CN103623426B - The purposes and its related drugs of people's PPP5C gene - Google Patents
The purposes and its related drugs of people's PPP5C gene Download PDFInfo
- Publication number
- CN103623426B CN103623426B CN201210313783.XA CN201210313783A CN103623426B CN 103623426 B CN103623426 B CN 103623426B CN 201210313783 A CN201210313783 A CN 201210313783A CN 103623426 B CN103623426 B CN 103623426B
- Authority
- CN
- China
- Prior art keywords
- ppp5c
- gene
- plko
- slow virus
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the purposes and its related drugs of people's PPP5C gene.The invention discloses purposes of the people PPP5C gene in oncotherapy, diagnosing tumor and medicine preparation.The present invention also further constructs people's PPP5C gene small molecules interference RNA, people's PPP5C gene interfering nucleic acid construct, people's PPP5C gene interference slow virus and discloses their purposes.SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, slow virus are capable of the expression of specificity inhibition people PPP5C gene, especially slow virus, target cell can efficiently be infected, expeditiously inhibit the expression of PPP5C gene in target cell, and then inhibit the growth of tumour cell, promote apoptosis of tumor cells, is of great significance in oncotherapy.
Description
Technical field
The present invention relates to field of biotechnology, relate more specifically to the purposes and its related drugs of people's PPP5C gene.
Background technique
RNA interference (RNA interference, RNAi) is carried out with the short double-stranded RNA (dsRNA) that nucleotide forms
Posttranscriptional gene silencing.It can efficiently, specifically block the expression of internal specific gene, lead to its degradation, so as to cause biology
The silencing of internal specific gene, makes cells show go out the missing of certain gene phenotype, is that one kind emerging in recent years is commonly ground
The laboratory technique studied carefully gene function, find disease treatment method.Studies have shown that the double-stranded RNA that length is 21-23nt can be
Transcription causes RNAi(Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi with post-transcriptional level specificity:
double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23
nucleotide intervals.Cell 2000;101:25-33.).Though tumor patient through chemotherapy, radiotherapy and complex treatment,
Five year survival rate is still very low, as can intervening tumor invasion and the related gene that is in progress, will open up for the treatment of tumour
New way.In recent years, RNAi has become the available strategy of the gene therapy of tumour.It can inhibit former cancer base using RNAi technology
Inhibit tumor progression because of the expression of tumor suppressor gene, Cell cycle-related genes, the anti-apoptotic related gene etc. of, mutation
(Uprichard, Susan L.The therapeutic potential of RNA interference.FEBS Letters
2005;579:5996-6007.).
PPP5C(protein phosphatase 5, catalytic subunit) it is also referred to as PP5, it is a kind of pair of ridge field
A member of acid/cantharidin/micro-capsule toxin sensitivity serine/threonine protein phosphatase family, the family protein pass through adjusting
The dephosphorylation of target protein adjusts growth, proliferation and differentiation (Swingle MR, Amable L, the Lawhorn BG, et of cell
al.Structure-activity relationship studies of fostriecin,cytostatin,and key
analogs,with PP1,PP2A,PP5,and(beta12-beta13)-chimeras(PP1/PP2A and PP5/PP2A),
provide further insight into the inhibitory actions of fostriecin family
inhibitors.J Pharmacol Exp Ther.2009;331 (1): 45-53.).Up to the present, PP5 in biology and
The effect played in disease is unclear.
In the past ten years, PP5 has always been considered as being a kind of potential cell growth regulator.In molecular level
On, PP5 is located in multiprotein complex, these albumen can be influenced by steroids (such as glucocorticoid) or cellular stress (such as
Anoxic, oxidative stress and DNA damage) caused by intracellular signal cascades react.When stress reaction does not occur in cell, PP5
Positioned at one by heat shock protein 70, heat shock protein 90, stress-induced phosphorylated protein 1 and cell division cycle homologous protein
(Vaughan CK, Mollapour M, Smith JR, et al.Hsp90-dependent in the compound of 37 compositions
activation of protein kinases is regulated by chaperone-targeted
dephosphorylation of Cdc37.Mol Cell.2008;31 (6): 886-95.).It is various it is various forms of stress
In reaction, PP5 and some protein kinases that stress be activated, including DNA-PKcs, ATM, ATR, ASK1, compound is collectively formed.
When reducing the expression of PP5 with siRNA or antisense oligonucleotides, some stress response protein phosphorylation degrees increase
(Huang S, Shu L, Easton J, et al.Inhibition of mammalian target of rapamycin
activates apoptosis signal-regulating kinase 1 signaling by suppressing
protein phosphatase 5 activity.J Biol Chem.2004;279 (35): 36490-6.).The above research is aobvious
Show, PP5 may adjust Cellular signalling network, play very during promoting cell to make appropriate reaction for Genomic damage
Important role.
PP5 albumen is highly conserved in not agnate, and in mouse, rabbit, homology is greater than 98% in ox and the mankind.People
PP5 albumen is expressed in most of tissues.There is the expression of studies have shown that PP5 albumen to activation hypoxia inducible factor and estrogen
Very sensitive (Urban G, Golden T, Aragon IV, Scammell JG, Dean NM, Honkanen
RE.Identification of an estrogeninducible phosphatase(PP5)that converts MCF-7
human breast carcinoma cells into an estrogenindependent phenotype when
expressed constitutively.J Biol Chem.2001;276:27638-27646.), and activate hypoxia inducible because
Son and estrogen it is all closely related with the proliferation of breast cancer (Bos R, Zhong H, Hanrahan CF, Mommers EC,
Semenza GL,Pinedo HM,Abeloff MD,Simons JW,van Diest PJ,van der Wall E.Levels
of hypoxia-inducible factor-1 alpha during breast carcinogenesis.J Natl
Cancer Inst 2001;93:309–314.Bos R,van der Groep P,Greijer AE,Shvarts A,Meijer
S,Pinedo HM,Semenza GL,van Diest PJ,van der Wall E.Levels of hypoxia-
inducible factor-1alpha independently predict prognosis in patients with
lymph node negative breast carcinoma.Cancer 2003;97:1573-1581.).Compared to non-malignant group
For knitting, in malignant galactophore cancerous tissue the expression of PP5 albumen and breast cancer grade malignancy present and be positively correlated (Goden T,
Aragon I,Rutland B,et al.Elevated levels of Ser/Thr protein phosphatase 5
(PP5) in human breast cancer.Biochim Biophys Acta.2008:1782 (4): 259-270.).More than
Research prompt PP5 may take part in the occurrence and development of breast cancer.But PP5 is in other malignant tumours in addition to breast cancer
In research it is also seldom, it is therefore necessary to further investigate PP5 other tumours generation in regulatory function.
Summary of the invention
It is an object of the invention to open and people PPP5C (protein phosphatase 5, catalytic
Subunit) the treatment method and drug of gene-correlation is means research PPP5C gene in tumour cell with RNA interference (RNAi)
Survival and apoptotic process in effect.
First aspect present invention has studied work of the PPP5C gene in tumour occurrence and development using RNA interference as means
With a kind of inhibition or reduction growth of tumour cell, proliferation, the method for differentiation and/or survival being disclosed, this method comprises: to swollen
Oncocyte applies a kind of transcription or translation for capableing of specificity inhibition PPP5C gene, or is capable of specificity and inhibits PPP5C albumen
Expression or active molecule, inhibit growth, proliferation, differentiation and/or the survival of tumour cell with this.
The tumour cell is selected from its growth tumour cell relevant to the expression of PPP5C albumen or activity.Preferably, institute
State tumour cell be selected from lung cancer, colon cancer, glioma it is any.
In the inhibition or reduction growth of tumour cell, proliferation, differentiation and/or the method for survival, the application of the molecule
Amount is enough transcriptions or translation for reducing PPP5C gene, or enough expression for reducing PPP5C albumen or active dosage.Into
One step, the expression of the PPP5C gene is at least lowered 50%, 80%, 90%, 95% or 99%.
The molecule may be selected from but not limited to: nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine,
Polypeptide, albumen or interference slow virus.
The nucleic acid includes but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozyme, endoribonuclease
The siRNA (esiRNA) or short hairpin RNA (shRNA) of III preparation.
The double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence or PPP5C gene of PPP5C gene
Information sequence.
Further, the double-stranded RNA is siRNA (siRNA).The siRNA includes the first chain and second
RNA dimer, and the sequence of first chain and PPP5C base is collectively formed in chain, first chain and the second chain complementation
15-27 continuous nucleotide sequences are essentially identical because in.The small molecules interference RNA can be specifically bound coded by target sequence
MRNA segment, and the expression of specific silencing people's PPP5C gene.
Further, the first chain-ordering of the siRNA and the target sequence in PPP5C gene are essentially identical.It is more excellent
, the target sequence in the PPP5C gene contains any sequence in SEQ ID NO:1-11.
Target sequence in the PPP5C gene is the small molecules interference RNA specificity silencing PPP5C gene expression
When, the segment in PPP5C gene corresponding to the mRNA segment of combination complementary with the small molecules interference RNA.
Preferably, the PPP5C gene source is in people.
First aspect present invention also discloses a kind of isolated people PPP5C gene and is preparing or screening tumor therapeutic agent,
Or purposes in the preparation of cancer diagnostic drugs.
Further, the tumour be selected from lung cancer, colon cancer, glioma it is any.
It is described that be used to prepare or screen tumor therapeutic agent for isolated PPP5C gene include both sides content: first,
It is applied to preparation tumor therapeutic agent or preparation for the action target of tumour cell using PPP5C gene as drug or preparation；
Second, using PPP5C gene as drug or preparation for the action target of tumour cell be applied to screening tumor therapeutic agent or
Preparation.
It is described to be applied to preparation oncotherapy for the action target of tumour cell using PPP5C gene as drug or preparation
Drug or preparation specifically refer to: using PPP5C gene as the target of RNA interference effect, to develop the drug for tumour cell
Or preparation, so as to reduce the expression of PPP5C gene in tumour cell.
It is described to be applied to screening oncotherapy for the action target of tumour cell using PPP5C gene as drug or preparation
Drug or preparation specifically refer to: using PPP5C gene as effective object, screening to drug or preparation, can be pressed down with finding
System promotes the drug of people PPP5C gene expression as oncotherapy drug candidate.Small point of gene of PPP5C as described in the present invention
Sub- RNA interfering (siRNA) is to obtain by effective object screening of people PPP5C gene, can be used as having inhibition tumour cell
The drug of proliferation function.In addition to this, such as antibody drug, small-molecule drug etc. can also using PPP5C gene and its albumen as
Effective object.
It is described that PPP5C gene is used to prepare cancer diagnosis drug, refer to swollen using PPP5C gene expression product as one
Tumor diagnosis index is applied to the preparation of cancer diagnosis drug.
The tumor therapeutic agent is to be capable of the transcription or translation of specificity inhibition PPP5C gene, or specific can press down
The expression of PPP5C albumen processed or active molecule reach inhibition to reduce the expression of PPP5C gene in tumour cell
Proliferation, growth, differentiation and/or the purpose of survival of tumour cell.
The tumor therapeutic agent or cancer diagnosis drug packet prepared by isolated PPP5C gene or screening obtains
It includes but is not limited to: nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine, polypeptide, albumen or the slow disease of interference
Poison.
The nucleic acid includes but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozyme, endoribonuclease
The siRNA (esiRNA) or short hairpin RNA (shRNA) of III preparation.
The amount of application of the tumor therapeutic agent is the transcription or translation for reducing people PPP5C gene enough, or drop enough
The expression of low people PPP5C albumen or active dosage.At least be lowered 50% to make one the expression of PPP5C gene, 80%, 90%,
95% or 99%.
Using the method for forgoing neoplasms therapeutic agent treatment tumour, mainly the expression water by reducing people PPP5C gene
The proliferation of tumour cell processed is stabilized to achieve the purpose that treatment.Specifically, people's PPP5C gene table will be effectively reduced when treatment
Up to horizontal administering substances in patient.
Second aspect of the present invention discloses a kind of isolated nucleic acid molecules for reducing PPP5C gene expression in tumour cell,
The nucleic acid molecules include:
A) double-stranded RNA, containing being capable of nucleotides sequence under stringent condition with PPP5C gene recombination in the double-stranded RNA
Column；Or
B) containing being capable of nucleotide sequence under stringent condition with PPP5C gene recombination in shRNA, the shRNA.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary common
Form RNA dimer, and the sequence of first chain and 15-27 in the PPP5C gene basic phases of continuous nucleotide sequence
Together.Preferably, the sequence of first chain and 19-23 in PPP5C gene continuous nucleotide sequences are essentially identical；More preferably
, the sequence of first chain and 19,20 or 21 in PPP5C gene continuous nucleotide sequences are essentially identical.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and the second chain complementation are total
With formation RNA dimer, and the sequence of first chain and the target sequence in PPP5C gene are essentially identical.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and 15-27 in PPP5C gene continuous nucleotide sequences are essentially identical.It can be at after the shRNA is processed
For siRNA (siRNA) and then play the role of endogenous PPP5C gene expression in specific silencing tumour cell.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and the target sequence in PPP5C gene are essentially identical.
First chain of the double-stranded RNA or the positive-sense strand segment of the shRNA and the basic phase of target sequence in PPP5C gene
Together, when the target sequence of the PPP5C gene is that siRNA is used for specific silencing PPP5C gene expression, known by the siRNA
The not simultaneously segment in PPP5C gene corresponding to the mRNA segment of silencing.
Preferably, the target sequence in the PPP5C gene contains any sequence of SEQ ID NO:1-11.
Further, the PPP5C gene source is in people.
The length of first chain of double-stranded RNA and the second chain is 15-27 nucleotide；Preferably, length is 19-23
A nucleotide；Optimal, length is 19,20 or 21 nucleotide.
Further, the double-stranded RNA is siRNA (siRNA).Further, first chain of siRNA
Sequence as shown in SEQ ID NO:23, specially 5 '-GAGACAGAGAAGAUUACAGUA-3 '.
It is that RNA interferes target sequence design that siRNA shown in SEQ ID NO:23, which is with sequence shown in SEQ ID NO:2,
, a chain of siRNA for people's PPP5C gene, another chain i.e. sequence of the second chain is complementary with the first chain-ordering,
The siRNA can play the role of endogenous PPP5C gene expression in specific silencing tumour cell.
Further, the sequence of the loop-stem structure of the shRNA can be selected from following any: UUCAAGAGA, AUG, CCC,
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of the shRNA is as shown in SEQ ID NO:24, specifically: 5 '-GAGACAGAGAAGA
UUACAGUAUUCAAGAGAUACUGUAAUCUUCUCUGUCUC-3’。
ShRNA can become siRNA after digestion is processed, and then play endogenous people in specific silencing tumour cell
The effect of PPP5C gene expression.
The interference slow virus carrier for encoding the genetic fragment of shRNA of the present invention contains appointing in SEQ ID NO:1-11
One sequence and its complementary series.
Third aspect present invention discloses a kind of PPP5C gene interfering nucleic acid construct, contains of the present invention point of coding
From nucleic acid molecules in shRNA genetic fragment, the shRNA can be expressed
People's PPP5C gene interfering nucleic acid construct, which can be, will encode the gene of aforementioned people PPP5C gene shRNA
Segment is cloned into known carrier acquisition.Further, the PPP5C gene interfering nucleic acid construct is that the interference of PPP5C gene is slow
Viral vectors.
PPP5C gene interference slow virus carrier of the invention is the DNA fragmentation gram that will encode aforementioned PPP5C gene shRNA
It is grand enter known carrier obtain, the known carrier is mostly slow virus carrier, and PPP5C gene interference slow virus carrier is by disease
After poison packaging becomes infectious virion, infected tumor's cell, and then shRNA of the present invention is transcribed out, pass through enzyme
Cut processing and etc., finally obtain the siRNA, the expression for specific silencing PPP5C gene.
Further, the PPP5C gene interference slow virus carrier also contains promoter sequence and/or codes for tumor cell
In the nucleotide sequence of marker that can be detected；Preferably, the marker the being detected such as green fluorescent protein
(GFP).
Further, the slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
The embodiment of the present invention is specifically listed interferes slow virus to carry by people's PPP5C gene of vector construction of pGCSIL-GFP
Body is named as pGCSIL-GFP-PPP5C-siRNA.
The nucleic acid molecules that the present invention separates can be used for preparing prevention or treat the drug of tumour, and the tumour is lung cancer, knot
Intestinal cancer or glioma.
PPP5C gene siRNA of the invention can be used for inhibiting the proliferation of tumour cell, and it is swollen further to may be used as treatment
The drug or preparation of tumor.PPP5C gene interference slow virus carrier then can be used for preparing the PPP5C gene siRNA.It is controlled when being used as
It is that the nucleic acid molecules of safe and effective amount are applied to mammal when treating the drug or preparation of tumour.Specific dosage is also answered
Administration route, the factors such as patient health situation are considered, within the scope of these are all skilled practitioners technical ability.
Fourth aspect present invention, discloses a kind of PPP5C gene interference slow virus, interferes slow disease by aforementioned PPP5C gene
Poisonous carrier slow virus packaging plasmid, cell line auxiliary under, packed by virus.The slow virus can infected tumor's cell
And the small molecules interference RNA for being directed to PPP5C gene is generated, to inhibit the proliferation of lung cancer, colon cancer or glioma tumor cell.
PPP5C gene interference slow virus can be used for preparing prevention or treat the drug of tumour.
Fifth aspect present invention, discloses a kind of for preventing or treating the pharmaceutical composition of tumour, and active principle contains
There are isolated nucleic acid molecules above-mentioned, PPP5C gene interfering nucleic acid construct and/or PPP5C gene interfere slow virus.
Further, described pharmaceutical composition contains double-stranded RNA described in 1~99wt%, shRNA, PPP5C gene interference core
Acid con-struct or PPP5C gene interference slow virus and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositions, usually active constituent is mixed with excipient, or with figuration dilution agent or Bao Ke
In carrier existing for capsule or sachet.When excipient plays diluent, it can be solid, semisolid or liquid
Medium of the material as excipient, carrier or active constituent.Therefore, composition can be tablet, pill, pulvis, solution, sugar
Starch agent, sterilizing injecting solution etc..The example of suitable excipient includes: lactose, glucose, sucrose, sorbierite, mannitol, shallow lake
Powder, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, etc..Preparation may also include that wetting agent, emulsifier, preservative
(such as methyl hydroxybenzoate and propyl ester), sweetener.
The invention also discloses described pharmaceutical compositions to treat lung cancer, colon cancer, any tumour of glioma in preparation
Application in therapeutic agent.
The application of the pharmaceutical composition is that the treatment of tumour provides a method, specially a kind of prevention or treatment object
The method of in-vivo tumour, including the pharmaceutical composition of effective dose to be applied in object.Further, the tumour
Selected from lung cancer, colon cancer, glioma it is any.
When described pharmaceutical composition is for prevention or treatment object in-vivo tumour, need the drug of effective dose
Composition is applied in object.Using this method, growth, proliferation, recurrence and/or the transfer of the tumour are suppressed.Further
, the growth of the tumour, proliferation, at least the 10% of recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95% or 99% part is suppressed.
Sixth aspect present invention discloses a kind of kit for reducing the PPP5C gene expression in tumour cell, institute
Stating kit includes: the isolated nucleic acid molecules being present in container, PPP5C gene interfering nucleic acid construct and/or institute
The PPP5C gene interference slow virus stated.
In conclusion the present invention devises 11 RNAi target sequences for people's PPP5C gene, building is corresponding
PPP5CRNAi carrier, wherein the RNAi carrier pGCSIL-GFP-PPP5C-siRNA of coded sequence SEQ ID NO:2 can be significant
PPP5C gene is lowered in the expression of mRNA level in-site and protein level.Base is used as using slow virus (lentivirus is abbreviated as Lv)
Because operational instrument carries the RNAi sequence that RNAi carrier pGCSIL-GFP-PPP5C-siRNA can will be directed to PPP5C gene with targeting
Column efficiently import human lung cancer H1299 cell, colon cancer RKO cell and glioma U87 cell, reduce the expression water of PPP5C gene
It is flat, significantly inhibit the proliferative capacity of above-mentioned tumour cell.Therefore the PPP5C gene silencing of lentivirus mediated is that malignant tumour is potential
Clinical non-operative treatment mode.
SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, slow virus being capable of specificity inhibition
The expression of people's PPP5C gene, especially slow virus, can efficiently infect target cell, expeditiously inhibit PPP5C base in target cell
The expression of cause, and then inhibit the growth of tumour cell, promote apoptosis of tumor cells, is of great significance in oncotherapy.
Detailed description of the invention
Fig. 1: pGCSIL-GFP Plasmid diagram
Fig. 2: PPP5C-RNAi slow virus infects human lung cancer H1299 cell, colon cancer RKO cell and glioma U87 cell 5
After it, the expression of PPP5C mRNA is significantly reduced
Fig. 3: PPP5C-RNAi slow virus infected human lung cancer H1299 cell after 5 days, caused cell inhibitory effect
Fig. 4: PPP5C-RNAi slow virus infected human colon carcinoma RKO cell after 5 days, caused cell inhibitory effect
After Fig. 5: PPP5C-RNAi slow virus infects people glioma U87 cell 5 days, cause cell inhibitory effect
Specific embodiment
The present invention relates to one group of small molecules interference RNA (siRNA) sequence for being directed to people PPP5C gene, rna interference vectors
Slow virus is interfered with RNA.Target site of the people PPP5C mRNA coding region sequence as siRNA is chosen, according to continuous in target site
10-30(preferred 15-27, more preferable 19-23) a base sequence designs siRNA target sequence.By gene cloning, table is constructed
Up to the nucleic acid construct of above-mentioned siRNA, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence
Can in specific silencing human tumor cells endogenous PPP5C gene expression.
Inventors have found that using tumour cell can be effectively inhibited after the expression of mediator's PPP5C gene under RNAi method
Proliferation, this research achievement show that PPP5C gene is proto-oncogene, can be used as the target spot of oncotherapy.Inventor further closes
At with test a variety of siRNA for PPP5C gene, filtered out can be effectively suppressed PPP5C expression so that inhibit people's lung
The siRNA of cancer H1299 cell, colon cancer RKO cell and glioma U87 cell Proliferation and growth completes this on this basis
Invention.
The present invention provides a series of siRNA (siRNA) sequences of interference people PPP5C genes, and constructing can be special
The slow virus of property silencing PPP5C gene expression.The research of the invention finds that for people's PPP5C gene design siRNA and
RNAi slow virus, stablizes and specifically lowers the expression of PPP5C gene, and effectively inhibits the proliferation of human tumor cells.This hair
It is bright to show that PPP5C gene can promote growth of tumour cell, it is expected to the target spot as early diagnosis of tumor and treatment.Moreover, passing through
The expression of RNAi mode silencing PPP5C gene can be used as the effective means for inhibiting tumor development.
Mentality of designing of the invention are as follows:
The present invention screens by the following method obtains a kind of people PPP5C gene RNAi slow virus: transferring from Genbank
People's PPP5C gene order；Predict the site siRNA；Synthesis is directed to the effective siRNA sequence of PPP5C gene, both ends position containing digestion
The double-stranded DNA Oligo of point cohesive end；It is connect after slow virus carrier double digestion with double-stranded DNA Oligo, building expression PPP5C gene
The RNAi plasmid of siRNA sequence；Assistant carrier (the Packing Mix, Sigma- that RNAi plasmid and slow virus packaging are needed
Aldrich company) cotransfection human embryonic kidney cells 293T, recombinant slow virus particle is generated, can be prepared by efficient silencing PPP5C gene
Slow virus.
Based on the above method, the present invention provides 11 Effective target sites for interfering PPP5C gene (it is specific such as SEQ ID NO:
Shown in 1-11), construct the slow virus of special interference people PPP5C gene.
Invention additionally discloses a kind of people PPP5C gene RNAi slow virus (PPP5C-RNAi) and its preparation and application simultaneously.
The study find that reducing expression of the PPP5C gene in tumour cell using the RNAi method of lentivirus mediated
Afterwards, the proliferation of tumour cell can effectively be inhibited.The study show that PPP5C gene is a proto-oncogene, it is thin to can promote tumour
Born of the same parents' proliferation has important biological function in tumour occurrence and development, and PPP5C gene can be the target of oncotherapy,
The PPP5C gene specific silencing of lentivirus mediated can be used as a kind of new tool of oncotherapy.
Below with reference to embodiment, the present invention is further explained.It should be understood that embodiment is merely to illustrate the present invention, rather than limit
The scope of the present invention.The reagent of test method without specific conditions and undeclared formula is according to conventional strip in embodiment
Part, such as [ beauty ] Sambrook.J write；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing: Science Press
The condition that condition described in 2002 or manufacturer suggest carries out or configuration.
Embodiment 1 is directed to the preparation of people PPP5C gene RNAi slow virus
1. the effective siRNA target spot that screening is directed to people PPP5C gene
PPP5C(NM_006247 is transferred from Genbank) gene information；Utilize the lucky triumphant limited public affairs of chemical gene technology in Shanghai
The design software Genechem design of department is directed to the effective siRNA target spot of PPP5C gene.In the coded sequence of PPP5C gene
(CDS) in region, obtain the sequence of 21 bases every the starting of base, table 1 list wherein 11 be directed to PPP5C gene
Effective siRNA target sequence.
Table 1 targets the siRNA target sequence of people's PPP5C gene
| SEQ ID NO | TargetSeq | Initiation site |
| 1 | GAAGTACATCAAGGGTTATTA | 339 |
| 2 | GAGACAGAGAAGATTACAGTA | 757 |
| 3 | CGCTCGTGGAAACCACACTCA | 777 |
| 4 | AACCACACTCAAAGAGACAGA | 787 |
| 5 | GAAGAGAACAACCTGGACTAT | 1306 |
| 6 | AGAAGTACATCAAGGGTTATT | 381 |
| 7 | CCACGAGACAGACAACATGAA | 1012 |
| 8 | CCAGATCACTTTCACCTCCTT | 983 |
| 9 | CCAGCAATGCCATCTACTATG | 279 |
| 10 | CTATGACCTCCTCAACATATT | 844 |
| 11 | GAGAACAACCTGGACTATATC | 1352 |
2. the preparation of slow virus carrier
For siRNA target spot (by taking SEQ ID NO:2 as an example) synthesis both ends I containing Age and EcoR I restriction enzyme site cohesive end
Double-stranded DNA Oligo sequence (table 2)；PGCSIL-GFP carrier (Shang Haiji is acted on Age I and EcoR I restriction enzyme
Triumphant chemical gene Technology Co., Ltd. provides, Fig. 1), make its linearisation, agarose gel electrophoresis identifies endonuclease bamhi.
The double-stranded DNA Oligo of 2 both ends I containing Age and EcoR I restriction enzyme site cohesive end of table
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | GAGACAGAGAAGATTACAGTA | TTCAAGAGA | TACTGTAATCTTCTCTGTCTC | TTTTTG | 12 |
| Antisense strand | AATTCAAAAA | GAGACAGAGAAGATTACAGTA | TCTCTTGAA | TACTGTAATCTTCTCTGTCTC | 13 |
Double digestion is linearized to the carrier of (digestion system is as shown in table 4,37 DEG C, reacts 1h) by T4 DNA ligase
DNA is connected with purified double-stranded DNA Oligo, in 16 DEG C of companies in buffer system appropriate (linked system is as shown in table 5)
Night is taken over, connection product is recycled.By fresh competent escherichia coli cell (the conversion behaviour of connection product conversion calcium chloride preparation
It refers to: 55-56 pages of the Molecular Cloning:A Laboratory guide second edition).Bacterium clone surface is grown in connection converted product to be stained with, is dissolved in
10 μ l LB culture mediums, mixing take 1 μ l as template；The upstream and downstream of RNAi sequence in slow virus carrier, designs general PCR
Primer (upstream primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:16)；Downstream primer sequence:
5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:17), progress PCR identification experiment (PCR reaction system such as table 6-1,
Reaction condition such as table 6-2).The clone positive to PCR identification is sequenced and compares analysis, and comparing correctly clone is to construct
Successfully for the carrier of the expression RNAi of SEQ ID NO:2, it is named as pGCSIL-GFP-PPP5C-siRNA.
PGCSIL-GFP-Scr-siRNA negative control plasmids are constructed, negative control siRNA target sequence is 5 '-
TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO:18).When constructing pGCSIL-GFP-Scr-siRNA negative control plasmids,
The double-stranded DNA Oligo sequence (table 3) of both ends I containing Age and EcoR I restriction enzyme site cohesive end is synthesized for Scr siRNA target spot,
The same pGCSIL-GFP-PPP5C-siRNA of remaining construction method, identification method and condition.
The double-stranded DNA Oligo of 3 both ends I containing Age and EcoR I restriction enzyme site cohesive end of table
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 14 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 15 |
Double digestion is linearized to the carrier of (digestion system is as shown in table 4,37 DEG C, reacts 1h) by T4 DNA ligase
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
5 carrier DNA of table and double-strand double-stranded DNA Oligo coupled reaction system
| Reagent | Positive control (μ l) | From even control (μ l) | Connection group (μ l) |
| The carrier DNA (100ng/ μ l) of linearisation | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer solution | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligase | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Upstream primer | 0.4 |
| Downstream primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program setting
3. packing PPP5C-siRNA slow virus
The DNA of RNAi plasmid pGCSIL-GFP-PPP5C-siRNA is extracted with the plasmid extraction kit of Qiagen company,
It is configured to 100ng/ μ l storing liquid.Before transfection for 24 hours, with the human embryonic kidney cells 293T cell of trypsin digestion logarithmic growth phase,
With the DMEM complete medium adjustment cell density containing 10% fetal calf serum for 1.5 × 105Cell/ml, is inoculated in 6 orifice plates, and 37
DEG C, 5%CO2Culture in incubator.It can be used to transfect when cell density reaches 70%-80%.2h before transfecting, is sucked out original culture
The fresh complete medium of 1.5ml is added in base.According to the MISSION Lentiviral of Sigma-aldrich company
Packing Mix(PVM is added into a sterile centrifugation tube for the explanation of Packaging Mix kit) 20 12 μ l of μ l, PEI,
400 μ l of plasma-free DMEM medium takes the Plasmid DNA of the 20 above-mentioned extractings of μ l, adds to above-mentioned PVM/PEI/DMEM mixed liquor.It will be upper
It states transfection mixture and is incubated at room temperature 15min, be transferred in the culture medium of human embryonic kidney cells 293T cell, 37 DEG C, 5% CO2
16h is cultivated in incubator.The culture medium containing transfection mixture is discarded, complete medium 2ml is added in PBS solution washing, after
Continuous culture 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration unit (Millipore) purifying and the slow disease of concentration
Poison, steps are as follows: (1) 4 DEG C, 4000g is centrifuged 10min, removes cell fragment；(2) 0.45 μm of filter filtering supernatants are in 40ml
In ultracentrifugation pipe；(3) 4000g is centrifuged, 10-15min, until the viral concentration volume needed；(4) it after being centrifuged, will filter
Cup and following filtered solution collection cups separate, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than
1000g；(5) Centrifuge Cup is removed from sample collection cup, in sample collection cup is viral concentration liquid.By viral concentration liquid
It is saved after packing in -80 degrees Celsius.The sequence of the first chain of siRNA contained in viral concentration liquid is as shown in SEQ ID NO:23.
The packaging process of slow virus is compareed with PPP5C-siRNA slow virus, only with the replacement of pGCSIL-GFP-Scr-siRNA carrier
PGCSIL-GFP-PPP5C-siRNA carrier.
The silence efficiency of 2 real-time fluorescence quantitative RT-PCR method of embodiment detection PPP5C gene
Human lung cancer H1299 cell, colon cancer RKO cell and glioma U87 cell in logarithmic growth phase carry out pancreatin
Digestion, cell suspension is made, and (cell number is about 5 × 104/ ml) it is inoculated in 6 orifice plates, culture to cell fusion degree reaches about
30%.According to plural (MOI, H1299:10, RKO:20, U87:20) value is infected, virus prepared by the embodiment 1 of appropriate amount is added,
Culture medium is replaced in culture afterwards for 24 hours, after time of infection reaches 5 days, collects cell.It is grasped according to the Trizol of Invitrogen company
Explain book, extracted total RNA.According to the M-MLV operational manual of Promega company, RNA reverse transcription is obtained into cDNA(and is reversed
Record reaction system is shown in Table 7,42 DEG C of reaction 1h, and then water-bath 10min inactivates reverse transcriptase in 70 DEG C of water-baths).
Real_time quantitative detection is carried out using TP800 type Real time PCR instrument (TAKARA).The primer of PPP5C gene is such as
Under: upstream primer 5 '-CCGGAAATGTGCCTACCA-3 ' (SEQ ID NO:19) and downstream primer 5 '-
GGTTGGTCTCCGAGGGTAA-3 ' (SEQ ID NO:20).Using house-keeping gene GAPDH as internal reference, primer sequence is as follows: upstream
Primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:21) and downstream primer 5 '-
CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:22).By the proportional arrangement reaction system in table 8.
7 reverse transcription reaction system of table
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H2O | 3.5 |
| Total | 11.0 |
Table 8Real-time PCR reaction system
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Upstream primer (2.5 μM): | 0.5 |
| Downstream primer (2.5 μM): | 0.5 |
| cDNA | 1.0 |
| ddH2O | 8.0 |
| Total | 20.0 |
Setting program is two-step method Real-time PCR: 95 DEG C of initial denaturation, 15s；Each step is denaturalized 95 DEG C later, 5s；It moves back
Fire extends 60 DEG C, 30s；45 circulations are carried out altogether.Extending stage reading light absorption value every time.After PCR, 95 DEG C of denaturation
1min is subsequently cooled to 55 DEG C, combines DNA double chain sufficiently.To 95 DEG C since 55 DEG C, each step increases by 0.5 DEG C, keeps
4s, while light absorption value is read, make melting curve.Using 2-ΔΔCtAnalytic approach calculates the gene expression abundance for having infected PPP5C mRNA.
The cell for compareing viral (Lv-Scr-siRNA) is infected as control.Experimental result (Fig. 2) shows human lung cancer H1299 cell, knot
The expression of PPP5C mRNA has lowered 96.4%, 95.2% and 86.3% in intestinal cancer RKO cell and glioma U87 cell.
Embodiment 3 detects the proliferative capacity for infecting the tumour cell of PPP5C-siRNA slow virus
People H1299 cell, colon cancer RKO cell and glioma U87 cell in logarithmic growth phase carry out pancreatin digestion,
Cell suspension is made, and (cell number is about 5 × 104/ ml) it is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to
Plural (MOI, H1299:10, RKO:20, U87:20) to be infected, the virus of appropriate amount is added, culture medium is replaced in culture afterwards for 24 hours, to
After time of infection reaches 5 days, each experimental group cell for being in logarithmic growth phase is collected.Complete medium is resuspended into cell suspension (2
×104/ ml), it is about 2000/hole with cell density, is inoculated with 96 orifice plates.Every group of 5 multiple holes, every 100 μ l of hole.After completing plate,
Set 37 DEG C, 5%CO2Incubator culture.Since after bed board second day, Cellomics instrument (Thermo Fisher) is used daily
It is primary to detect read plate, continuous detection read plate 5 days.By adjusting the input parameter of Cellomics arrayscan, accurately calculate
Data are carried out statistics drawing, draw cell Proliferation curve by the quantity for scanning the cell with green fluorescence in orifice plate every time out
(result is as shown in Figure 3-Figure 5).The result shows that slow virus infects each tumour of group after cell injuring model 5 days, growth rate is aobvious
Work slows down, and far below the growth rate of control group tumour cell, vigor cell number has dropped 99.5%, 95.1% and respectively
77.5%, show that PPP5C gene silencing causes tumor cell proliferation ability to be suppressed.
The above, only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that under the premise of not departing from the method for the present invention, can also be made for those skilled in the art
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are equivalent embodiment of the invention；Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution of any equivalent variations made by above-described embodiment, still fall within the range of technical solution of the present invention
It is interior.
Claims (7)
1. a kind of purposes of isolated PPP5C gene as action target in screening treatment of colon cancer drug；The purposes tool
Body refers to: the double-strand of the expression of PPP5C gene in colon cancer cell can be reduced using PPP5C gene as action target screening
RNA or shRNA is as treatment of colon cancer drug, and the target sequence of the double-stranded RNA or shRNA are as shown in SEQ ID NO:2.
2. a kind of pharmaceutical composition contains preparing the purposes in treatment of colon cancer drug, the active principle of described pharmaceutical composition
It is any below: to reduce the isolated nucleic acid molecules of PPP5C gene expression dose in colon cancer cell, PPP5C gene interferes core
Acid con-struct, PPP5C gene interfere slow virus, and the nucleic acid molecules include: can reduce the table of PPP5C gene in colon cancer cell
Up to horizontal double-stranded RNA or shRNA, the target sequence of the double-stranded RNA or shRNA are as shown in SEQ ID NO:2；The PPP5C
Gene interfering nucleic acid construct, containing the genetic fragment for encoding the shRNA in the isolated nucleic acid molecules, can express described in
shRNA；The PPP5C gene interference slow virus after the gene fragment clone for encoding the shRNA is entered slow virus carrier by obtaining
?.
3. purposes as claimed in claim 2, which is characterized in that the double-stranded RNA is siRNA, first chain of tiny RNA
Sequence is as shown in SEQ ID:23.
4. purposes as claimed in claim 2, which is characterized in that the shRNA sequence is as shown in SEQ ID:24.
5. purposes as claimed in claim 2, which is characterized in that the PPP5C gene interfering nucleic acid construct is interference slow virus
Carrier.
6. purposes as claimed in claim 5, which is characterized in that the interference slow virus carrier will be by that will encode the base of the shRNA
It is obtained after being cloned into slow virus carrier because of segment, the slow virus carrier is selected from: pLKO.1-puro,
pLKO.1-CMV-tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、
pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-TagCFP、pLKO.1-puro-CMV-TagYFP、
pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-TagFP635、
pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-1xLacO、
pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、
pLenti6/BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、
Appointing in pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ
One.
7. purposes as claimed in claim 2, which is characterized in that the PPP5C gene interference slow virus is by the slow disease of the interference
Poisonous carrier slow virus packaging plasmid, cell line auxiliary under, packed by virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313783.XA CN103623426B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's PPP5C gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313783.XA CN103623426B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's PPP5C gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103623426A CN103623426A (en) | 2014-03-12 |
| CN103623426B true CN103623426B (en) | 2019-03-12 |
Family
ID=50205104
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210313783.XA Active CN103623426B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's PPP5C gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103623426B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113274510B (en) * | 2021-04-29 | 2022-05-13 | 山东农业大学 | Composition for inhibiting J subgroup avian leukosis virus replication and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6235891B1 (en) * | 1999-03-31 | 2001-05-22 | South Alabama Medical Science Foundation | Glucocorticoid receptor agonist and decreased PP5 |
| CN102552937A (en) * | 2011-12-19 | 2012-07-11 | 上海吉凯基因化学技术有限公司 | Application of human p21-activated kinase 7 (PAK7) gene and relevant medicines of human PAK7 gene |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2001524318A (en) * | 1997-11-20 | 2001-12-04 | サウス、アラバマ、メディカル、サイエンス、ファウンデーション | Inhibition of cell proliferation by lowering levels of PP5 |
| US5948902A (en) * | 1997-11-20 | 1999-09-07 | South Alabama Medical Science Foundation | Antisense oligonucleotides to human serine/threonine protein phosphatase genes |
| US20040171564A1 (en) * | 1997-11-20 | 2004-09-02 | Honkanen Richard E. | Antisense oligonucleotide modulation of human serine/threonine protein phosphatase gene expression |
-
2012
- 2012-08-29 CN CN201210313783.XA patent/CN103623426B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6235891B1 (en) * | 1999-03-31 | 2001-05-22 | South Alabama Medical Science Foundation | Glucocorticoid receptor agonist and decreased PP5 |
| CN102552937A (en) * | 2011-12-19 | 2012-07-11 | 上海吉凯基因化学技术有限公司 | Application of human p21-activated kinase 7 (PAK7) gene and relevant medicines of human PAK7 gene |
Non-Patent Citations (4)
| Title |
|---|
| A comprehensive platform for highly multiplexed mammalian functional genetic screens;Ketela, T., et al.;《BMC Genomics》;20111231;第12卷;1-13 |
| CD133 Protein N-Glycosylation Processing Contributes to Cell Surface Recognition of the Primitive Cell Marker AC133 Epitope;Anthony B. Mak，et al.;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20111125;第286卷(第47期);41046–41056 |
| Genome-scale loss-of-function screening with a lentiviral RNAi library;David E Root, et al.;《NATURE METHODS》;20060823;第3卷(第9期);715-719 |
| Systematic investigation of genetic vulnerabilities across cancer cell lines reveals lineage-specific dependencies in ovarian cancer;Hiu Wing Cheung, et al.;《PNAS》;20110726;第108卷(第30期);12372-12377 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103623426A (en) | 2014-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
| CN105586391A (en) | Application of human GTPBP4 gene and related drugs of human GTPBP4 gene | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103667430A (en) | Application and relevant medicament of nucleotide octamer binding protein expression gene | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN103421887B (en) | The purposes and its related drugs of CIT gene | |
| CN104368012B (en) | The purposes and its related drugs of people's RPL34 gene | |
| CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes | |
| CN105803053A (en) | Uses and related drugs of human RBM17 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200602 Address after: 201203 room 101-A, 328 Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI GENECHEM TECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |