CN103667422B - The purposes and its related drugs of people's CUL4B genes - Google Patents
The purposes and its related drugs of people's CUL4B genes Download PDFInfo
- Publication number
- CN103667422B CN103667422B CN201210313850.8A CN201210313850A CN103667422B CN 103667422 B CN103667422 B CN 103667422B CN 201210313850 A CN201210313850 A CN 201210313850A CN 103667422 B CN103667422 B CN 103667422B
- Authority
- CN
- China
- Prior art keywords
- cul4b
- genes
- plko
- sequence
- slow virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses the purposes and its related drugs of people's CUL4B genes.The invention discloses purposes of the people CUL4B genes in oncotherapy, diagnosing tumor and medicine preparation.The present invention also further constructs people's CUL4B genes small molecules interference RNA, people's CUL4B gene interfering nucleic acid construct, people's CUL4B genes interference slow virus and discloses their purposes.SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, slow virus are capable of the expression of specificity inhibition people's CUL4B genes, especially slow virus, target cell can efficiently be infected, expeditiously inhibit the expression of CUL4B genes in target cell, and then inhibit the growth of tumour cell, promote apoptosis of tumor cells, is of great significance in oncotherapy.
Description
Technical field
The present invention relates to biotechnologies, relate more specifically to the purposes and its related drugs of people's CUL4B genes.
Background technology
RNA is interfered（RNA interference,RNAi）The short double-stranded RNA (dsRNA) formed with nucleotide carries out
Posttranscriptional gene silencing.It can efficiently, specifically block the expression of internal specific gene, lead to its degradation, so as to cause biology
The silence of internal specific gene, makes cells show go out the missing of certain gene phenotype, is that one kind emerging in recent years is commonly ground
The laboratory technique studied carefully gene function, find disease treatment method.Studies have shown that the double-stranded RNA that length is 21-23nt can be
Transcription causes RNAi with post-transcriptional level specificity（Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi:
double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21to 23
nucleotide intervals.Cell 2000;101:25-33.）.Though tumor patient through chemotherapy, radiotherapy and complex treatment,
Five year survival rate is still very low, will be that the treatment of tumour is opened up as can intervening tumor invasion and the related gene that is in progress
New way.In recent years, RNAi has become the available strategy of the gene therapy of tumour.It can inhibit former cancer base using RNAi technology
Inhibit tumor progression because of the expression of tumor suppressor gene, Cell cycle-related genes, the anti-apoptotic related gene etc. of, mutation
（Uprichard,Susan L.The therapeutic potential of RNA interference.FEBS Letters
2005;579:5996-6007.）.
CUL4B（cullin 4b）Belonging to cullin families, the division growth of the family member and cell has substantial connection,
It, which becomes exclusive or unconventionality expression, will cause the unsuitable proliferation of cell, and cullin gene families member is in kinds of tumors tissue
There is abnormal expression（Salon C,Brambilla E,Brambilla C,et al.Altered pattern of cul-
1protein expression and neddylation in human lung tumors:relationships with
CAND 1 and cyclin E protein levels.J Pathol.2007;213(3):303-310.Laura PS,
Lorenzo M,Francisco J,et al.Abstract 91:The CUL4A ubiquitin ligase,a putative
target gene at the 13q34 amplicon and its role in breast cancer pathogenesis&
progression.Cancer Research.2012；72(8):91.）.
CUL4B and CUL4A protein sequence homologies are up to 83% in people cullin families（Sarikas A,Hartmann
T,Pan ZQ.The cullin protein family.Genome Biol.2011;12:220.）, past research is often by two
Person is as one（CUL4）It studies, the functional study of CUL4 CRLs is mostly obtained by CUL4A, CUL4A is thin in breast cancer and liver
Up-regulated expression in born of the same parents' cancer（Laura PS,Lorenzo M,Francisco J,et al.Abstract 91:The CUL4A
ubiquitin ligase,a putative target gene at the 13q34 amplicon and its role in
breast cancer pathogenesis&progression.Cancer Research.2012；72(8):91.）, show
CUL4A may play a significant role in terms of regulation of cell proliferation.But both recent research prompts may in partial function and
There are larger differences on specific mechanism of action.2007 the study found that CUL4B gene mutations can cause a kind of X chain
Feeblemindedness syndrome, it may be the chain feeblemindedness syndrome Disease-causing genes of a common X to prompt the gene（Patrick
ST,F.Lucy R,Sarah O,Mutations in CUL4B,Which Encodes a Ubiquitin E3 Ligase
Subunit,Cause an X-linked Mental Retardation Syndrome Associated with
Aggressive Outbursts, Seizures, Relative Macrocephaly, Central Obesity,
Hypogonadism,Pes Cavus,and Tremor.Am.J.Hum.Genet.2007;80:345–352.）, so far CUL4B
Importance be just gradually realized, therefore the function of CUL4B causes the great interest of people.Have that researches show that the low tables of CUL4B
Up to that may lead to cell proliferation disorder, the S phases occur blocks and causes cyclin cyclin E Increased Plasma Half-lifes.Research
It has also been found that CUL4B is mainly expressed in nucleus, N-terminal37KKRK40For the nuclear localization signal of CUL4B albumen, and
It is closely related that the performance of CUL4B functions with it correctly enters core（Zou YX, Mi J, Cui JP, et al.Characterization
of Nuclear Localization Signal in the N Terminus of CUL4B and Its Essential
Role in Cyclin E Degradation and Cell Cycle Progression.J Biol Chem.2009
November 27;284(48):33320–33332.）.The above result of study shows that CUL4B is played in regulating cell proliferation
Important role.But up to the present, the effect for CUL4B in tumor cell proliferation regulation and control and mechanism are known little about it.
In order to further investigate regulatory functions of the CUL4B in tumor cell proliferation, the present invention chooses osteosarcoma and colon cancer
Cell model, the effect using RNAi as means research CUL4B in osteosarcoma and colon cancer occurrence and development.
Invention content
It is an object of the invention to open and people CUL4B（cullin 4B）The therapy and drug of gene-correlation, with
RNA is interfered（RNAi）For effect of the means research CUL4B genes in the survival and apoptotic process of tumour cell.
First aspect present invention has studied work of the CUL4B genes in tumour occurrence and development using RNA interference as means
With disclosing a kind of inhibition or reduction growth of tumour cell, proliferation, the method for differentiation and/or survival, this method includes：To swollen
Oncocyte is using a kind of transcription or translation be capable of specificity and inhibit CUL4B genes, or is capable of specificity and inhibits CUL4B albumen
Expression or active molecule, inhibit growth, proliferation, differentiation and/or the survival of tumour cell with this.
The tumour cell is selected from the expression or the relevant tumour cell of activity of growth and CUL4B albumen.Preferably, institute
State tumour cell be selected from osteosarcoma, colon cancer it is any.
In the inhibition or reduction growth of tumour cell, proliferation, differentiation and/or the method for survival, the application of the molecule
Amount is enough transcriptions or translation for reducing CUL4B genes, or reduces the expression of CUL4B albumen or active dosage enough.Into
One step, the expression of the CUL4B genes is at least lowered 50%, 80%, 90%, 95% or 99%.
The molecule may be selected from but not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine,
Polypeptide, albumen or interference slow virus.
The nucleic acid includes but not limited to：Antisense oligonucleotides, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence or CUL4B genes of CUL4B genes
Information sequence.
Further, the double-stranded RNA is siRNA（siRNA）.The siRNA includes the first chain and second
RNA dimers, and the sequence of first chain and CUL4B bases is collectively formed in chain, first chain and the second chain complementation
15-27 continuous nucleotide sequences are essentially identical because in.The small molecules interference RNA can be specifically bound coded by target sequence
MRNA segments, and the expression of specific silence people's CUL4B genes.
Further, the first chain-ordering of the siRNA and the target sequence in CUL4B genes are essentially identical.It is more excellent
, the target sequence in the CUL4B genes contains SEQ ID NO:Any sequence in 1-18.
Target sequence in the CUL4B genes is the small molecules interference RNA specificity silence CUL4B gene expressions
When, the segment in the CUL4B genes corresponding to mRNA segments combined with the small molecules interference RNA complementation.
Preferably, the CUL4B gene sources are in people.
First aspect present invention also discloses a kind of people CUL4B genes of separation and is preparing or screening tumor therapeutic agent,
Or purposes in the preparation of cancer diagnostic drugs.
Further, the tumour is selected from osteosarcoma or colon cancer.
It is described that be used to prepare or screen tumor therapeutic agent by the CUL4B genes of separation include both sides content：First,
It is applied to prepare tumor therapeutic agent or preparation for the action target of tumour cell using CUL4B genes as drug or preparation；
Second, using CUL4B genes as drug or preparation for the action target of tumour cell be applied to screening tumor therapeutic agent or
Preparation.
It is described to be applied to prepare oncotherapy for the action target of tumour cell using CUL4B genes as drug or preparation
Drug or preparation specifically refer to：Using CUL4B genes as the target of RNA interference effects, to develop the drug for tumour cell
Or preparation, so as to reduce the expression of CUL4B genes in tumour cell.
It is described to be applied to screening oncotherapy for the action target of tumour cell using CUL4B genes as drug or preparation
Drug or preparation specifically refer to：Using CUL4B genes as effective object, drug or preparation are screened, can be pressed down with finding
System promotes the drug of people's CUL4B gene expressions as oncotherapy drug candidate.Small point of CUL4B genes as described in the present invention
Sub- RNA interfering（siRNA）It is to be obtained by effective object screening of people CUL4B genes, can be used as that there is inhibition tumour cell
The drug of proliferation function.In addition to this, such as antibody drug, small-molecule drug etc. also can using CUL4B genes and its albumen as
Effective object.
It is described that CUL4B genes are used to prepare cancer diagnosis drug, refer to swollen using CUL4B gene expression products as one
Tumor diagnosis index is applied to the preparation of cancer diagnosis drug.
The tumor therapeutic agent is to be capable of the transcription or translation of specificity inhibition CUL4B genes, or specific can press down
The expression of CUL4B albumen processed or active molecule reach inhibition to reduce the expression of CUL4B genes in tumour cell
Proliferation, growth, differentiation and/or the purpose of survival of tumour cell.
The tumor therapeutic agent or cancer diagnosis drug packet that prepared by the CUL4B genes by separation or screening obtains
It includes but is not limited to：Nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine, polypeptide, albumen or the slow disease of interference
Poison.
The nucleic acid includes but not limited to：Antisense oligonucleotides, double-stranded RNA（dsRNA）, ribozyme, endoribonuclease
SiRNA prepared by III（esiRNA）Or short hairpin RNA（shRNA）.
The amount of application of the tumor therapeutic agent is to reduce the transcription or translation of people's CUL4B genes enough, or drop enough
The expression of low people CUL4B albumen or active dosage.Expression to make one CUL4B genes is at least lowered 50%, 80%, 90%,
95% or 99%.
The method that tumour is treated using forgoing neoplasms medicine, mainly the expression water by reducing people's CUL4B genes
The proliferation of tumour cell processed is stabilized to achieve the purpose that treatment.Specifically, when treatment, people's CUL4B gene tables will be effectively reduced
Up to horizontal administering substances in patient.
Second aspect of the present invention discloses a kind of nucleic acid molecules reducing the separation of CUL4B gene expressions in tumour cell,
The nucleic acid molecules include：
A) double-stranded RNA, in the double-stranded RNA containing can be under stringent condition with CUL4B gene recombinations nucleotides sequence
Row；Or
B) contain nucleotide sequence that can be under stringent condition with CUL4B gene recombinations in shRNA, the shRNA.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary common
Form RNA dimers, and the sequence of first chain and 15-27 in the CUL4B genes basic phases of continuous nucleotide sequence
Together.Preferably, the sequence of first chain and 19-23 in CUL4B genes continuous nucleotide sequences are essentially identical；More preferably
, the sequence of first chain and 19,20 or 21 in CUL4B genes continuous nucleotide sequences are essentially identical.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and the second chain complementation are total
With formation RNA dimers, and the sequence of first chain and the target sequence in CUL4B genes are essentially identical.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and 15-27 in CUL4B genes continuous nucleotide sequences are essentially identical.It can be at after the shRNA is processed
For siRNA（siRNA）And then play the role of endogenous CUL4B gene expressions in specific silence tumour cell.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and the target sequence in CUL4B genes are essentially identical.
First chain of the double-stranded RNA or the positive-sense strand segment of the shRNA and the basic phase of target sequence in CUL4B genes
Together, when the target sequence of the CUL4B genes is that siRNA is used for specific silence CUL4B gene expressions, known by the siRNA
The not simultaneously segment in the CUL4B genes corresponding to the mRNA segments of silence.
Preferably, the target sequence in the CUL4B genes contains SEQ IDNO:Any sequence of 1-18.
Further, the CUL4B gene sources are in people.
The length of the first chain of the double-stranded RNA and the second chain is 15-27 nucleotide；Preferably, length is 19-23
A nucleotide；Best, length is 19,20 or 21 nucleotide.
Further, the double-stranded RNA is siRNA（siRNA）.Further, the first chain of the siRNA
Sequence such as SEQ ID NO：Shown in 30, specially 5 '-AGCAGUGGAAGCUAUUCAGAA-3 '.
SEQ ID NO：SiRNA shown in 30 is with SEQ ID NO:Sequence shown in 4 is that RNA interferes target sequence design
, a chain of siRNA for people's CUL4B genes, another chain i.e. sequence of the second chain is complementary with the first chain-ordering,
The siRNA can play the role of endogenous CUL4B gene expressions in specific silence tumour cell.
Further, the sequence of the loop-stem structure of the shRNA can be selected from following any：UUCAAGAGA、AUG、CCC、
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of the shRNA such as SEQ ID NO:Shown in 31, specially：5’-
AGCAGUGGAAGCUAUUCAGAAUUCAAGAGAUUCUGAAUAGCUUCCACUGCU-3’。
ShRNA can become siRNA after digestion is processed, and then play endogenous people in specific silence tumour cell
The effect of CUL4B gene expressions.
The interference slow virus carrier for encoding the genetic fragment of shRNA of the present invention contains SEQ ID NO:Appointing in 1-18
One sequence and its complementary series.
Third aspect present invention discloses a kind of CUL4B genes interfering nucleic acid construct, contains of the present invention point of coding
From nucleic acid molecules in shRNA genetic fragment, the shRNA can be expressed.
People's CUL4B gene interfering nucleic acid constructs can will encode the gene of aforementioned people CUL4B genes shRNA
Segment is cloned into known carrier acquisition.Further, the CUL4B genes interfering nucleic acid construct is that the interference of CUL4B genes is slow
Viral vectors.
The CUL4B genes interference slow virus carrier of the present invention is the DNA fragmentation gram that will encode aforementioned CUL4B genes shRNA
It is grand enter known carrier obtain, the known carrier is mostly slow virus carrier, and CUL4B genes interference slow virus carrier is by disease
After poison packaging becomes infectious virion, infected tumor's cell, and then shRNA of the present invention is transcribed out, pass through enzyme
Processing is cut, finally obtains the siRNA, the expression for specific silence CUL4B genes.
Further, the CUL4B genes interference slow virus carrier also contains promoter sequence and/or codes for tumor cell
In the nucleotide sequence of marker that can be detected；Preferably, the marker the being detected such as green fluorescent protein
（GFP）.
Further, the slow virus carrier can be selected from：pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA 1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
The embodiment of the present invention is specifically listed interferes slow virus to carry by people's CUL4B genes of vector construction of pGCSIL-GFP
Body is named as pGCSIL-GFP-CUL4B-siRNA.
The nucleic acid molecules that the present invention detaches can be used for prepare prevent or treatment tumour drug, the tumour be osteosarcoma or
Colon cancer.
The CUL4B gene siRNAs of the present invention can be used for inhibiting the proliferation of tumour cell, and it is swollen further to may be used as treatment
The drug or preparation of tumor.CUL4B genes interference slow virus carrier then can be used for preparing the CUL4B gene siRNAs.When as controlling
It is that the nucleic acid molecules of safe and effective amount are applied to mammal when treating the drug or preparation of tumour.Specific dosage is also answered
Administration route, the factors such as patient health situation are considered, within the scope of these are all skilled practitioners technical ability.
Fourth aspect present invention, discloses a kind of CUL4B genes interference slow virus, and slow disease is interfered by aforementioned CUL4B genes
Poisonous carrier slow virus packaging plasmid, cell line auxiliary under, packed by virus.The slow virus can infected tumor's cell
And the small molecules interference RNA for being directed to CUL4B genes is generated, to inhibit the proliferation of osteosarcoma or colon cancer tumours cell.It should
CUL4B genes interference slow virus can be used for preparing the drug for preventing or treating tumour.
Fifth aspect present invention, discloses a kind of pharmaceutical composition for preventing or treating tumour, and active principle contains
There are the nucleic acid molecules of separation above-mentioned, CUL4B gene interfering nucleic acid constructs and/or CUL4B genes to interfere slow virus.
Further, described pharmaceutical composition contains double-stranded RNA described in 1~99wt%, shRNA, CUL4B gene interference core
Acid con-struct or CUL4B genes interference slow virus and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositions, usually active constituent is mixed with excipient, or with figuration dilution agent or Bao Ke
With in carrier existing for capsule or sachet.When excipient plays diluent, it can be solid, semisolid or liquid
Medium of the material as excipient, carrier or active constituent.Therefore, composition can be tablet, pill, pulvis, solution, sugar
Starch agent, sterilizing injecting solution etc..The example of suitable excipient includes:Lactose, glucose, sucrose, sorbierite, mannitol, shallow lake
Powder, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, etc..Preparation may also include:Wetting agent, emulsifier, preservative
(such as methyl hydroxybenzoate and propyl ester), sweetener.
The invention also discloses described pharmaceutical compositions to prepare treatment osteosarcoma, any cancer therapeutics of colon cancer
Application in object.
The application of the pharmaceutical composition is that the treatment of tumour provides a method, specially a kind of prevention or treatment object
The method of in-vivo tumour includes that the pharmaceutical composition of effective dose is applied in object.
When described pharmaceutical composition is for prevention or treatment object in-vivo tumour, need the drug of effective dose
Composition is applied in object.Using this method, growth, proliferation, recurrence and/or the transfer of the tumour are suppressed.Further
, the growth of the tumour, proliferation, at least the 10% of recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95% or 99% part is suppressed.
Sixth aspect present invention discloses a kind of kit for reducing the CUL4B gene expressions in tumour cell, institute
Stating kit includes：It is present in the nucleic acid molecules of the separation in container, CUL4B gene interfering nucleic acid constructs and/or institute
The CUL4B genes interference slow virus stated.
In conclusion the present invention devises 18 RNAi target sequences for people's CUL4B genes, structure is corresponding
CUL4BRNAi carriers, wherein coded sequence SEQ ID NO：4 RNAi carrier pGCSIL-GFP-CUL4B-siRNA can be notable
Lower expression of the CUL4B genes in mRNA level in-site and protein level.Use slow virus（Lentivirus is abbreviated as Lv）As base
Because operation instrument carry RNAi carrier pGCSIL-GFP-CUL4B-siRNA can target will be for the RNAi sequences of CUL4B genes
Row efficiently import human osteosarcoma SaoS2 cells and colon cancer RKO cells, reduce the expression of CUL4B genes, significantly inhibit
State the proliferative capacity of tumour cell.Therefore the CUL4B gene silencings of lentivirus mediated are malignant tumour potentially clinical No operations
Therapeutic modality.
SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, slow virus being capable of specificity inhibition
The expression of people's CUL4B genes, especially slow virus, can efficiently infect target cell, expeditiously inhibit CUL4B bases in target cell
The expression of cause, and then inhibit the growth of tumour cell, promote apoptosis of tumor cells, is of great significance in oncotherapy.
Description of the drawings
Fig. 1：PGCSIL-GFP Plasmid diagrams
Fig. 2：CUL4B-RNAi slow virus infected human osteosarcoma SaoS2 cells and colon cancer RKO cells after 5 days,
The expression of CUL4BmRNA significantly reduces
Fig. 3：CUL4B-RNAi slow virus infected human osteosarcoma SaoS2 cells after 5 days, caused cell inhibitory effect
Fig. 4：CUL4B-RNAi slow virus infected human colon carcinoma RKO cells after 5 days, caused cell inhibitory effect
Specific implementation mode
The present invention relates to the small molecules interference RNAs that one group is directed to people's CUL4B genes（siRNA）Sequence, rna interference vector
Slow virus is interfered with RNA.Target site of people's CUL4B mRNA coding region sequences as siRNA is chosen, according to continuous in target site
10-30（It is preferred that 15-27, more preferable 19-23）A base sequence designs siRNA target sequences.By gene cloning, table is built
Up to the nucleic acid construct of above-mentioned siRNA, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence
Can in specific silence human tumor cells endogenous CUL4B genes expression.
Inventor has found, using can effectively inhibit tumour cell after the expression of mediator's CUL4B genes under RNAi methods
Proliferation, this achievement in research show that CUL4B genes are proto-oncogenes, can be used as the target spot of oncotherapy.Inventor further closes
At with test a variety of siRNA for CUL4B genes, filtered out can effectively inhibit CUL4B expression so that inhibit people's bone
The siRNA of sarcoma SaoS2 cells and colon cancer RKO cell Proliferations and growth, completes the present invention on this basis.
The present invention provides a series of siRNAs of interference people's CUL4B genes（siRNA）Sequence, constructing can be special
The slow virus of property silence CUL4B gene expressions.The present invention the study found that for people's CUL4B genes design siRNA and
RNAi slow virus, stablizes and specifically lowers the expression of CUL4B genes, and effectively inhibits the proliferation of human tumor cells.This hair
It is bright to show that CUL4B genes promote growth of tumour cell, it is expected to the target spot as early diagnosis of tumor and treatment.Moreover, passing through
The expression of RNAi mode silence CUL4B genes can be used as the effective means for inhibiting tumor development.
The present invention mentality of designing be：
The present invention screens by the following method obtains a kind of people CUL4B gene RNAi slow virus：It is transferred from Genbank
People's CUL4B gene orders；Predict the sites siRNA；Synthesis is for the effective siRNA sequence of CUL4B genes, both ends position containing digestion
The double-stranded DNA Oligo of point cohesive end；It is connect with double-stranded DNA Oligo after slow virus carrier double digestion, structure expression CUL4B genes
The RNAi plasmids of siRNA sequence；The assistant carrier that RNAi plasmids and slow virus packaging are needed（Packing Mix, Sigma-
Aldrich companies）Cotransfection human embryonic kidney cells 293T generates recombinant slow virus particle, you can efficient silence CUL4B genes are made
Slow virus.
Based on the above method, the present invention provides the Effective target sites of 18 interference CUL4B genes（Specific such as SEQ ID NO：
Shown in 1-18）, construct the slow virus of special interference people's CUL4B genes.
Invention additionally discloses a kind of people CUL4B gene RNAi slow virus simultaneously（CUL4B-RNAi）And its preparation and application.
The study find that using the RNAi methods of lentivirus mediated, expression of the CUL4B genes in tumour cell is being reduced
Afterwards, the proliferation of tumour cell can effectively be inhibited.The study show that CUL4B genes may be a proto-oncogene, can promote to swell
Tumor cell proliferation, it can be the target of oncotherapy to have important biological function, CUL4B genes in tumour occurrence and development
Mark, the CUL4B gene specific silences of lentivirus mediated can be used as a kind of new tool of oncotherapy.
With reference to embodiment, the present invention is further explained.It should be understood that embodiment is merely to illustrate the present invention, and it is unrestricted
The scope of the present invention.The reagent of test method without specific conditions and undeclared formula is according to conventional strip in embodiment
Part, such as ［ beautiful ］ Sambrook.J works；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing：Science Press
The condition that condition or manufacturer described in 2002 are suggested carries out or configuration.
Embodiment 1 is directed to the preparation of people CUL4B gene RNAi slow virus
1. screening is for the effective siRNA target spots of people's CUL4B genes
CUL4B is transferred from Genbank（NM_003588）Gene information；Utilize the lucky triumphant limited public affairs of chemical gene technology in Shanghai
Effective siRNA target spot of the design software Genechem designs of department for CUL4B genes.In the coded sequence of CUL4B genes
（CDS）In region, the sequence of 21 bases is obtained every a base starting, table 1 lists wherein 18 and is directed to CUL4B genes
Effective siRNA target sequences.
Table 1 targets the siRNA target sequences of people's CUL4B genes
2. the preparation of slow virus carrier
For siRNA target spots（With SEQ ID NO：For 4）Synthesize both ends I containing Age and EcoR I restriction enzyme site cohesive ends
Double-stranded DNA Oligo sequences（Table 2）；PGCSIL-GFP carriers are acted on Age I and EcoR I restriction enzymes（Shang Haiji
Triumphant chemical gene Technology Co., Ltd. provides, Fig. 1）, its linearisation, agarose gel electrophoresis is made to identify endonuclease bamhi.
The double-stranded DNA Oligo of 2 both ends I containing Age and EcoR I restriction enzyme site cohesive ends of table
Double digestion is linearized by T4DNA ligases（Digestion system is as shown in table 4,37 DEG C, reacts 1h）Carrier DNA
It is connected with purified double-stranded DNA Oligo, in buffer system appropriate（Linked system is as shown in table 5）In connected in 16 DEG C
Night recycles connection product.Fresh competent escherichia coli cell prepared by connection product conversion calcium chloride（Conversion operation is joined
It examines：55-56 pages of the Molecular Cloning:A Laboratory guide second edition）.
Bacterium clone surface is grown in connection converted product to be stained with, is dissolved in 10 μ l LB culture mediums, mixing takes 1 μ l as mould
Plate；The upstream and downstream of RNAi sequences in slow virus carrier, designs general PCR primer（Upstream primer sequence：5’-
CCTATTTCCCATGATTCCTTCATA-3’（SEQ ID NO：23）；Downstream primer sequence：5’-
GTAATACGGTTATCCACGCG-3’（SEQ ID NO：24）, carry out PCR identification experiments（PCR reaction systems such as table 6-1, reaction
Condition such as table 6-2）.The clone positive to PCR identifications is sequenced and compares analysis, and it is to build successfully to compare correctly clone
Be directed to SEQ ID NO：The carrier of the corresponding RNAi of expression of 4 target sequences, is named as pGCSIL-GFP-CUL4B-siRNA.
PGCSIL-GFP-Scr-siRNA negative control plasmids are built, negative control siRNA target sequences are 5 '-
TTCTCCGAACGTGTCACGT-3’（SEQ ID NO：25）.When building pGCSIL-GFP-Scr-siRNA negative control plasmids,
The double-stranded DNA Oligo sequences of both ends I containing Age and EcoR I restriction enzyme site cohesive ends are synthesized for Scr siRNA target spots（Table 3）,
The same pGCSIL-GFP-CUL4B-siRNA of remaining construction method, identification method and condition.
The double-stranded DNA Oligo of 3 both ends I containing Age and EcoR I restriction enzyme site cohesive ends of table
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 21 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 22 |
Double digestion is linearized by T4 DNA ligases（Digestion system is as shown in table 4,37 DEG C, reacts 1h）Carrier
Table 4pGCSIL-GFP plasmid enzyme restriction reaction systems
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmids (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
5 carrier DNA of table and double-strand double-stranded DNA Oligo coupled reaction systems
| Reagent | Positive control (μ l) | From even control (μ l) | Connection group (μ l) |
| The carrier DNA (100ng/ μ l) of linearisation | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer solutions | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligases | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction systems
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Sense primer | 0.4 |
| Downstream primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program settings
3. packing CUL4B-siRNA slow virus
The DNA of RNAi plasmids pGCSIL-GFP-CUL4B-siRNA is extracted with the plasmid extraction kit of Qiagen companies,
It is configured to 100ng/ μ l storing liquids.Before transfection for 24 hours, with the human embryonic kidney cells 293T cells of trypsin digestion exponential phase,
With the DMEM complete mediums adjustment cell density containing 10% fetal calf serum for 1.5 × 105Cell/ml, is inoculated in 6 orifice plates, and 37
DEG C, 5%CO2Culture in incubator.It can be used to transfect when cell density reaches 70%-80%.2h before transfection, is sucked out original culture
The fresh complete mediums of 1.5ml are added in base.According to the MISSION Lentiviral of Sigma-aldrich companies
Packing Mix are added into a sterile centrifugation tube for the explanation of Packaging Mix kits（PVM）20 12 μ l of μ l, PEI,
400 μ l of plasma-free DMEM medium take the Plasmid DNA of the 20 above-mentioned extractings of μ l, add to above-mentioned PVM/PEI/DMEM mixed liquors.It will be upper
It states transfection mixture and is incubated at room temperature 15min, be transferred in the culture medium of human embryonic kidney cells 293T cells, 37 DEG C, 5%CO2Training
It supports and cultivates 16h in case.The culture medium containing transfection mixture is discarded, PBS solution washing is added complete medium 2ml, continues
Cultivate 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration units（Millipore）Purifying and the slow disease of concentration
Poison, steps are as follows：（1）4 DEG C, 4000g centrifuges 10min, removes cell fragment；（2）0.45 μm of filter filtering supernatant is in 40ml
In ultracentrifugation pipe；（3）4000g is centrifuged, 10-15min, until the viral concentration volume needed；（4）After centrifugation, it will filter
Cup and following filtered solution collection cups separate, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than
1000g；（5）Centrifuge Cup is removed from sample collection cup, in sample collection cup is viral concentration liquid.By viral concentration liquid
In -80 degrees Celsius of preservations after packing.The sequence of the first chains of siRNA contained in viral concentration liquid such as SEQID NO:Shown in 30.It is right
According to slow virus packaging process with CUL4B-siRNA slow virus, only with pGCSIL-GFP-Scr-siRNA carriers replace pGCSIL-
GFP-CUL4B-siRNA carriers.
2 real-time fluorescence quantitative RT-PCR method of embodiment detects the silence efficiency of CUL4B genes
Human osteosarcoma SaoS2 cells and colon cancer RKO cells in exponential phase carry out pancreatin digestion, and cell is made
Suspension（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infecting plural number
（MOI, SaoS2:10, RKO:10）Value, is added virus prepared by the embodiment 1 of appropriate amount, and culture is replaced culture medium, waited for afterwards for 24 hours
After time of infection reaches 5 days, cell is collected.According to the Trizol operational manuals of Invitrogen companies, extracted total RNA.Root
According to the M-MLV operational manuals of Promega companies, RNA reverse transcriptions are obtained into cDNA（Reverse transcription reaction system is shown in Table 7,42 DEG C instead
1h is answered, then water-bath 10min makes reverse transcriptase inactivate in 70 DEG C of water-baths）.
Using TP800 type Real time PCR instruments（TAKARA）Carry out Real_time quantitative detection.The primer of CUL4B genes is such as
Under：Sense primer 5 '-GGGAAAGGAATGGTGAA-3 '（SEQ ID NO：26）With downstream primer 5 '-
TGCATAGAGCCGGTTAG-3’（SEQ ID NO：27）.Using house-keeping gene GAPDH as internal reference, primer sequence is as follows：Draw upstream
Object 5 '-TGACTTCAACAGCGACACCCA-3 '（SEQ ID NO：28）With downstream primer 5 '-
CACCCTGTTGCTGTAGCCAAA-3’（SEQ IDNO：29）.By the proportional arrangement reaction system in table 8.
7 reverse transcription reaction system of table
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H2O | 3.5 |
| Total | 11.0 |
Table 8Real-time PCR reaction systems
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Sense primer（2.5μM）： | 0.5 |
| Downstream primer（2.5μM）： | 0.5 |
| cDNA | 1.0 |
| ddH2O | 8.0 |
| Total | 20.0 |
Setting program is two-step method Real-time PCR：95 DEG C of pre-degeneration, 15s；Each step is denaturalized 95 DEG C later, 5s；It moves back
Fire extends 60 DEG C, 30s；45 cycles are carried out altogether.Extending stage reading light absorption value every time.After PCR, 95 DEG C of denaturation
1min is subsequently cooled to 55 DEG C, DNA double chain is made fully to combine.To 95 DEG C since 55 DEG C, each step increases by 0.5 DEG C, keeps
4s, while light absorption value is read, make melting curve.The expression that CUL4B mRNA have been infected using the calculating of 2- Δ Δ Ct analytic approach is rich
Degree.Infect comparison virus（Lv-Scr-siRNA）Cell as a contrast.Experimental result（Fig. 2）Show that human osteosarcoma SaoS2 is thin
The expression of CUL4B mRNA has lowered 90.1% and 48.3% in born of the same parents and colon cancer RKO cells.
Embodiment 3 detects the proliferative capacity for the tumour cell for infecting CUL4B-siRNA slow virus
Human osteosarcoma SaoS2 cells and colon cancer RKO cells in exponential phase carry out pancreatin digestion, and cell is made
Suspension（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infecting plural number
（MOI, SaoS2:10, RKO:10）, the virus of appropriate amount is added, culture replaces culture medium, waits for that time of infection reaches 5 days afterwards for 24 hours
Afterwards, each experimental group cell in exponential phase is collected.Complete medium is resuspended into cell suspension（2×104/ml）, with thin
Born of the same parents' density is about 2000/hole, is inoculated with 96 orifice plates.Every group of 5 multiple holes, per 100 μ l of hole.
After completing plate, 37 DEG C, 5%CO are set2Incubator culture.Since after bed board second day, Cellomics instrument was used daily
Device（Thermo Fisher）It is primary to detect read plate, it is continuous to detect read plate 5 days.By adjusting the defeated of Cellomics arrayscan
Enter parameter, the quantity of the cell with green fluorescence in scanning orifice plate every time be accurately calculated, statistics drawing is carried out to data,
Draw cell Proliferation curve（As a result as Figure 3-Figure 4）.The result shows that slow virus infects each tumour of group in cell injuring model
After 5 days, growth rate significantly slows, and is far below the growth rate of control group tumour cell, and vigor cell number has dropped respectively
55.4% and 86%, show that CUL4B gene silencings cause tumor cell proliferation ability to be suppressed.
The above, only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that for those skilled in the art, under the premise of not departing from the method for the present invention, can also make
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are the equivalent embodiment of the present invention；Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution of any equivalent variations made by above-described embodiment, still fall within the range of technical scheme of the present invention
It is interior.
Claims (3)
1. a kind of purposes of the people CUL4B genes of separation in preparing or screening clinical treatment of osteosarcoma drug.
2. a kind of purposes of pharmaceutical composition in the tumor therapeutic agent for preparing treatment osteosarcoma, described pharmaceutical composition contain
Reduce nucleic acid molecules, CUL4B gene interfering nucleic acid constructs or the CUL4B of the separation of CUL4B gene expressions in osteosarcoma cell
Gene interferes any of slow virus, and the nucleic acid molecules include：
A) double-stranded RNA, in the double-stranded RNA containing can be under stringent condition with CUL4B gene recombinations nucleotide sequence, institute
It includes the first chain and the second chain to state double-stranded RNA, and RNA dimers are collectively formed in first chain and the second chain complementation, and
The sequence of first chain and the target sequence in CUL4B genes are essentially identical, and the target sequence of the CUL4B genes contains SEQ ID
NO:Sequence shown in 4, the double-stranded RNA are siRNA, the sequence such as SEQ ID NO of first chain of siRNA：30 institutes
Show；Or
B) contain nucleotide sequence that can be under stringent condition with CUL4B gene recombinations in shRNA, the shRNA, it is described
ShRNA includes positive-sense strand segment and antisense strand segment, and connects the loop-stem structure of the positive-sense strand segment and antisense strand segment,
The sequence of the positive-sense strand segment and the antisense strand segment is complementary, and the sequence of the positive-sense strand segment and CUL4B genes
In target sequence it is essentially identical, the target sequence of the CUL4B genes contains SEQ ID NO:Sequence shown in 4, the sequence of the shRNA
Row such as SEQ ID NO：Shown in 31；The CUL4B genes interfering nucleic acid construct contains in the nucleic acid molecules for encoding the separation
ShRNA genetic fragment, the shRNA can be expressed；The CUL4B genes interfering nucleic acid construct is that interference slow virus carries
Body；The CUL4B genes interfere slow virus, by the interference slow virus carrier in slow virus packaging plasmid, the auxiliary of cell line
Under, it is packed by virus.
3. purposes as claimed in claim 2, which is characterized in that the interference slow virus carrier will be by that will encode the shRNA's
Gene fragment clone obtains after entering slow virus carrier, and the slow virus carrier is selected from：pLKO.1-puro、pLKO.1-CMV-
tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、
pLKO.1-puro-CMV-TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-
puro-CMV-TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-
puro-IPTG-1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/
BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/
Any in V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313850.8A CN103667422B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's CUL4B genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313850.8A CN103667422B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's CUL4B genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667422A CN103667422A (en) | 2014-03-26 |
| CN103667422B true CN103667422B (en) | 2018-08-07 |
Family
ID=50306190
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210313850.8A Active CN103667422B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's CUL4B genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667422B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106075396B (en) * | 2016-07-12 | 2019-08-16 | 中国农业大学 | The application of Cul4 albumen |
| CN111228292B (en) * | 2020-03-11 | 2021-04-13 | 福州载基生物科技有限公司 | Application of human TPT1/TCTP gene in preparation of antitumor drugs |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120046186A1 (en) * | 2010-08-20 | 2012-02-23 | Pelham Robert J | Gene Expression Markers for Prediction of Response to Platinum-Based Chemotherapy Drugs |
-
2012
- 2012-08-29 CN CN201210313850.8A patent/CN103667422B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Characterization of Nuclear Localization Signal in the N Terminus of CUL4B and Its Essential Role in Cyclin E Degradation and Cell Cycle Progression;Yongxin Zou et al;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20091127;第284卷(第48期);33320-33332 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667422A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN103421886B (en) | The purposes and its related drugs of CIZ1 genes | |
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN104774928B (en) | The application of people's RRS1 genes and inhibitor | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN104368012B (en) | The purposes and its related drugs of people's RPL34 gene | |
| CN103301474B (en) | Usage and related drugs of human RNF40 gene | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |