above-mentioned tumour cell.Therefore the NOB1 gene silencing of lentivirus mediated is the potential clinical non-operative treatment mode of malignant tumour.
SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus specificity can suppress the expression of people NOB1 gene, especially slow virus, efficiently can infect target cell, suppress the expression of NOB1 gene in target cell expeditiously, and then suppress the growth of cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and human pancreatic carcinoma cell, promote cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and human pancreatic carcinoma cell apoptosis, significant in the treatment of cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and pancreatic tumour.
Accompanying drawing explanation
Fig. 1 represents pGCSIL-GFP Plasmid diagram
Fig. 2 represents that siNOB1-Lentivirus slow virus infected SGC-7901gastriccarcinomacellline, SMMC-7721 liver cancer cells, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 cell after 5 days, and the expression level of NOB1mRNA significantly reduces.
Fig. 3 represents that siNOB1-Lentivirus slow virus infected SGC-7901gastriccarcinomacellline after 5 days, remarkable antiproliferative effect.
Fig. 4 represents that siNOB1-Lentivirus slow virus infected human hepatocarcinoma BEL-7402 after 5 days, remarkable antiproliferative effect.
Fig. 5 represents that siNOB1-Lentivirus slow virus infected human colon carcinoma RKO cell after 5 days, remarkable antiproliferative effect.
Fig. 6 represents that siNOB1-Lentivirus slow virus infected people lung cancer H1299 cell after 5 days, remarkable antiproliferative effect.
Fig. 7 represents that siNOB1-Lentivirus slow virus infected human pancreas cancer Panc-1 cell after 5 days, remarkable antiproliferative effect.
Fig. 8 uses the immunohistochemical methods detected result of nob1 antibody on different tumor tissues tissue samples
A, b are carcinoma of the pancreas, and c is lung cancer, and d is colorectal carcinoma, and e, f are cancer of the stomach
Embodiment
The present invention is based on the research that zinc ribbon protein may be relevant to the propagation of tumour cell, resistance and transfer etc., think that NOB1 may take part in generation and the development of other malignant tumours except ovarian cancer as a kind of zinc ribbon protein.
The present invention relates to one group of small molecules interference RNA for people NOB1 gene (siRNA) sequence, rna interference vector and RNA and disturb slow virus.Choose the target site of people NOB1mRNA coding region sequence as siRNA, according to continuous print 10-30 in target site (preferred 15-27, more preferably 19-23) individual base sequence design siRNA target sequence.By gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the expression of endogenous NO B1 gene in the reticent human tumor cells of specificity.
Contriver finds, can the propagation of inhibition tumor cell effectively after the expression of NOB1 gene of transferring person under adopting RNAi method, and this achievement in research shows that NOB1 gene is proto-oncogene, can be used as the target spot of oncotherapy.Contriver synthesizes further and tests the multiple siRNA for NOB1 gene, filter out the expression that effectively can suppress NOB1 and then suppressed the siRNA of SGC-7901gastriccarcinomacellline, SMMC-7721 liver cancer cells and colorectal carcinoma RKO cell proliferation and growth, complete the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of interference people NOB1 gene, constructing can the slow virus of the reticent NOB1 genetic expression of specificity.The present invention studies discovery, for siRNA and the RNAi slow virus of people NOB1 gene design, and stable expression of also lowering NOB1 gene specifically, and effectively suppress the propagation of human tumor cells.The present invention shows that NOB1 gene can promote growth of tumour cell, is expected to the target spot becoming early diagnosis of tumor and treatment.And, by the expression of the reticent NOB1 gene of RNAi mode, can be used as the effective means of Tumor suppression development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people NOB1 gene RNAi slow virus: from Genbank, transfer people NOB1 gene order; Prediction siRNA site; Synthesize the effective siRNA sequence for NOB1 gene, two ends are containing the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected with double-stranded DNA Oligo after lentiviral vectors double digestion, the RNAi plasmid of construction expression NOB1 gene siRNA sequence; By assistant carrier (PackingMix, Sigma-aldrich company) the cotransfection HEKC 293T that RNAi plasmid and slow virus packaging need, the recombinant RNA i lentiviral particle of packaging expression NOB1 gene.Lentiviral particle in collecting cell culture supernatant, purified concentration, namely obtains slow virus (siNOB1-Lentivirus) that is pure, stably express NOB1siRNA.
Based on aforesaid method, the invention provides the Effective target site (specifically as shown in SEQIDNO1-20) of 20 interference NOB1 genes, construct the slow virus of special interference people NOB1 gene.
The present invention simultaneously also discloses a kind of people NOB1 gene RNAi slow virus (NOB1-RNAi) and preparation and application thereof.
This research finds, utilizes the RNAi method of lentivirus mediated, after reducing the expression in tumour cell of NOB1 gene, and can the propagation of effective inhibition tumor cell.This research shows, NOB1 gene is a proto-oncogene, can promote tumor cell proliferation, occurs and have important biological function in development in tumour, NOB1 gene can be the target of oncotherapy, and the NOB1 gene specific silence of lentivirus mediated can be used as a kind of new tool of oncotherapy.
The present invention is set forth further below in conjunction with embodiment.Should be understood that embodiment only for illustration of the present invention, but not limit the scope of the invention.In embodiment, the experimental technique of unreceipted actual conditions and the reagent of undeclared formula are conveniently condition, as works such as [U.S.] Sambrook.J; Huang Peitang etc. translate.Molecular cloning texts guide, the third edition.Beijing: the condition of the condition described in Science Press 2002 or manufacturers's suggestion is carried out or configures.
Embodiment 1: for the preparation of people NOB1 gene RNAi slow virus
1. screening is for the effective siRNA target spot of people NOB1 gene
The coding region sequence of people NOB1 (NM_014062) gene is chosen, every the sequence of an initial acquisition of base 20 bases from Genbank; Utilize the design software of Shanghai JiKai Gene Chemical Technology Co., Ltd, with people NOB1mRNA sequence for template, determine 20 effective siRNA target sequences (SEQIDNO:1-20), as shown in table 1:
Table 1 target is in the siRNA target sequence of people NOB1 gene
Double-stranded DNA Oligo sequence (table 2) of two ends containing AgeI and EcoRI restriction enzyme site cohesive end is synthesized for siRNA target spot (for SEQIDNO:20); (Shanghai JiKai Gene Chemical Technology Co., Ltd provides to act on pGCSIL-GFP carrier with AgeI and EcoRI restriction enzyme, Fig. 1), (reaction system is as shown in table 4,37 DEG C to make its linearizing, reaction 1h), agarose gel electrophoresis qualification endonuclease bamhi.
Table 2 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By T4DNA ligase enzyme, by double digestion linearizing, (it is as shown in table 4 that enzyme cuts system, 37 DEG C, reaction 1h) the carrier DNA double-stranded DNA Oligo good with purifying be connected, spend the night in 16 DEG C of connections in suitable buffer system (linked system is as shown in table 5), reclaim and connect product.By fresh competent escherichia coli cell (conversion operation reference: Molecular Cloning: A Laboratory guide second edition 55-56 page) prepared by connection product conversion calcium chloride.Growing bacterium clone surface at connection converted product is stained with, and be dissolved in 10 μ lLB substratum, mixing gets 1 μ l as template; The upstream and downstream of RNAi sequence, designs general PCR primer upstream primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQIDNO:22) in lentiviral vectors; Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQIDNO:23), carries out PCR identification experiment (, as table 6-1, reaction conditions is as table 6-2 for PCR reaction system).The clone positive to PCR qualification checks order and compare of analysis, and the clone that comparison is correct is the RNAi carrier containing SEQIDNO:20 successfully constructed, called after pGCSIL-GFP-siNOB1.
Build pGCSIL-GFP-control negative control plasmids, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQIDNO:24).When building pGCSIL-GFP-control negative control plasmids, for double-stranded DNA Oligo sequence (table 3) of Scr (scramble) siRNA target spot synthesis two ends containing AgeI and EcoRI restriction enzyme site cohesive end, all same pGCSIL-GFP-siNOB1 of all the other construction processs, authentication method and condition.
Table 3 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By the carrier of T4DNA ligase enzyme by double digestion linearizing (it is as shown in table 4 that enzyme cuts system, 37 DEG C, reaction 1h)
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| ddH 2O | 40.5 |
| Total | 50.0 |
Table 5 carrier DNA and double-strand double-stranded DNA Oligo ligation system
| Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connecting groups (μ l) |
| Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase enzyme damping fluid | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligase enzyme | 1.0 | 1.0 | 1.0 |
| ddH 2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Upstream primer | 0.4 |
| Downstream primer | 0.4 |
| Taq polysaccharase | 0.2 |
| Template | 1.0 |
| ddH 2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program setting
2. pack siNOB1-Lentivirus slow virus
Extract the DNA of RNAi plasmid pGCSIL-GFP-siNOB1 with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.24h before transfection, with the HEKC 293T cell of tryptic digestion logarithmic phase, with the DMEM perfect medium adjustment cell density containing 10% foetal calf serum for 1.5 × 10
5cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO
2cultivate in incubator.Transfection is can be used for when cell density reaches 70%-80%.2h before transfection, the original substratum of sucking-off, adds the perfect medium that 1.5ml is fresh.According to the explanation of the MISSIONLentiviralPackagingMix test kit of Sigma-aldrich company, PackingMix (PVM) 20 μ l is added in a sterile centrifugation tube, PEI12 μ l, plasma-free DMEM medium 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed solution.Above-mentioned transfection miscellany is at room temperature hatched 15min, is transferred in the substratum of HEKC 293T cell, 37 DEG C, 5%CO
216h is cultivated in incubator.Discard the developing medium containing transfection miscellany, PBS solution is washed, and adds perfect medium 2ml, continues to cultivate 48h.Collecting cell supernatant liquor, CentriconPlus-20 centrifugal ultrafiltration unit (Millipore) purifying and concentrated slow virus, step is as follows: (1) 4 DEG C, the centrifugal 10min of 4000g, removing cell debris; (2) 0.45 μm of frit supernatant liquors are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, 10-15min, to the viral concentration volume needed; (4), after centrifugal end, filtering cup and filtered solution collection cups are below separated, tipped upside down on by filtering cup on sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from sample collection cup, in sample collection cup, be viral concentration liquid.By after the packing of viral concentration liquid in-80 degrees Celsius of preservations.The siRNA sequence contained in viral concentration liquid is SEQIDNO:21.The wrapping process of contrast slow virus control, with siNOB1-Lentivirus slow virus, only replaces pGCSIL-GFP-siNOB1 carrier with pGCSIL-GFP-control carrier.
Embodiment 2: real-time fluorescence quantitative RT-PCR method detects the silence efficiency of NOB1 gene
Be in the SGC-7901gastriccarcinomacellline of logarithmic phase, SMMC-7721 liver cancer cells and colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 and carry out trysinization, (cell count is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cytogamy degree and reach about 30%.According to infection multiplicity, (the MOI value of SGC-7901 and SMMC-7721 is 20, the MOI value of H1299 cell, Panc-1 and RKO cell is 10) value, virus prepared by the embodiment 1 adding sufficient quantity, replaced medium after cultivation 24h, after time of infection reaches 5 days, collecting cell.According to the Trizol process specifications of Invitrogen company, extracted total RNA.According to the M-MLV process specifications of Promega company, RNA reverse transcription is obtained cDNA (in table 7,42 DEG C are reacted 1h to reverse transcription reaction system, and then water-bath 10min makes reversed transcriptive enzyme inactivation in 70 DEG C of water-baths).
TP800 type RealtimePCR instrument (TAKARA) is adopted to carry out Real_time quantitative detection.The primer of NOB1 gene is as follows: upstream primer 5 '-ATCTGCCCTACAAGCCTAAAC-3 ' (SEQIDNO:25) and downstream primer 5 '-TCCTCCTCCTCCTCCTCAC-3 ' (SEQIDNO:26).With house-keeping gene GAPDH for internal reference, primer sequence is as follows: upstream primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQIDNO:27) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQIDNO:28).By the proportional arrangement reaction system in table 8.
Table 7 reverse transcription reaction system
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H 2O | 3.5 |
| Total | 11.0 |
Table 8Real-timePCR reaction system
| Reagent | Volume (μ l) |
| SYBR premix ex taq： | 10.0 |
| Upstream primer (2.5 μMs): | 0.5 |
| Downstream primer (2.5 μMs): | 0.5 |
| cDNA | 1.0 |
| ddH 2O | 8.0 |
| Total | 20.0 |
Setting program is two-step approach Real-timePCR: denaturation 95 DEG C, 15s; Each step sex change 95 DEG C afterwards, 5s; Annealing extension 60 DEG C, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR terminates, 95 DEG C of sex change 1min, are then cooled to 55 DEG C, and DNA double chain is fully combined.To 95 DEG C from 55 DEG C, each walks increase by 0.5 DEG C, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2-
Δ Δ Ctanalytical method calculates and has infected the gene expression abundance of NOB1mRNA.With infect contrast virus (control) cell compare, as shown in Figure 2, in experimental group, the NOB1mRNA expression level of SGC-7901gastriccarcinomacellline, SMMC-7721 liver cancer cells, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 have dropped for 91.2%, 67.6%, 60.0%, 92.5% and 96.6% (as shown in Figure 2) to result respectively.
Embodiment 3: detect the multiplication capacity infecting the tumour cell of siNOB1-Lentivirus slow virus
Be in the SGC-7901gastriccarcinomacellline of logarithmic phase, SMMC-7721 liver cancer cells, colorectal carcinoma RKO cell lung cancer H1299 cell and carcinoma of the pancreas Panc-1 and carry out trysinization, (cell count is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cytogamy degree and reach about 30%.According to infection multiplicity, (the MOI value of SGC-7901 and SMMC-7721 is 20, the MOI value of H1299 cell, Panc-1 and RKO cell is 10), add the siNOB1-Lentivirus virus of sufficient quantity, replaced medium after cultivation 24h, after time of infection reaches 5 days, collect each experimental group cell being in logarithmic phase.The resuspended one-tenth cell suspension (2 × 10 of perfect medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Often organize 5 multiple holes, every hole 100 μ l.After completing plate, put 37 DEG C, 5%CO
2incubator is cultivated.From after bed board second day, every day was detected with Cellomics instrument (ThermoFisher) and reads plate once, and continuous detecting reads plate 5 days.By adjusting the input parameter of Cellomicsarrayscan, calculating the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, statistics being carried out to data and draws, draw cell proliferation curve (result is as shown in Fig. 3-Fig. 7).Result shows, siNOB1-Lentivirus slow virus infects each tumour of group at cell injuring model after 5 days, rate of propagation significantly slows down, far below the rate of propagation of control group tumour cell, vigor cell number have dropped 75.5%, 80.5%, 98.3%, 81.3% and 60.4% respectively, shows that NOB1 gene silencing causes tumor cell proliferation ability suppressed.
The test of NOB1 gene overexpression in embodiment 4 tumour cell
Tissue samples: human pancreas cancer, lung cancer, colorectal carcinoma and stomach organization sample
NOB1 antibody: available from Sigma
Test method:
Take out organization chip, organization chip is toasted 30 minutes in 60 DEG C of thermostat containers.Then to organization chip dewaxing, dewaxing process is: dimethylbenzene 15 minutes, dimethylbenzene: ethanol=1: in 1 mixed liquid, in dehydrated alcohol, in 95% ethanol, in 85% ethanol, in 75% ethanol, soak 10 minutes successively in distilled water; Then fresh 3%H is configured with distilled water or PBS
2o
2, room temperature closes 10 minutes; Organization chip is put into by antigen retrieval high fire heating 0.01M sodium citrate buffer (pH6.0) in microwave oven to boiling, and low fire maintains 20 minutes; After naturally cooling to room temperature, insert in distilled water and soak 10 minutes; 10% serum (TBS preparation) closes 30 minutes; Serum is abandoned in suction, does not wash and adds NOB1 antibody (1: 100 dilution) overnight incubation; TBS washes 2 times, each 5 minutes; The goat-anti rabbit two adding HRP mark resists, incubated at room 60 minutes; TBS washes 4 times, each 5 minutes; Add DAB dyeing, until aobvious light yellow, put into distilled water termination reaction; 30 seconds are soaked, clear water rinsing 7-8 time with bush; Dehydration mounting, in 75% ethanol, 85% ethanol, 95% ethanol, dehydrated alcohol, dimethylbenzene: ethanol=1: 1 mixed liquid, in dimethylbenzene, leaching puts 5 minutes successively; After taking-up, drip 30ul neutral gum, use cover glass mounting, dry, observations, take pictures, result as shown in Figure 8.
Result shows:
Use NOB1 antibody to carry out Immunohistochemical Expression detection to carcinoma of the pancreas, lung cancer, colorectal carcinoma and stomach organization, found that, in different tissues sample, all can find the high expression level of NOB1 gene coded protein.The representative of figure Oxford gray is expressed positive.Based on this experimental result, think and carry out auxiliary diagnosis cancer by the expression detecting histocyte NOB1 gene.
Claims (11)
1. the purposes of small molecules interference RNA in preparation or screening anti-tumor medicine, the sequence of described small molecules interference RNA is for shown in SEQIDNO:21, and described tumour is selected from cancer of the stomach, liver cancer, colorectal carcinoma and lung cancer.。
2. the people NOB1 gene small molecules interference RNA target fragments be separated, its sequence is SEQIDNO:20.
3. a people NOB1 gene small molecules interference RNA, can the expression of specificity reticent people NOB1 gene, the target sequence of described people NOB1 gene small molecules interference RNA reticent people NOB1 genetic expression using SEQIDNO:20 as specificity, described people NOB1 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment is the RNA of SEQIDNO:20 coding.
4. people NOB1 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, described people NOB1 gene small molecules interference RNA is hair clip type single stranded RNA, is separated in the middle of described just RNA fragment and described antisense RNA fragment by stem ring plate section.
5. people NOB1 gene small molecules interference RNA as claimed in claim 4, it is characterized in that, the sequence of described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.
6. people NOB1 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, the sequence of described people NOB1 gene small molecules interference RNA is SEQIDNO:21.
7. a people NOB1 Gene interfere nucleic acid construct, comprises the gene fragment of people NOB1 gene small molecules interference RNA described in the arbitrary claim of coding claim 3-6, can express people NOB1 gene small molecules interference RNA.
8. people NOB1 Gene interfere nucleic acid construct as claimed in claim 7, is characterized in that, described people NOB1 Gene interfere nucleic acid construct behaviour NOB1 Gene interfere lentiviral vectors.
9. people NOB1 Gene interfere nucleic acid construct as claimed in claim 8, it is characterized in that, described lentiviral vectors is selected from:
pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、
pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-TagCFP、
pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-TagFP635、
pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-1xLacO、
pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、
pLenti6/BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、
Arbitrary in pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
10. a people NOB1 Gene interfere slow virus, by people NOB1 Gene interfere nucleic acid construct described in the arbitrary claim of claim 7-9 slow virus packaging plasmid, clone auxiliary under, form through virus packaging.
11. 1 kinds of pharmaceutical compositions, people NOB1 Gene interfere slow virus described in people NOB1 gene small molecules interference RNA or claim 10 described in the arbitrary claim of claim 3-6 containing treatment significant quantity, and pharmaceutically acceptable carrier, thinner or vehicle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210005128.8A CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110425830.5 | 2011-12-19 | ||
| CN201110425830 | 2011-12-19 | ||
| CN201210005128.8A CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102559895A CN102559895A (en) | 2012-07-11 |
| CN102559895B true CN102559895B (en) | 2016-01-06 |
Family
ID=46406495
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210005128.8A Active CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559895B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803053B (en) * | 2014-12-31 | 2021-03-16 | 上海吉凯基因科技有限公司 | Application of human RBM17 gene and related medicine thereof |
| CN107988230A (en) * | 2018-01-17 | 2018-05-04 | 南通大学附属医院 | Suppress the siRNA molecule of NOB1 genes |
| CN108192895B (en) * | 2018-01-17 | 2024-02-06 | 南通大学附属医院 | siRNA molecule targeting NOB1 gene and application thereof |
-
2012
- 2012-01-10 CN CN201210005128.8A patent/CN102559895B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| "NOB1基因与肿瘤";董波;《第二军医大学学报》;20110430;第32卷(第4期);432-434 * |
| "应用RNA干扰沉默NOB1基因对卵巢癌HEY细胞增殖和周期的影响";林杨;《中国妇幼保健》;20100331(第8期);摘要、第1077页左栏第1段、第1079页右栏第2-3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102559895A (en) | 2012-07-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN103421886B (en) | The purposes and its related drugs of CIZ1 genes | |
| CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
| CN103301474B (en) | Usage and related drugs of human RNF40 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |