CN103667430B - A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene - Google Patents
A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene Download PDFInfo
- Publication number
- CN103667430B CN103667430B CN201210349845.2A CN201210349845A CN103667430B CN 103667430 B CN103667430 B CN 103667430B CN 201210349845 A CN201210349845 A CN 201210349845A CN 103667430 B CN103667430 B CN 103667430B
- Authority
- CN
- China
- Prior art keywords
- nono
- genes
- plko
- gene
- slow virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The present invention relates to biological technical fields, and in particular to the purposes and its related drugs of eight polynucleotide binding protein expression gene of people.The invention discloses purposes of the eight polynucleotide binding protein expression gene of people in oncotherapy, diagnosing tumor and medicine preparation, and the small molecules interference RNA for eight polynucleotide binding protein expression gene of people, gene interfering nucleic acid construct, gene interference slow virus are further constructed, discloses their purposes.SiRNA provided by the invention or nucleic acid construct comprising the siRNA sequence, slow virus can specificity inhibit the protein-bonded expression of eight polynucleotide of people, especially slow virus, target cell can efficiently be infected, expeditiously inhibit the protein-bonded expression of eight polynucleotides in target cell, and then inhibit the growth of tumour cell, promote apoptosis of tumor cells, be of great significance in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to the purposes of eight polynucleotide binding protein expression gene of people
And its related drugs.
Background technology
RNA is disturbed（RNA interference,RNAi）The short double-stranded RNA (dsRNA) formed with nucleotide carries out
Posttranscriptional gene silencing.It can efficiently, specifically block the expression of internal specific gene, cause its degradation, so as to cause biology
The silence of internal specific gene, makes cells show go out the missing of certain gene phenotype, and being that one kind emerging in recent years is common grinds
Study carefully gene function, the laboratory technique for finding disease treatment method.Research shows that the double-stranded RNA that length is 21-23nt can be
Transcription causes RNAi with post-transcriptional level specificity（Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi:
double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23
nucleotide intervals.Cell 2000;101:25-33.）.Though tumor patient through chemotherapy, radiotherapy and complex treatment,
Five year survival rate is still very low, as can the gene related with progress to tumor invasion is intervened, will be that the treatment of tumour is opened up
New way.In recent years, RNAi has become the available strategy of the gene therapy of tumour.It can inhibit former cancer base using RNAi technology
Inhibit tumor progression because of the expression of tumor suppressor gene, Cell cycle-related genes, the anti-apoptotic related gene etc. of, mutation
（Uprichard,Susan L.The therapeutic potential of RNA interference.FEBS Letters
2005;579:5996-6007.）.
Nono（non-POU domain containing,octamer-binding）It is a kind of nucleoprotein of function complexity
（Yaron ST, Dov Z.PSF and p54nrb/Nono muti-functional nuclear proteins.FEBS
Letters.2002;531:109-114.）, it participates in the processing of cell nuclear RNA（Zhang Z,Carmichael GG.The
fate of dsRNA in the nucleus:a p54nrb-containing complex mediates the nuclear
retention of promiscuously A-to-Iedited RNAs.Cell.2001;106(4):465-75.）, gene
Transcriptional control（Mathur M, Tucker PW, Samuels HH.PSF is a novel corepressor that
mediates its effect through Sin3A and the DNA binding domain of nuclear
hormone receptors.Mol Cell Biol.2001;21(7):2298-311.）, DNA restructuring pairing（Straub T,
Knudsen BR,and Boege F.PSF/p54nrb Stimulates“Jumping”of DNA Topoisomerase I
between Separate DNA Helices.Biochemistry.2000;39(25):7552-8.）Etc. various nuclear reactions
Process.As a kind of nucleic acid binding protein, Nono has DNA/RNA dual combination abilities, often with the shape of monomer or heterodimer
Formula is combined with other nuclear factors plays a role or is formed the various of the interior generation of DNA/RNA- nuclear factors complex participation nucleus
React (Yang YS, Hanke JH, Carayannopoulos L, and et al.NonO, a non-POU-domain-
containing,octamer-binding protein,is the mammalian homolog of Drosophila
nonAdiss.Mol Cell Biol.1993;13(9):5593–5603.).At present, to the research of Nono biological functions also not
Comprehensively, the adjustment effect on Nono in tumour generation is still not clear.
Nono and p54nrbWith high homology, they only differ several amino acid on amino acid composition, and express
Spectral limit is wide, has expression in most of tissues and cell（Yang YS,Hanke JH,Carayannopoulos L,and
et al.NonO,a non-POU-domain-containing,octamer-binding protein,is the
mammalian homolog of Drosophila nonAdiss.Mol Cell Biol.1993;13(9):5593–
5603.）.Some researches show that p54nrbApparent up-regulation is expressed in human melanoma cell, after knocking out the gene, can effectively be pressed down
Melanoma cell growth processed is active, multiplication capacity and blocks cellular divide, and shows p54nrbOne is played in neoplastic process
Fixed effect（Schiffner S,Zimara N,Schmid R,et al.p54nrb is a new regulator of
progression of malignant melanoma.Carcinogenesis.2011;32(8)：1176-1182.）.In kidney
In mamillary cytoma, PSF and p54nrbWith the TFE3 genes on X chromosome transposition, and chromosome occur for/Nono respectively
Transposition may cause proto-oncogene to be activated, closely related with the generation of kinds of tumors（Clark J, Lu YJ, Sidhar SK,
et al.Fusion of splicing factor genes PSF and NonO(p54nrb)to the TFE3 gene in
papillary renal cell carcinoma.Oncogene.1997;15(18):2233-2239.）.Simultaneously in prostate
In tissue, p54 is also detected thatnrbAbnormal expression raises（Ishiguro H,Uemura H,Fujinami K,et al.55kDa
NUCLEAR MATRIX PROTEIN(nmt55)mRNA IS EXPRESSED IN HUMAN PROSTATE CANCER
TISSUE AND IS ASSOCIATED WITH THE ANDROGEN RECEPTOR.Int.J.Cancer.2003;105:26-
32.）.Above research prompting p54nrbClosely related with the occurrence and development of kinds of tumors, Nono is as p54nrbVery high homology egg
In vain, it is presumed that it may also assist in the occurrence and development of malignant tumour.
In order to further investigate regulatory functions of the NONO in tumour generation, it is thin that the present invention chooses stomach cancer, lung cancer and glioma
Born of the same parents' model, using effects of the RNAi as means research NONO in stomach cancer, lung cancer and glioma occurrence and development.
The content of the invention
It is an object of the invention to open therapies and medicine with eight polynucleotide binding protein expression gene-correlation of people
Object is disturbed with RNA（RNAi）For survival of the eight polynucleotide binding protein expression gene of means research in tumour cell and apoptosis
Effect in the process.
Eight polynucleotides binding protein expression gene of the present invention for NONO (non-POU domain containing,
Octamer-binding) gene.
First aspect present invention using RNA interference as means, has studied work of the NONO genes in tumour occurrence and development
With disclosing a kind of inhibition or reduction growth of tumour cell, multiplication, differentiation and/or the method for survival, this method includes：To swollen
Oncocyte applies a kind of transcription for being capable of specificity inhibition NONO genes or translation or being capable of specificity eight polynucleotide knot of inhibition
The expression of hop protein or the molecule of activity inhibit the growth of tumour cell, multiplication, differentiation and/or survival with this.
The tumour cell is selected from its growth expression protein-bonded with eight polynucleotides or the relevant tumour cell of activity.
Preferably, the tumour cell is selected from any of stomach cancer, lung cancer and glioma.
In the inhibition or reduction growth of tumour cell, multiplication, differentiation and/or the method for survival, the application of the molecule
It measures the transcription to reduce NONO genes enough or translation or reduces the expression of NONO albumen or the dosage of activity enough.Into one
Step, the expression of the NONO genes is at least lowered 50%, 80%, 90%, 95% or 99%.
The molecule may be selected from but be not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine,
Polypeptide, albumen or interference slow virus.
The nucleic acid includes but not limited to：Antisense oligonucleotides, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence of NONO genes or NONO genes
Information sequence.
Further, the double-stranded RNA is siRNA（siRNA）.The siRNA includes the first chain and second
RNA dimers, and the sequence of first chain and NONO genes is collectively formed in chain, first chain and the second chain complementation
Middle 15-27 continuous nucleotide sequences are essentially identical.It is encoded that the small molecules interference RNA can specifically bind target sequence
MRNA segments, and the expression of specific silence people's NONO genes.
Further, the first chain-ordering of the siRNA and the target sequence in NONO genes are essentially identical.It is more excellent
, the target sequence in the NONO genes contains SEQ ID NO:Any sequence in 1-7.
When target sequence in the NONO genes is the small molecules interference RNA specificity silence NONO gene expressions,
With the small molecules interference RNA it is complementary with reference to mRNA segments corresponding to NONO genes in segment.
Preferably, the NONO gene sources are in people.
First aspect present invention also disclose a kind of separated people NONO genes prepare or screen anti-tumor medicine or
Purposes of the person in diagnosing tumor drug is prepared.
Further, the tumour is selected from stomach cancer, lung cancer or glioma.
It is described by separated NONO genes be used to prepare or screen anti-tumor medicine include both sides content：First,
It is applied to prepare anti-tumor medicine or preparation for the action target of tumour cell using NONO genes as drug or preparation；Its
Two, it is applied to screening anti-tumor medicine or system for the action target of tumour cell using NONO genes as drug or preparation
Agent.
It is described to be applied to prepare oncotherapy for the action target of tumour cell using NONO genes as drug or preparation
Drug or preparation specifically refer to：Using NONO genes as the target of RNA interference effects, come develop for tumour cell drug or
Preparation, so as to reduce the expression of NONO genes in tumour cell.
It is described to be applied to screening oncotherapy for the action target of tumour cell using NONO genes as drug or preparation
Drug or preparation specifically refer to：Using NONO genes as effective object, drug or preparation are screened, can be inhibited with finding
Or promote the drug of people's NONO gene expressions as oncotherapy drug candidate.NONO gene small molecules as described in the present invention are done
Disturb RNA（siRNA）It is to be obtained by effective object screening of people NONO genes, can be used as that there is inhibition tumor cell proliferation to make
Drug.In addition, such as antibody drug, small-molecule drug etc. also can be using NONO genes and its albumen as effect pair
As.
It is described that NONO genes are used to prepare diagnosing tumor drug, refer to using NONO gene expression products as a tumour
Diagnosis index is applied to the preparation of diagnosing tumor drug.
The anti-tumor medicine is to be capable of the specific transcription for inhibiting NONO genes or translation or specific can inhibit
The expression of NONO albumen or the molecule of activity, so as to reduce the expression of NONO genes in tumour cell, reach inhibition tumour
Multiplication, growth, differentiation and/or the purpose of survival of cell.
It is described to prepare or screen the anti-tumor medicine obtained or diagnosing tumor drug bag by separated NONO genes
It includes but is not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine, polypeptide, albumen or the slow disease of interference
Poison.
The nucleic acid includes but not limited to：Antisense oligonucleotides, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The amount of application of the anti-tumor medicine is the transcription or translation of reduction people's NONO genes enough or reduction enough
The expression of people's NONO albumen or the dosage of activity.With make one the expression of NONO genes be at least lowered 50%, 80%, 90%, 95% or
99%。
Using the method for forgoing neoplasms medicine treatment tumour, the mainly expression by reducing people's NONO genes
Inhibit the multiplication of tumour cell to achieve the purpose that treatment.Specifically, during treatment, people's NONO gene expression water will be effectively reduced
Flat administering substances are in patient.
Second aspect of the present invention discloses a kind of separated nucleic acid molecules for reducing NONO gene expressions in tumour cell, institute
Nucleic acid molecules are stated to include：
A) double-stranded RNA, in the double-stranded RNA containing can be under stringent condition with NONO gene recombinations nucleotides sequence
Row；Or
B) nucleotide sequence that can be under stringent condition with NONO gene recombinations is contained in shRNA, the shRNA.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary common
Form RNA dimers, and the sequence of first chain and 15-27 in the NONO genes basic phases of continuous nucleotide sequence
Together.Preferably, the sequence of first chain and 19-23 in NONO genes continuous nucleotide sequences are essentially identical；More preferably,
The sequence of first chain and 19,20 or 21 in NONO genes continuous nucleotide sequences are essentially identical.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary altogether
With formation RNA dimers, and the sequence of first chain and the target sequence in NONO genes are essentially identical.
Further, the shRNA include positive-sense strand segment and antisense strand segment and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and 15-27 in NONO genes continuous nucleotide sequences are essentially identical.It can become after the shRNA is processed
SiRNA（siRNA）And then play the role of endogenous NONO gene expressions in specific silence tumour cell.
Further, the shRNA include positive-sense strand segment and antisense strand segment and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and the target sequence in NONO genes are essentially identical.
First chain of the double-stranded RNA or the positive-sense strand segment of the shRNA and the basic phase of target sequence in NONO genes
Together, when the target sequence of the NONO genes is that siRNA is used for specific silence NONO gene expressions, identified by the siRNA
And the segment in the NONO genes corresponding to the mRNA segments of silence.
Preferably, the target sequence in the NONO genes contains SEQ ID NO:Any sequence of 1-7.
Further, the NONO gene sources are in people.
The length of first chain of double-stranded RNA and the second chain is 15-27 nucleotide；Preferably, length is 19-23
A nucleotide；Optimal, length is 19,20 or 21 nucleotide.
Further, the double-stranded RNA is siRNA（siRNA）.Further, first chain of siRNA
Sequence such as SEQ ID NO：It is specially 5 '-GCAGGCGAAGUCUUCAUUCAU-3 ' shown in 19.
SEQ ID NO：SiRNA shown in 19 is with SEQ ID NO:Sequence shown in 1 disturbs target sequence design for RNA
, a chain of siRNA for people's NONO genes, another chain i.e. sequence of the second chain is complementary with the first chain-ordering,
The siRNA can play the role of endogenous NONO gene expressions in specific silence tumour cell.
Further, the sequence of the loop-stem structure of the shRNA may be selected from following any：UUCAAGAGA、AUG、CCC、
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of the shRNA such as SEQ ID NO:Shown in 20, it is specially：5’-
GCAGGCGAAGUCUUCAUUCAUUUCAAGAGAAUGAAUGAAGACUUCGCCUGC-3’。
ShRNA can become siRNA after digestion is processed, and then play endogenous people NONO in specific silence tumour cell
The effect of gene expression.
The interference slow virus carrier for encoding the genetic fragment of shRNA of the present invention contains SEQ ID NO:Appointing in 1-7
One sequence and its complementary series.
Third aspect present invention discloses a kind of NONO genes interfering nucleic acid construct, containing coding of the present invention point
From nucleic acid molecules in shRNA genetic fragment, the shRNA can be expressed.
People's NONO gene interfering nucleic acid constructs can will encode the gene piece of foregoing people NONO genes shRNA
Section is cloned into known carrier acquisition.Further, the NONO genes interfering nucleic acid construct disturbs slow virus for NONO genes
Carrier.
The NONO genes interference slow virus carrier of the present invention is to clone the DNA fragmentation for encoding foregoing NONO genes shRNA
Enter known carrier acquisition, the known carrier is mostly slow virus carrier, and the NONO genes interference slow virus carrier is by virus
After packaging becomes infectious virion, infected tumor's cell, and then shRNA of the present invention is transcribed out, pass through digestion
Processing and etc., the siRNA is finally obtained, for the expression of specific silence NONO genes.
Further, the NONO genes interference slow virus carrier also contains promoter sequence and/or codes for tumor cell
In the nucleotide sequence of label that can be detected；Preferably, the label the being detected such as green fluorescent protein
（GFP）.
Further, the slow virus carrier can be selected from：pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
The people NONO genes that the embodiment of the present invention specifically lists using pGCSIL-GFP as vector construction disturb slow virus to carry
Body is named as pGCSIL-GFP-NONO-siRNA.
The separated nucleic acid molecules of the present invention can be used for the drug for preparing prevention or treatment tumour, and the tumour is stomach cancer, lung
Cancer or glioma.
The NONO gene siRNAs of the present invention can be used for the multiplication for inhibiting tumour cell, and it is swollen further to may be used as treatment
The drug or preparation of knurl.NONO genes interference slow virus carrier then can be used for preparing the NONO gene siRNAs.When as treatment
It is that the nucleic acid molecules of safe and effective amount are applied to mammal when the drug or preparation of tumour.Specific dosage is also taken an examination
Administration route, the factors such as patient health situation are considered, within the scope of these are all skilled practitioners technical ability.
Fourth aspect present invention discloses a kind of NONO genes interference slow virus, slow virus is disturbed by foregoing NONO genes
Carrier slow virus packaging plasmid, cell line auxiliary under, packed by virus.The slow virus can infected tumor's cell simultaneously
The small molecules interference RNA for NONO genes is generated, so as to inhibit the multiplication of stomach cancer, lung cancer or glioma tumor cell.It should
NONO genes interference slow virus can be used for the drug for preparing prevention or treatment tumour.
Fifth aspect present invention, discloses a kind of pharmaceutical composition for being used to preventing or treating tumour, and active principle contains
There are foregoing separated nucleic acid molecules, NONO gene interfering nucleic acid constructs and/or NONO genes interference slow virus.
Further, described pharmaceutical composition contains double-stranded RNA described in 1~99wt%, shRNA, NONO gene interfering nucleic acid
Construct or NONO genes interference slow virus and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositions, usually active ingredient is mixed with excipient or with figuration dilution agent or Bao Ke
With in carrier existing for capsule or sachet.When excipient plays diluent, it can be solid, semisolid or liquid
Medium of the material as excipient, carrier or active ingredient.Therefore, composition can be tablet, pill, pulvis, solution, sugar
Starch agent, sterilizing injecting solution etc..The example of suitable excipient includes:Lactose, glucose, sucrose, sorbierite, mannitol, shallow lake
Powder, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, etc..Preparation may also include:Wetting agent, emulsifier, preservative
(such as methyl hydroxybenzoate and propyl ester), sweetener.
It is controlled the invention also discloses described pharmaceutical composition in any tumour for preparing treatment stomach cancer, lung cancer and glioma
Treat the application in drug.
The application of the pharmaceutical composition provides a method for the treatment of tumour, is specially a kind of prevention or treatment object
The method of in-vivo tumour, including the pharmaceutical composition of effective dose is applied in object.
Described pharmaceutical composition is for preventing or during treatment object in-vivo tumour, it is necessary to the drug by effective dose
Composition is applied in object.Using this method, growth, multiplication, recurrence and/or the transfer of the tumour are suppressed.Further
, the growth of the tumour, multiplication, at least the 10% of recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%th, 95% or 99% part is suppressed.
Sixth aspect present invention discloses a kind of kit of the NONO gene expressions for reducing in tumour cell, institute
Stating kit includes：The separated nucleic acid molecules being present in container, NONO gene interfering nucleic acid constructs and/or institute
The NONO genes interference slow virus stated.
In conclusion the present invention devises 7 RNAi target sequences for people's NONO genes, structure is corresponding
NONORNAi carriers, wherein coded sequence SEQ ID NO：1 RNAi carrier pGCSIL-GFP-NONO-siRNA can significantly under
Adjust expression of the NONO genes in mRNA level in-site and protein level.Use slow virus（Lentivirus is abbreviated as Lv）As gene
Operation instrument carry RNAi carrier pGCSIL-GFP-NONO-siRNA can target the RNAi sequences for NONO genes is high
Effect imports human gastric cancer SGC7901 cells, lung cancer H1299 cells and glioma U87 cells, reduces the expression of NONO genes,
Significantly inhibit the multiplication capacity of above-mentioned tumour cell.Therefore the NONO gene silencings of lentivirus mediated are that malignant tumour is potentially faced
Bed non-operative treatment mode.
SiRNA provided by the invention or nucleic acid construct comprising the siRNA sequence, slow virus can specificity inhibit
The expression of people's NONO genes, especially slow virus, can efficiently infect target cell, expeditiously inhibit NONO genes in target cell
Expression, and then inhibit tumour cell growth, promote apoptosis of tumor cells, be of great significance in oncotherapy.
Description of the drawings
Fig. 1：PGCSIL-GFP Plasmid diagrams
Fig. 2：NONO-RNAi slow virus infects human gastric cancer SGC7901 cells, lung cancer H1299 cells and glioma U87 cells
After 5 days, the expression of NONO mRNA significantly reduces
Fig. 3：NONO-RNAi slow virus infected human gastric cancer SGC7901 cells after 5 days, caused cell inhibitory effect
Fig. 4：NONO-RNAi slow virus infected human lung cancer H1299 cells after 5 days, caused cell inhibitory effect
Fig. 5：NONO-RNAi slow virus infected people glioma U87 cells after 5 days, caused cell inhibitory effect
Specific embodiment
The present invention relates to the small molecules interference RNAs that one group is directed to people's NONO genes（siRNA）Sequence, rna interference vector
Slow virus is disturbed with RNA.Target site of people's NONO mRNA coding region sequences as siRNA is chosen, according to continuous in target site
10-30（It is preferred that 15-27, more preferable 19-23）A base sequence designs siRNA target sequences.Pass through gene cloning, structure expression
The nucleic acid construct of above-mentioned siRNA, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence energy
The expression of endogenous NONO genes in enough specificity silence human tumor cells.
Inventor has found, using the increasing that tumour cell can be effectively inhibited after the expression of mediator's NONO genes under RNAi methods
It grows, this achievement in research shows that NONO genes are proto-oncogenes, can be as the target spot of oncotherapy.Inventor further synthesis and
A variety of siRNA for NONO genes are tested, filtered out the expression that can effectively inhibit NONO and then inhibit human gastric cancer
SGC7901 cells, lung cancer H1299 cells and glioma U87 cell Proliferations and the siRNA of growth complete this on this basis
Invention.
The present invention provides a series of siRNAs of interference people's NONO genes（siRNA）Sequence, constructing can specificity
The slow virus of silence NONO gene expressions.The present invention is the study found that slow for the siRNA and RNAi of the design of people NONO genes
Virus is stablized and specifically lowers the expression of NONO genes, and effectively inhibits the multiplication of human tumor cells.Present invention demonstrates that
NONO genes can promote growth of tumour cell, be expected to become the target spot of early diagnosis of tumor and treatment.Moreover, pass through RNAi modes
The expression of silence NONO genes, can be as the effective means for inhibiting tumor development.
The present invention mentality of designing be：
The present invention screens by the following method obtains a kind of people NONO gene RNAi slow virus：It is transferred from Genbank
People's NONO gene orders；Predict siRNA sites；For the effective siRNA sequence of NONO genes, both ends contain restriction enzyme site for synthesis
The double-stranded DNA Oligo of cohesive end；It is connected after slow virus carrier double digestion with double-stranded DNA Oligo, structure expression NONO genes
The RNAi plasmids of siRNA sequence；The assistant carrier that RNAi plasmids and slow virus packaging are needed（Packing Mix, Sigma-
Aldrich companies）Cotransfection human embryonic kidney cells 293T generates recombinant slow virus particle, you can efficient silence NONO genes are made
Slow virus.
Based on the above method, the present invention provides the Effective target sites of 7 interference NONO genes（Specific such as SEQ ID NO:1-
Shown in 7）, construct the special slow virus for disturbing people's NONO genes.
Invention additionally discloses a kind of people NONO gene RNAi slow virus simultaneously（NONO-RNAi）And its preparation and application.
The study find that using the RNAi methods of lentivirus mediated, expression of the NONO genes in tumour cell is being reduced
Afterwards, the multiplication of tumour cell can effectively be inhibited.The study show that NONO genes are a proto-oncogenes, tumour can be promoted thin
Born of the same parents are proliferated, and have important biological function in tumour occurrence and development, and NONO genes can be the target of oncotherapy, slowly
Virus-mediated NONO gene specifics silence can be as a kind of new tool of oncotherapy.
With reference to embodiment, the present invention is further explained.It is to be understood that embodiment is merely to illustrate the present invention, and it is unrestricted
The scope of the present invention.It is according to conventional strip that the experimental method of actual conditions and the reagent of undeclared formula are not specified in embodiment
Part, such as ［ beautiful ］ Sambrook.J works；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing：Science Press
The condition that condition or manufacturer described in 2002 are suggested carries out or configuration.
Embodiment 1 is directed to the preparation of people NONO gene RNAi slow virus
1. screening is for the effective siRNA target spots of people's NONO genes
NONO is transferred from Genbank（NM_007363）Gene information；Utilize Shanghai JiKai Gene Chemical Technology Co., Ltd
Design software Genechem design for NONO genes effective siRNA target spots.In the coded sequence of NONO genes（CDS）
In region, the sequence of 21 bases is obtained every a base starting, table 1 lists wherein 7 for the effective of NONO genes
SiRNA target sequences.
Table 1 targets the siRNA target sequences of people's NONO genes
| SEQ ID NO | TargetSeq | Initiation site |
| 1 | GCAGGCGAAGTCTTCATTCAT | 469 |
| 2 | GCTGCTACAATGGAAGGAATT | 1483 |
| 3 | GCCAGAATTCTACCCTGGAAA | 1644 |
| 4 | CAGGCGAAGTCTTCATTCATA | 895 |
| 5 | CCTCAGTATGTGTCCAACGAA | 1062 |
| 6 | TCCAGAGAAGCTGGTTATAAA | 1304 |
| 7 | TGAGCACCAGGTCATGCTAAT | 1511 |
2. the preparation of slow virus carrier
For siRNA target spots（With SEQ ID NO：Exemplified by 1）Synthesize both ends I containing Age and EcoR I restriction enzyme site cohesive ends
Double-stranded DNA Oligo sequences（Table 2）；PGCSIL-GFP carriers are acted on Age I and EcoR I restriction enzymes（Shang Haiji
Triumphant chemical gene Technology Co., Ltd. provides, Fig. 1）, make its linearisation, agarose gel electrophoresis identification endonuclease bamhi.
The double-stranded DNA Oligo of 2 both ends I containing Age and EcoR I restriction enzyme site cohesive ends of table
Double digestion is linearized by T4 DNA ligases（Digestion system is as shown in table 4,37 DEG C, reacts 1h）Carrier
DNA is connected with purified double-stranded DNA Oligo, in appropriate buffer system（Linked system is as shown in table 5）In in 16 DEG C of companies
Night is taken over, recycles connection product.Fresh competent escherichia coli cell prepared by connection product conversion calcium chloride（Conversion behaviour
It refers to：55-56 pages of the Molecular Cloning:A Laboratory guide second edition）.
Bacterium clone surface is grown in connection converted product to be stained with, is dissolved in 10 μ l LB culture mediums, mixing takes 1 μ l as mould
Plate；The upstream and downstream of RNAi sequences in slow virus carrier, designs general PCR primer（Upstream primer sequence：5’-
CCTATTTCCCATGATTCCTTCATA-3’（SEQ ID NO：12）；Downstream primer sequence：5’-
GTAATACGGTTATCCACGCG-3’（SEQ ID NO：13）, carry out PCR identification experiments（PCR reaction systems such as table 6-1, reaction
Condition such as table 6-2）.The clone positive to PCR identifications is sequenced and is compared analysis, and it is to build successfully to compare correctly clone
Be directed to SEQ ID NO：The carrier of the corresponding RNAi of expression of 1 target sequence, is named as pGCSIL-GFP-NONO-siRNA.
Build pGCSIL-GFP-Scr-siRNA negative control plasmids, negative control siRNA target sequences for 5 '-
TTCTCCGAACGTGTCACGT-3’（SEQ ID NO：14）.When building pGCSIL-GFP-Scr-siRNA negative control plasmids,
For the double-stranded DNA Oligo sequences of Scr siRNA target spots synthesis both ends I containing Age and EcoR I restriction enzyme site cohesive ends（Table 3）,
The same pGCSIL-GFP-NONO-siRNA of remaining construction method, identification method and condition.
The double-stranded DNA Oligo of 3 both ends I containing Age and EcoR I restriction enzyme site cohesive ends of table
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 10 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 11 |
Double digestion is linearized by T4 DNA ligases（Digestion system is as shown in table 4,37 DEG C, reacts 1h）Carrier
4 pGCSIL-GFP plasmid enzyme restriction reaction systems of table
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmids (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
5 carrier DNA of table and double-strand double-stranded DNA Oligo coupled reaction systems
| Reagent | Positive control (μ l) | From even control (μ l) | Connection group (μ l) |
| The carrier DNA (100ng/ μ l) of linearisation | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer solutions | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligases | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction systems
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Sense primer | 0.4 |
| Anti-sense primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program settings
3. pack NONO-siRNA slow virus
With the DNA of the plasmid extraction kit extraction RNAi plasmids pGCSIL-GFP-NONO-siRNA of Qiagen companies, match somebody with somebody
100ng/ μ l storing liquids are made.Before transfection for 24 hours, with the human embryonic kidney cells 293T cells of Trypsin Induced exponential phase, with
DMEM complete mediums adjustment cell density containing 10% hyclone is 1.5 × 105Cell/ml, is inoculated in 6 orifice plates, 37 DEG C,
5%CO2Culture in incubator.It can be used to transfect when cell density reaches 70%-80%.2h before transfection suctions out original culture medium,
Add in the fresh complete mediums of 1.5ml.According to the MISSION Lentiviral Packaging of Sigma-aldrich companies
The explanation of Mix kits adds in Packing Mix into a sterile centrifugation tube（PVM）20 μ l, PEI 12 μ l, serum-free DMEM
400 μ l of culture medium take the Plasmid DNA of the 20 above-mentioned extractings of μ l, add to above-mentioned PVM/PEI/DMEM mixed liquors.Above-mentioned transfection is mixed
Object is incubated at room temperature 15min, is transferred in the culture medium of human embryonic kidney cells 293T cells, 37 DEG C, 5%CO2Culture in incubator
16h.The culture medium containing transfection mixture is discarded, PBS solution washing adds in complete medium 2ml, continues to cultivate 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration units（Millipore）Purifying and the slow disease of concentration
Poison, step are as follows：（1）4 DEG C, 4000g centrifugation 10min remove cell fragment；（2）0.45 μm of filter filtering supernatant is in 40ml
In ultracentrifugation pipe；（3）4000g is centrifuged, 10-15min, until the viral concentration volume needed；（4）After centrifugation, it will filter
Cup and following filtered solution collection cups separate, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than
1000g；（5）Centrifuge Cup is removed from sample collection cup, in sample collection cup is viral concentration liquid.By viral concentration liquid
Packing is after -80 degrees Celsius of preservations.The sequence such as SEQID NO of the first chains of siRNA contained in viral concentration liquid:Shown in 19.It is right
According to slow virus packaging process with NONO-siRNA slow virus, pGCSIL- is only replaced with pGCSIL-GFP-Scr-siRNA carriers
GFP-NONO-siRNA carriers.
2 real-time fluorescence quantitative RT-PCR method of embodiment detects the silence efficiency of NONO genes
Human gastric cancer SGC7901 cells, lung cancer H1299 cells and glioma U87 cells in exponential phase carry out pancreas
Cell suspension is made in enzymic digestion（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, cultivates to cell fusion degree and reach about
30%.According to infecting plural number（MOI, SGC7901:20, H1299:10, U87:10）Value adds in the preparation of embodiment 1 of appropriate amount
Virus, culture medium is replaced in culture afterwards for 24 hours, after time of infection reaches 5 days, collects cell.According to Invitrogen companies
Trizol operational manuals, extracted total RNA.According to the M-MLV operational manuals of Promega companies, RNA reverse transcriptions are obtained
cDNA（Reverse transcription reaction system is shown in Table 6,42 DEG C of reaction 1h, and then water-bath 10min loses reverse transcriptase in 70 DEG C of water-baths
It is living）.
Using TP800 type Real time PCR instruments（TAKARA）Carry out Real_time quantitative detection.The primer of NONO genes is such as
Under：Sense primer 5 '-CCACCACCGCCAATACCT-3 '（SEQ ID NO：15）With anti-sense primer 5 '-
CTTCGCCTGCCTTTCCATA-3’（SEQ ID NO：16）.Using house-keeping gene GAPDH as internal reference, primer sequence is as follows：Upstream
Primer 5 '-TGACTTCAACAGCGACACCCA-3 '（SEQ ID NO：17）With anti-sense primer 5 '-
CACCCTGTTGCTGTAGCCAAA-3’（SEQ ID NO：18）, by the proportional arrangement reaction system in table 8.
7 reverse transcription reaction system of table
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H2O | 3.5 |
| Total | 11.0 |
Table 8Real-time PCR reaction systems
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Sense primer（2.5μM）： | 0.5 |
| Anti-sense primer（2.5μM）： | 0.5 |
| cDNA | 1.0 |
| ddH2O | 8.0 |
| Total | 20.0 |
Setting program is two-step method Real-time PCR：95 DEG C of pre-degeneration, 15s；Each step is denatured 95 DEG C afterwards, 5s；It moves back
60 DEG C of fire extension, 30s；45 Xun Huans are carried out altogether.Every time light absorption value is read in the extension stage.After PCR, 95 DEG C of denaturation
1min is subsequently cooled to 55 DEG C, DNA double chain is made fully to combine.To 95 DEG C since 55 DEG C, each step increases by 0.5 DEG C, keeps
4s, while light absorption value is read, make melting curve.Using 2-ΔΔCtAnalytic approach calculates the gene expression abundance for having infected NONO mRNA.
Infect comparison virus（Lv-Scr-siRNA）Cell as control.Experimental result（Fig. 2）Show human gastric cancer SGC7901 cells,
The expression of NONO mRNA has lowered 89.8%, 97.9% and 84.8% in lung cancer H1299 cells and glioma U87 cells.
Embodiment 3 detects the multiplication capacity for the tumour cell for infecting NONO-siRNA slow virus
Human gastric cancer SGC7901 cells, lung cancer H1299 cells and glioma U87 cells in exponential phase carry out pancreas
Cell suspension is made in enzymic digestion（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, cultivates to cell fusion degree and reach about
30%.According to infecting plural number（MOI, SGC7901:20, H1299:10, U87:10）, the virus of appropriate amount is added in, after culture for 24 hours more
Culture medium is changed, after time of infection reaches 5 days, collects each experimental group cell in exponential phase.Complete medium is resuspended
Into cell suspension（2×104/ml）, it is about 2000/hole with cell density, is inoculated with 96 orifice plates.Every group of 5 multiple holes, per 100 μ of hole
l.After completing plate, 37 DEG C, 5%CO are put2Incubator culture.Since after bed board second day, Cellomics instruments were used daily
（Thermo Fisher）Detect read plate once, it is continuous to detect read plate 5 days.By adjusting the input of Cellomics arrayscan
Parameter calculates the quantity of the cell with green fluorescence in scanning orifice plate every time, carries out statistics drawing to data, paint exactly
Go out cell Proliferation curve（As a result as shown in Figure 3-Figure 5）.The result shows that slow virus infects each tumour of group in cell injuring model 5
After it, growth rate significantly slows, and far below the growth rate of control group tumour cell, vigor cell number has dropped respectively
62.9%th, 76.9% and 88.6%, show that NONO gene silencings cause tumor cell proliferation ability to be suppressed.
The above, be only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that for those skilled in the art, on the premise of the method for the present invention is not departed from, can also make
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed are the equivalent embodiment of the present invention；Meanwhile all substantial technologicals pair according to the invention
The variation, modification and evolution for any equivalent variations that above-described embodiment is made still fall within the scope of technical scheme
It is interior.
Claims (8)
1. a kind of purposes of people NONO gene inhibitors in anti-tumor medicine is prepared, the tumour is glioma, described
The target sequence of NONO genes is as shown in SEQ ID NO.1.
2. purposes according to claim 1, which is characterized in that the inhibitor be separated nucleic acid molecules, the NONO
As shown in SEQ ID NO.1, the nucleic acid molecules include the target sequence of gene：
A) double-stranded RNA, the double-stranded RNA be siRNA, the sequence such as SEQ ID NO of first chain of siRNA：19 institutes
Show or
B) sequence of shRNA, the shRNA such as SEQ ID NO：Shown in 20.
3. a kind of purposes of NONO genes interfering nucleic acid construct in anti-tumor medicine is prepared contains coding claim 2
Described in shRNA in separated nucleic acid molecules genetic fragment, the shRNA can be expressed, the tumour is glioma.
4. purposes as claimed in claim 3, which is characterized in that the NONO genes interfering nucleic acid construct is interference slow virus
Carrier.
5. purposes as claimed in claim 4, which is characterized in that the interference slow virus carrier will be by that will encode the shRNA's
Gene fragment clone obtains after entering slow virus carrier, and the slow virus carrier is selected from：pLKO.1-puro、pLKO.1-CMV-
tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、
pLKO.1-puro-CMV-TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-
puro-CMV-TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-
puro-IPTG-1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/
BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/
Any in V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
6. a kind of purposes of NONO genes interference slow virus in anti-tumor medicine is prepared, by any rights of claim 4-5
Described in it is required that disturb slow virus carrier slow virus packaging plasmid, cell line auxiliary under, packed by virus, it is described
Tumour is glioma.
7. a kind of pharmaceutical composition for being used to prevent or treat tumour answering in the anti-tumor medicine for preparing treatment glioma
Contain the separated nucleic acid molecules described in claim 2 with, active principle, institute in claim 3-5 any claims
State the NONO genes interference slow virus described in NONO gene interfering nucleic acid constructs and/or claim 6.
8. a kind of purposes for reducing the kit of NONO gene expressions in tumour cell in anti-tumor medicine is prepared,
It is characterized in that, the kit includes：It is present in container, the separated nucleic acid molecules described in claim 2, right will
Ask NONO genes interfering nucleic acid construct described in 3-5 any claims and/or the NONO genes described in claim 6
Slow virus is disturbed, the tumour is glioma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210349845.2A CN103667430B (en) | 2012-09-18 | 2012-09-18 | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210349845.2A CN103667430B (en) | 2012-09-18 | 2012-09-18 | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667430A CN103667430A (en) | 2014-03-26 |
| CN103667430B true CN103667430B (en) | 2018-06-01 |
Family
ID=50306198
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210349845.2A Active CN103667430B (en) | 2012-09-18 | 2012-09-18 | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667430B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107523569B (en) * | 2016-06-21 | 2024-02-06 | 上海吉倍生物技术有限公司 | Application of PDCD1 gene and related medicaments thereof |
| CN115125250B (en) * | 2022-06-07 | 2023-11-17 | 山东省农业科学院畜牧兽医研究所 | Pig NONO protein knockout gene, related plasmid, cell line, preparation method and application |
-
2012
- 2012-09-18 CN CN201210349845.2A patent/CN103667430B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| 55 kDa Nuclear Matrix Protein (nmt55) mRNA is Expressed in Human Prostate Cancer Tissue and is Associated with the Androgen Receptor;Hitoshi ISHIGURO等;《Int. J. Cancer》;20031231;第105卷;第26-32页 * |
| Expression Profiling of Primary Tumors and Matched Lymphatic and Lung Metastases in a Xenogeneic Breast Cancer Model;Valerie Montel等;《American Journal of Pathology》;20050531;第166卷(第5期);第1565-1579页 * |
| iTRAQ Quantitative Analysis ofMultidrug Resistance Mechanisms in Human Gastric Cancer Cells;Huai-Dong Hu等;《Huai-Dong Hu等》;20101231;第1-10页 * |
| p54nrb is a new regulator of progression of malignant melanoma;Susanne Schiffner等;《Carcinogenesis》;20111231;第32卷(第8期);第1176-1182页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667430A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN105586391B (en) | Application of human GTPBP4 gene and related medicine thereof | |
| CN102433383A (en) | Applications and correlated medicament of human STIM1 gene | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103656674B (en) | Application of human eIF5B gene and related medicine thereof | |
| CN103468785B (en) | Application of human SEMA4C gene and related medicine thereof | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN104894224B (en) | Application of human CKIP1 gene and related medicine thereof | |
| CN104225619B (en) | The purposes and its related drugs of people's ILK gene therapy tumours | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN110643705A (en) | Application of human DGKZ gene and related medicine thereof | |
| CN105803056B (en) | Application of human IARS2 gene and related medicine thereof | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN105803053B (en) | Application of human RBM17 gene and related medicine thereof | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN106267208B (en) | Application of RPS15A gene and related medicine thereof | |
| CN104774928B (en) | The application of people's RRS1 genes and inhibitor | |
| CN110684845A (en) | Application of human PTP4A3 gene and related drugs thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200602 Address after: 201203 room 101-7, No. 332, Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI JIBEI BIOTECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
| TR01 | Transfer of patent right |