CN102552937B - The purposes of people PAK7 gene and related drugs thereof - Google Patents
The purposes of people PAK7 gene and related drugs thereof Download PDFInfo
- Publication number
- CN102552937B CN102552937B CN201110425877.1A CN201110425877A CN102552937B CN 102552937 B CN102552937 B CN 102552937B CN 201110425877 A CN201110425877 A CN 201110425877A CN 102552937 B CN102552937 B CN 102552937B
- Authority
- CN
- China
- Prior art keywords
- pak7
- gene
- people
- plko
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses purposes and the related drugs thereof of people PAK7 gene.The invention discloses the purposes of people PAK7 gene in the preparation of oncotherapy, diagnosing tumor and medicine.The present invention also constructs people PAK7 gene small molecules interference RNA, people PAK7 Gene interfere nucleic acid construct, people PAK7 Gene interfere slow virus disclose their purposes further.SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus can suppress the expression of people PAK7 gene by specificity, especially slow virus, efficiently can infect target cell, suppress the expression of PAK7 gene in target cell expeditiously, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people PAK7 gene.
Background technology
The RNA interference (RNAinterference, RNAi) phenomenon refer to when with double-stranded RNA (dsRNA) transfered cell of endogenous mRNA coding region section sequence homology after, there is selective degradation in this mRNA, and causes the silence of this gene expression.Research shows, length is that the double-stranded RNA of 21-23nt specificly with post-transcriptional level can cause RNAi (TuschlT transcribing, ZamorePD, SharpPA, BartelDP.RNAi:double-strandedRNAdirectstheATP-dependentc leavageofmRNAat21to23nucleotideintervals.Cell2000; 101:25-33.).Tumor is the principal disease threatening human health.Though tumor patient is through chemotherapy, radiotherapy and Comprehensive Treatment, five year survival rate is still very low, if intervene with the relevant gene of progress tumor invasion, new way is opened up in the treatment that can be tumor.In recent years, RNAi has become the available strategy of the gene therapy of tumor.Utilize RNAi technology can suppress proto-oncogene, generation and development (Uprichard, SusanL.ThetherapeuticpotentialofRNAinterference.FEBSLett ers2005 that the expression of antioncogene, Cell cycle-related genes, anti-apoptotic related gene etc. of sudden change carrys out Tumor suppression; 579:5996-6007.).
P21 activated protein kinase (p21-activatedkinase, PAK) family is the threonine/serine kinase of the upper high conservative of evolution, for the target protein that Rho family little guanosine triphosphatase (Rho-GTPase) Cdc42 and Rac downstream is important, it is also the upstream regulation factor of mitogen activated protein kinase (MAPK) signal pathway.PAK family protein participates in many important cellular activities, kinetics as cytoskeleton regulates, cell movement, (KumarR, the VadlamudiRK.EmergingFunctionsofp21-ActivatedKinasesinHum anCancerCells.JCellPhysiol.2002 such as existence and apoptosis, cell cycle, genetic transcription adjustment, Growth of Cells signal transduction and conversion; 193 (2): 133-44.SellsMA, BoydJT, ChernoffJ.p21-activatedkinase1 (Pak1) regulatescellmotilityinmammalianfibroblasts.JCellBiol.19 99; 145 (4): 837-49.VadlamudiRK, KumarR.P21-activatedkinasesinhumancancer.CancerMetastasi sRev.2003; 22 (4): 385-93.EdwardsDC, SandersLC, BokochGM, GillGN.ActivationofLIM-kinasebyPak1couplesRac/Cdc42GTPas esignallingtoactincytoskeletaldynamics.NatCellBiol.1999; 1 (5): 253-9.).
Two subgroups can be divided into: A group (comprising PAK1-3) and B group (comprising PAK4-6) according to the degree of homology of PAK family member.PAK7 is the PAK family member be finally cloned, and is positioned chromosome 20p12 position, coding 80kD albumen.This albumen is containing CDC42/Rac1 interaction pattern and GTPase binding structural domain.PAK7 can be activated the MAPK signal path in one-step activation downstream of going forward side by side by p21, have the ability of self-phosphorylation and oneself's activation.PAK7 protein localization is on mitochondrial membrane, in 112 serine phosphorylation BAD albumen (CotteretS, JafferZM, BeeserA, ChernoffJ.p21-Activatedkinase5 (Pak5) localizestomitochondriaandinhibitsapoptosisbyphosphoryla tingBAD.MolCellBiol.2003; 23 (16): 5526-39.), also can in pro apoptotic protein BAD (CotteretS, the ChernoffJ.NucleocytoplasmicshuttlingofPak5regulatesitsan tiapoptoticproperties.MolCellBiol.2006 of 136 serine phosphorylation Bcl-2 families after activated protein kinase AKT; 26 (8): 3215-30.), thus realize direct and indirect to apoptotic suppression (GirouxV, DagornJC, IovannaJL.AReviewofKinasesImplicatedinPancreaticCancer.P ancreatology.2009 (6); 9:738-54.).Research also finds, PAK7 albumen can shuttle back and forth between nucleus and mitochondrion, and accurate Subcellular Localization is most important to its performance apoptosis inhibit effect.PAK7 also participates in cell movement, keeping microtubule stabilization, causing F-actin networks disorderly by lowering MARK2 albumen, stress fiber and talin disappear, cell is made to form pseudopodium (MateniaD, GriesshaberB, LiXY, ThiessenA, JohneC, JiaoJ, MandelkowE, MandelkowEM.PAK5kinaseisaninhibitorofMARK/Par-1, whichleadstostablemicrotubulesanddynamicactin.MolBiolCel are l.2005; 16 (9): 4410-22.TimmT, MateniaD, LiXY, GriesshaberB, MandelkowEM.SignalingfromMARKtotau:regulation, cytoskeletalcrosstalk, andpathologicalphosphorylation.NeurodegenerDis.2006; 3 (4-5): 207-17.) PAK7 mainly specific in brain, continuous expression (PandeyA, DanI, KristiansenTZ, WatanabeNM, VoldbyJ, KajikawaE, Khosravi-FarR, BlagoevB, MannM.CloningandcharacterizationofPAK5, anovelmemberofmammalianp21-activatedkinase-IIsubfamilyth atispredominantlyexpressedinbrain.Oncogene.2002; 21 (24): 3939-48.), and PAK7 process LAN promotes growth and the extension of neurite in N1E-115 cell, and the sudden change of PAK7 shows the function suppressing neurite outgrowth, it is pointed out to play an important role (DanC in brain development process, NathN, LibertoM, MindenA.PAK5, anewbrainspecifickinase, promotesneuriteoutgrowthinN1E-115cells.MolCellBiol.2002; 22 (2): 567-77.).At clinical middle discovery PAK7 high expressed in colorectal cancer, and improve along with grade malignancy increases expression, and by regulating cell adhesion and migration to promote colon cancer transfer (GongW, AnZ, WangY, PanX, FangW, JiangB, ZhangH.P21-activatedkinase5isoverexpressedduringcolorect alcancerprogressionandregulatescolorectalcarcinomacellad hesionandmigration.IntJCancer.2009; 125 (3): 548-55.).Studies have found that to combine and suppress PAK7, MAP3K7 and CK2, cumulative apoptosis induction effect can be obtained, PAK7 is expected to become an effective therapy target (GirouxV of cancer of pancreas, DagornJC, IovannaJL.AReviewofKinasesImplicatedinPancreaticCancer.P ancreatology.2009 (6); 9:738-54.).At present, adjustment cell movement and invasion and attack function aspects are mainly concentrated on to the research of the function of PAK7 in tumor cell.Report is there is no about the function of PAK7 in tumor cell survival, apoptosis and cell cycle progress.
Slow virus (lentivirus) carrier is efficient gene transfer instrument, is mainly used in infecting the cell lower to conventional method transfection efficiency, as primary cell etc.Lentiviral particle can the cell of simultaneously infection development and non-proliferative, and infect more stable, lasting.Use slow virus carrier, the high expressed of specific gene can be realized, also can express hairpin RNA (shorthairpinRNA, shRNA) and disturb (RNAinterference, RNAi) mode to lower the expression of certain gene with RNA.RNAi is the sequence-specific PTGS phenomenon utilizing double chain RNA mediate, become a kind of emerging effective means of research gene function, and be expected to instrument (the IzquierdoM.ShortinterferingRNAsasatoolforcancergenethera py.CancerGeneTher.2005 becoming the disease gene treatments such as tumor; 12 (3): 217-27.).The present invention intends the function of RNAi technology research PKA7 gene in tumor cell malignant proliferation adopting lentivirus mediated, for the No operation clinical treatment of malignant tumor provides theoretical foundation.
Summary of the invention
The object of the invention is to Therapeutic Method and the medicine of open and people PAK7 (P21 (Cdc42/Rac)-activatedkinase7) gene-correlation.
First aspect present invention, disclose by people PAK7 gene for the preparation of or screening anti-tumor medicine, or by people PAK7 gene for the preparation of diagnosing tumor medicine.
People PAK7 gene for the preparation of or screening anti-tumor medicine comprise the content of two aspects: one, to be applied to people PAK7 gene for the action target of tumor cell as medicine or preparation and to prepare anti-tumor medicine or preparation; Its two, people PAK7 gene is applied to screening anti-tumor medicine or preparation as medicine or preparation for the action target of tumor cell.
Described people PAK7 gene specifically to be referred to as action target for tumor cell of medicine or preparation: people PAK7 gene is produced the target of RNA interference effect as medicine or preparation for tumor cell, thus the expression of tumor cell people PAK7 gene can be reduced.
Describedly people PAK7 gene is applied to screening anti-tumor medicine as medicine or preparation for the action target of tumor cell or preparation specifically refers to: as effective object, medicine or preparation are screened by people PAK7 gene, can suppress or promote that the medicine of people PAK7 gene expression is as oncotherapy drug candidate to find.Namely people PAK7 gene small molecules interference RNA as described later obtains for effective object screening with people PAK7 gene, can be used as the medicine with inhibition tumor cell proliferation function.Such as antibody drug, small-molecule drug etc. also can using PAK7 gene as effective object.
Described by people PAK7 gene for the preparation of diagnosing tumor medicine, refer to preparation people PAK7 gene expression product being applied to diagnosing tumor medicine as a diagnosing tumor index.
Described tumor can be any one tumor that the propagation of its tumor cell is relevant to the expression of people PAK7 gene, further, is a kind of malignant tumor, such as, is selected from: pulmonary carcinoma, gastric cancer and glioma.
Described anti-tumor medicine can be small-molecule chemical medicine, antibody medicine, also can be nucleic acid drug.
Further, described anti-tumor medicine can reduce the expression of people PAK7 gene thus the propagation of inhibition tumor cell.
Adopt the method for forgoing neoplasms medicine treatment tumor, mainly reach therapeutic purposes by the propagation of the expression inhibition tumor cell reducing people PAK7 gene.
Concrete, during treatment, effectively can reduce the administering substances of people PAK7 gene expression dose in patient.
Further, the described material that effectively can reduce people PAK7 gene expression dose, comprising can the small molecules interference RNA (siRNA) of specificity reticent people PAK7 gene expression.This small molecules interference RNA (siRNA) can play the effect of the expression of endogenous PAK7 gene in the reticent tumor cell of specificity.
Further, described small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people PAK7 gene expression of SEQIDNO:1-50.
The target sequence of described small molecules interference RNA reticent people PAK7 gene expression using the arbitrary sequence being selected from SEQIDNO:1-50 as specificity refers to: this small molecules interference RNA can be combined by the mRNA fragments specific coded by any one sequence in SEQIDNO:1-50, and the expression of specificity silence people PAK7 gene.
Further, describedly can the small molecules interference RNA (siRNA) of specificity reticent people PAK7 gene expression to express via slow virus carrier.Specifically, this process comprises: the DNA fragmentation of the described people PAK7 gene small molecules interference RNA of coding is cloned into slow virus carrier and obtains people PAK7 Gene interfere slow virus carrier, and then utilizing this people PAK7 Gene interfere slow virus carrier after virus packaging becomes infectious virion, infected tumor's cell also finally expresses described siRNA.
People PAK7 Gene interfere slow virus carrier is obtain after the DNA fragmentation of the described people PAK7 gene small molecules interference RNA of coding is cloned into slow virus carrier, can produce people PAK7 gene small molecules interference RNA.
Further, described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, any one slow virus carrier in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ, it is carrier that the embodiment of the present invention specifically lists with pGCSIL-GFP.
Slow virus carrier can slow virus packaging plasmid, cell line auxiliary under, become infectious virion through virus packaging.
Second aspect present invention, discloses a kind of people PAK7 gene small molecules interference RNA (siRNA) target fragments of separation, and its sequence is any sequence in SEQIDNO:1-50.
People PAK7 gene small molecules interference RNA (siRNA) target fragments of described separation can be applicable to screening and the preparation of people PAK7 gene small molecules interference RNA.
Third aspect present invention, discloses a kind of people PAK7 gene small molecules interference RNA (siRNA), can the expression of specificity reticent people PAK7 gene.
Described people PAK7 gene small molecules interference RNA is to be selected from the target sequence of arbitrary sequence as specificity reticent people PAK7 gene expression of SEQIDNO:1-50.
Further, described people PAK7 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, and described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment contains the RNA of the arbitrary sequential coding in SEQIDNO:1-50.
Described just RNA fragment and antisense RNA fragment are present on two different RNA chains or are present on same RNA chain.
The length of described just RNA fragment and antisense RNA fragment is 15-27 nucleotide; Preferably, length is 19-23 nucleotide; Best, length is 19,20 or 21 nucleotide.
Further, described people PAK7 gene small molecules interference RNA is hair clip type single stranded RNA, comprises just RNA fragment, stem ring plate section and antisense RNA fragment, is separated in the middle of just RNA fragment and antisense RNA fragment by stem ring plate section; Wherein, just RNA fragment and antisense RNA fragment complementation, the sequence of just RNA fragment is selected from the arbitrary of SEQIDNO:1-50.
Described stem ring plate segment structure comprises 6 or 9 bases.The sequence of further described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.It is stem ring that the present invention specifically lists with UUCAAGAGA.
As embodiment is enumerated, the sequence of described people PAK7 gene small molecules interference RNA is SEQIDNO:51:GAGCUCUCUCCUACCUUCAUAUUCAAGAGAUAUGAAGGUAGGAGA GAGCUC.
Fourth aspect present invention, discloses a kind of people PAK7 Gene interfere nucleic acid construct, comprises the genetic fragment of aforementioned people PAK7 gene small molecules interference RNA of encoding, can express aforementioned people PAK7 gene small molecules interference RNA.
Described people PAK7 Gene interfere nucleic acid construct can be the gene fragment clone of the aforementioned people PAK7 gene small molecules interference RNA of coding is entered known carrier obtain.
Further, described people PAK7 Gene interfere nucleic acid construct behaviour PAK7 Gene interfere slow virus carrier, obtain after the gene fragment clone of the described people PAK7 gene small molecules interference RNA of coding is entered slow virus carrier, people PAK7 gene small molecules interference RNA can be produced.
Described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people PAK7 Gene interfere nucleic acid construct of vector construction that the embodiment of the present invention specifically lists with pGCSIL-GFP, called after PAK7-shRNA-plasmid.
Further, the sequence of genetic fragment of described people PAK7 gene small molecules interference RNA of encoding contains arbitrary sequence in SEQIDNO:1-50 and complementary series thereof.
People PAK7 gene small molecules interference RNA of the present invention can be used for the propagation of inhibition tumor cell, can be used as medicine or the preparation for the treatment of or diagnosing tumour further.People PAK7 Gene interfere nucleic acid construct then can be used for preparing described people PAK7 gene small molecules interference RNA.
When being used as medicine or the preparation for the treatment of tumor, be that the people PAK7 gene small molecules interference RNA of safe and effective amount is applied to mammal.Certainly, concrete dosage also should consider the factor such as route of administration, patient health situation, and these are all within skilled practitioners skill.
Fifth aspect present invention, discloses a kind of people PAK7 Gene interfere slow virus, by aforementioned people PAK7 Gene interfere slow virus carrier slow virus packaging plasmid, cell line auxiliary under, form through virus packaging.This slow virus can infected tumor's cell produce people PAK7 gene small molecules interference RNA, thus the propagation of inhibition tumor cell.
Sixth aspect present invention, also discloses a kind of pharmaceutical composition, the people PAK7 gene small molecules interference RNA containing treatment effective dose or people PAK7 Gene interfere slow virus.
Further, described pharmaceutical composition contains 1 ~ 99wt% foregoing people PAK7 gene small molecules interference RNA or people PAK7 Gene interfere slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositionss, usually by active component and mixed with excipients, or with excipient dilution, or wrap in can in the carrier that exists of capsule or sachet.When excipient plays diluent effect, it can be solid, semisolid or the fluent material medium as excipient, carrier or active component.Therefore, compositions can be tablet, pill, powder, solution, syrup, sterilizing injecting solution etc.The example of suitable excipient comprises: lactose, glucose, sucrose, sorbitol, mannitol, starch, microcrystalline Cellulose, polyvinylpyrrolidone, cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, antiseptic (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In sum, the present invention devises 50 RNAi target sequences for people PAK7 gene, build corresponding PAK7RNAi carrier, wherein the RNAi carrier PAK7-ShRNA-plasmid of coded sequence SEQIDNO:35 significantly can lower the expression of PAK7 gene at mRNA level in-site and protein level.Use slow virus (lentivirus, be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-PAK7-siRNA as genetic manipulation instrument the RNAi sequence for PAK7 gene can efficiently be imported people pulmonary carcinoma H1299 cell, gastric cancer SGC7901 cell and glioma U251 cell targeting, reduce the expression of PAK7 gene, significantly suppress the multiplication capacity of above-mentioned tumor cell.Therefore the PAK7 gene silencing of lentivirus mediated is the potential clinical non-operative treatment mode of malignant tumor.
SiRNA provided by the invention or comprise the nucleic acid construct of this siRNA sequence, slow virus can suppress the expression of people PAK7 gene by specificity, especially slow virus, efficiently can infect target cell, suppress the expression of PAK7 gene in target cell expeditiously, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Accompanying drawing explanation
Fig. 1 represents pGCSIL-GFP Plasmid diagram
After Fig. 2 represents that PAK7shRNA slow virus infects 5 days, compared with infecting group with contrast slow virus, the expression of the PAK7mRNA in people pulmonary carcinoma H1299 cell, gastric cancer SGC7901 cell and glioma U251 cell reduces
Fig. 3 represents that PAK7shRNA slow virus contaminated people pulmonary carcinoma H1299 cell after 5 days, remarkable antiproliferative effect
Fig. 4 represents that PAK7shRNA slow virus contaminated people gastric cancer SGC7901 cell after 5 days, remarkable antiproliferative effect
Fig. 5 represents that PAK7shRNA slow virus contaminated glioma U251 cell after 5 days, remarkable antiproliferative effect
Fig. 6 uses the SABC testing result of PAK7 antibody on tumor tissues sample.
A is gastric cancer b, c is pulmonary carcinoma
Detailed description of the invention
The present invention is based on the research that PAK7 is relevant, think that PAK7 may take part in generation and the development of malignant tumor.
The present invention relates to one group of small molecules interference RNA for people PAK7 gene (siRNA) sequence, rna interference vector and RNA and disturb slow virus.Choose the target site of people PAK7mRNA coding region sequence as siRNA, according to continuous print 10-30 in target site (preferred 15-27, more preferably 19-23) individual base sequence design siRNA target sequence.By gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the expression of endogenous PAK7 gene in the reticent human tumor cells of specificity.
Inventor finds, can the propagation of inhibition tumor cell effectively after the expression of PAK7 gene of transferring person under adopting RNAi method, and this achievement in research shows that PAK7 gene is proto-oncogene, can be used as the target spot of oncotherapy.Inventor synthesizes further and tests the multiple siRNA for PAK7 gene, filter out the expression that effectively can suppress PAK7 and then suppressed the siRNA of people pulmonary carcinoma H1299 cell, gastric cancer SGC7901 cell and Proliferation of Glioma U 251 Cells and growth, complete the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of interference people PAK7 gene, constructing can the slow virus of the reticent PAK7 gene expression of specificity.The present invention studies discovery, for siRNA and the RNAi slow virus of people PAK7 gene design, and stable expression of also lowering PAK7 gene specifically, and effectively suppress the propagation of human tumor cells.The present invention shows that PAK7 gene can promote growth of tumour cell, is expected to the target spot becoming early diagnosis of tumor and treatment.And, by the expression of the reticent PAK7 gene of RNAi mode, can be used as the effective means of Tumor suppression development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people PAK7 gene RNAi slow virus: from Genbank, transfer people PAK7 gene order; Prediction siRNA site; Synthesize the effective siRNA sequence for PAK7 gene, design and synthesize the OligoDNA of target sequence, annealing forms double-stranded DNA (sequence is made up of positive-sense strand, antisense strand, reverse complementary sequence and ring); Be connected with double-stranded DNA Oligo after slow virus carrier double digestion, the RNAi plasmid of construction expression PAK7 gene siRNA sequence; By the assistant carrier (PackingMix that RNAi plasmid and slow virus packaging need, Sigma-aldrich company) cotransfection HEKC 293T, produce recombinant slow virus granule, the slow virus (PAK7shRNA) of efficient reticent PAK7 gene can be obtained.
Based on said method, the invention provides the Effective target site (specifically as shown in SEQIDNO:1-50) of 50 interference PAK7 genes, construct the slow virus of special interference people PAK7 gene.
The present invention simultaneously also discloses a kind of people PAK7 gene RNAi slow virus and preparation and application thereof.
This research finds, utilizes the RNAi method of lentivirus mediated, after reducing the expression in tumor cell of PAK7 gene, and can the propagation of effective inhibition tumor cell.This research shows, PAK7 gene is a proto-oncogene, can promote tumor cell proliferation, occurs and have important biological function in development in tumor, PAK7 gene can be the target of oncotherapy, and the PAK7 gene specific silence of lentivirus mediated can be used as a kind of new tool of oncotherapy.
The present invention is set forth further below in conjunction with embodiment.Should be understood that embodiment only for illustration of the present invention, but not limit the scope of the invention.In embodiment, the experimental technique of unreceipted actual conditions and the reagent of undeclared formula are conveniently condition, as works such as [U.S.] Sambrook.J; Huang Peitang etc. translate.Molecular cloning texts guide, the third edition.Beijing: the condition of the condition described in Science Press 2002 or manufacturer's suggestion is carried out or configures.
Embodiment 1: for the preparation of people PAK7 gene RNAi slow virus
1. screening is for the effective siRNA target spot of people PAK7 gene
PAK7 (NM_177990) gene information is transferred from Genbank; Utilize the design software Genechem of Shanghai JiKai Gene Chemical Technology Co., Ltd design for the effective siRNA target spot of PAK7 gene.In coded sequence (CDS) region of PAK7 gene, every the sequence of an initial acquisition of base 21 bases, table 1 lists wherein 50 effective siRNA target sequences for PAK7 gene; Carry out BLAST analysis by Genbank data base, determine that it does not produce interference effect to other gene any.
Table 1 targeting is in the siRNA target sequence of people PAK7 gene
Double-stranded DNA Oligo sequence (table 2) of two ends containing AgeI and EcoRI restriction enzyme site cohesive end is synthesized for siRNA target spot (for SEQIDNO:35); Act on pGCSIL-GFP carrier (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 1) with AgeI and EcoRI restricted enzyme, make its linearisation, agarose gel electrophoresis qualification endonuclease bamhi.
Table 2 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By T4DNA ligase, by double digestion linearisation, (enzyme action system is as shown in table 4,37 DEG C, reaction 1h) the carrier DNA double-stranded DNA Oligo good with purification be connected, spend the night in 16 DEG C of connections in suitable buffer system (linked system is as shown in table 5), reclaim and connect product.By fresh competent escherichia coli cell (conversion operation reference: Molecular Cloning: A Laboratory guide second edition 55-56 page) prepared by connection product conversion calcium chloride.Growing bacterium clone surface at connection converted product is stained with, and be dissolved in 10 μ lLB culture medium, mixing gets 1 μ l as template; The upstream and downstream of RNAi sequence, designs general PCR primer forward primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQIDNO:52) in slow virus carrier; Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQIDNO:53), carries out PCR identification experiment (, as table 6-1, reaction condition is as table 6-2 for PCR reaction system).The clone positive to PCR qualification checks order and compare of analysis, and the clone that comparison is correct is the RNAi carrier containing SEQIDNO:35 successfully constructed, called after PAK7-shRNA-plasmid.
Build Scr-shRNA-plasmid negative control plasmids, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQIDNO:54).When building Scr-shRNA-plasmid negative control plasmids, for double-stranded DNA Oligo sequence (table 3) of Scr (scramble) siRNA target spot synthesis two ends containing AgeI and EcoRI restriction enzyme site cohesive end, all same PAK7-shRNA-plasmid of all the other construction methods, authentication method and condition.
Table 3 two ends are containing the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
By the carrier of T4DNA ligase by double digestion linearisation (enzyme action system is as shown in table 4,37 DEG C, reaction 1h)
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
Reagent | Volume (μ l) |
PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
10×buffer | 5.0 |
100×BSA | 0.5 |
Age I(10U/μl) | 1.0 |
EcoR I(10U/μl) | 1.0 |
ddH 2O | 40.5 |
Total | 50.0 |
Table 5 carrier DNA and double-strand double-stranded DNA Oligo coupled reaction system
Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connecting groups (μ l) |
Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
10 × T4 phage DNA ligase buffer | 1.0 | 1.0 | 1.0 |
T4 phage DNA ligase | 1.0 | 1.0 | 1.0 |
ddH 2O | 16.0 | 17.0 | 16.0 |
Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
Reagent | Volume (μ l) |
10×buffer | 2.0 |
dNTPs(2.5mM) | 0.8 |
Forward primer | 0.4 |
Downstream primer | 0.4 |
Taq polymerase | 0.2 |
Template | 1.0 |
ddH 2O | 15.2 |
Total | 20.0 |
Table 6-2PCR reaction system program setting
2. pack PAK7shRNA slow virus
Extract the DNA of RNAi plasmid PAK7-shRNA-plasmid with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.24h before transfection, with the HEKC 293T cell of trypsinization exponential phase, with the DMEM complete medium adjustment cell density containing 10% hyclone for 1.5 × 10
5cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO
2cultivate in incubator.Transfection is can be used for when cell density reaches 70%-80%.2h before transfection, the original culture medium of sucking-off, adds the complete medium that 1.5ml is fresh.According to the explanation of the MISSIONLentiviralPackagingMix test kit of Sigma-aldrich company, PackingMix (PVM) 20 μ l is added in a sterile centrifugation tube, PEI12 μ l, plasma-free DMEM medium 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed liquor.Above-mentioned transfection mixture is at room temperature hatched 15min, is transferred in the culture medium of HEKC 293T cell, 37 DEG C, 5%CO
216h is cultivated in incubator.Discard the culture medium containing transfection mixture, PBS solution is washed, and adds complete medium 2ml, continues to cultivate 48h.Collecting cell supernatant, CentriconPlus-20 centrifugal ultrafiltration unit (Millipore) purification and concentrated slow virus, step is as follows: (1) 4 DEG C, the centrifugal 10min of 4000g, removing cell debris; (2) 0.45 μm of frit supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, 10-15min, to the viral concentration volume needed; (4), after centrifugal end, filter cup and filtered solution collection cups are below separated, tipped upside down on by filter cup on sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from sample collection cup, in sample collection cup, be viral concentration liquid.By after viral concentration liquid subpackage in-80 degrees Celsius of preservations.The siRNA sequence contained in viral concentration liquid is SEQIDNO:51.The packaging process of contrast slow virus ScrshRNA, with PAK7-shRNA slow virus, only replaces PAK7-shRNA-plasmid carrier with Scr-shRNA-plasmid carrier.
Embodiment 2: real-time fluorescence quantitative RT-PCR method detects the silence efficiency of PAK7 gene
Be in the people pulmonary carcinoma H1299 cell of exponential phase, people gastric cancer SGC7901 cell and glioma U251 cell and carry out trypsinization, (cell number is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach about 30%.According to infection multiplicity (MOI of H1299 and U251 cell is the MOI of 10, SGC7901 is 20) value, virus prepared by the embodiment 1 adding Sq, cultivates replaced medium after 24h, after time of infection reaches 5 days, and collecting cell.According to the Trizol operating instruction of Invitrogen company, extracted total RNA.According to the M-MLV operating instruction of Promega company, RNA reverse transcription is obtained cDNA (in table 7,42 DEG C are reacted 1h to reverse transcription reaction system, and then water-bath 10min makes reverse transcriptase inactivation in 70 DEG C of water-baths).
TP800 type RealtimePCR instrument (TAKARA) is adopted to carry out Real_time quantitative detection.The primer of PAK7 gene is as follows: forward primer 5 '-CCGATACTACTGCTGACTACAC-3 ' (SEQIDNO:55) and downstream primer 5 '-GCTCTCTGATACTCCCACTTG-3 ' (SEQIDNO:56).With house-keeping gene GAPDH for internal reference, primer sequence is as follows: forward primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQIDNO:57) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQIDNO:58).By the proportional arrangement reaction system in table 8.
Table 7 reverse transcription reaction system
Reagent | Volume (μ l) |
5×RT buffer | 4.0 |
10mM dNTPs | 2.0 |
RNasin | 0.5 |
M-MLV-RTase | 1.0 |
DEPC H 2O | 3.5 |
Total | 11.0 |
Table 8Real-timePCR reaction system
Reagent | Volume (μ l) |
SYBR premix ex taq: | 10.0 |
Forward primer (2.5 μMs): | 0.5 |
Downstream primer (2.5 μMs): | 0.5 |
cDNA | 1.0 |
ddH 2O | 8.0 |
Total | 20.0 |
Setting program is two-step method Real-timePCR: denaturation 95 DEG C, 15s; Each step degeneration 95 DEG C afterwards, 5s; Annealing extension 60 DEG C, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR terminates, 95 DEG C of degeneration 1min, are then cooled to 55 DEG C, and DNA double chain is fully combined.To 95 DEG C from 55 DEG C, each walks increase by 0.5 DEG C, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2-
Δ Δ Ctanalytic process calculates and has infected the gene expression abundance of PAK7mRNA.Infect the cell of contrast virus (ScrshRNA) in contrast.Experimental result (Fig. 2) shows, in people pulmonary carcinoma H1299 cell, people gastric cancer SGC7901 cell and glioma U251 cell, the expression of PAK7mRNA has lowered 85.7%, 66.9% and 67.1% (the results are shown in Figure 2, p < 0.05).
Embodiment 3: detect the multiplication capacity infecting the tumor cell of PAK7shRNA slow virus
Be in the people pulmonary carcinoma H1299 cell of exponential phase, gastric cancer SGC7901 cell and glioma U251 cell and carry out trypsinization, (cell number is about 5 × 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach about 30%.According to infection multiplicity, (MOI of H1299 and U251 cell is 10, the MOI of SGC7901 is 20), add the PAK7shRNA virus of Sq, replaced medium after cultivation 24h, after time of infection reaches 5 days, collect each experimental group cell being in exponential phase.The resuspended one-tenth cell suspension (2 × 10 of complete medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Often organize 5 multiple holes, every hole 100 μ l.After completing plate, put 37 DEG C, 5%CO
2incubator is cultivated.From after bed board second day, every day was detected with CellomicsArrayScanVTI High content screening analyser (ThermoFisher) and reads plate once, and continuous detecting reads plate 5 days.By adjusting the input parameter of Cellomicsarrayscan, calculating the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, statistics being carried out to data and draws, draw cell proliferation curve (result as shown in Figure 3).Result shows, after people pulmonary carcinoma H1299 cell, gastric cancer SGC7901 cell and glioma U251 cell that PAK7shRNA slow virus is infected cultivate 5 days in vitro, vigor cell number have dropped 45.5%, 49.0% and 68.4% respectively, shows that PAK7 gene silencing causes tumor cell proliferation ability suppressed.
The test of PAK7 gene overexpression in embodiment 4 tumor cell
Tissue samples: people's pulmonary carcinoma and stomach organization sample
PAK7 antibody: available from Sigma
Test method:
Take out organization chip, organization chip is toasted 30 minutes in 60 DEG C of calorstats.Then to organization chip dewaxing, dewaxing process is: dimethylbenzene 15 minutes, dimethylbenzene: ethanol=1: in 1 mixed liquid, in dehydrated alcohol, in 95% ethanol, in 85% ethanol, in 75% ethanol, soak 10 minutes successively in distilled water; Then fresh 3%H is configured with distilled water or PBS
2o
2, room temperature closes 10 minutes; Organization chip is put into by antigen retrieval high fire heating 0.01M sodium citrate buffer (pH6.0) in microwave oven to boiling, and low fire maintains 20 minutes; After naturally cooling to room temperature, insert in distilled water and soak 10 minutes; 10% serum (TBS preparation) closes 30 minutes; Serum is abandoned in suction, does not wash and adds PAK7 antibody (1: 100 dilution) overnight incubation; TBS washes 2 times, each 5 minutes; The goat-anti rabbit two adding HRP labelling resists, incubated at room 60 minutes; TBS washes 4 times, each 5 minutes; Add DAB dyeing, until aobvious light yellow, put into distilled water cessation reaction; 30 seconds are soaked, clear water rinsing 7-8 time with Lignum Sappan; Dehydration mounting, in 75% ethanol, 85% ethanol, 95% ethanol, dehydrated alcohol, dimethylbenzene: ethanol=1: 1 mixed liquid, in dimethylbenzene, leaching puts 5 minutes successively; After taking-up, drip 30ul neutral gum, use coverslip mounting, dry, observed result, take pictures, result as shown in Figure 6.
Result shows:
Use PAK7 antibody to carry out Immunohistochemical Expression detection to pulmonary carcinoma and stomach organization, found that, in pulmonary carcinoma and cancerous lung tissue sample, the high expressed of PAK7 gene coded protein can be found.The representative of figure Oxford gray is expressed positive.Based on this experimental result, think and carry out auxiliary diagnosis cancer by the expression detecting histiocyte PAK7 gene.
Claims (11)
1. the purposes of people PAK7 gene in preparation or screening anti-tumor medicine, described people PAK7 gene is specially preparing the purposes in anti-tumor medicine: to be applied to for the action target of tumor cell as medicine or preparation by people PAK7 gene and to prepare anti-tumor medicine or preparation, people PAK7 gene is produced the target of RNA interference effect as medicine or preparation for tumor cell by described specifically being referred to as medicine or preparation for the action target of tumor cell by people PAK7 gene, target sequence is SEQIDNO:35, thus the expression of tumor cell people PAK7 gene can be reduced, the purposes of described people PAK7 gene in screening anti-tumor medicine is specially: screened as action target medicine or preparation by people PAK7 gene, target sequence is SEQIDNO:35, can suppress or promote that the medicine of people PAK7 gene expression is as oncotherapy drug candidate to find, described tumor is selected from: pulmonary carcinoma, gastric cancer and glioma.
2. the people PAK7 gene small molecules interference RNA target fragments be separated, its sequence is SEQIDNO:35.
3. a people PAK7 gene small molecules interference RNA, can the expression of specificity reticent people PAK7 gene, the target sequence of described people PAK7 gene small molecules interference RNA reticent people PAK7 gene expression using the sequence of SEQIDNO:35 as specificity, described people PAK7 gene small molecules interference RNA comprises just RNA fragment and antisense RNA fragment, described just RNA fragment and the complementation of described antisense RNA fragment, described just RNA fragment contains the RNA of SEQIDNO:35 sequential coding.
4. people PAK7 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, described people PAK7 gene small molecules interference RNA is hair clip type single stranded RNA, is separated in the middle of described just RNA fragment and described antisense RNA fragment by stem ring plate section.
5. people PAK7 gene small molecules interference RNA as claimed in claim 4, it is characterized in that, the sequence of described stem ring plate section is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.
6. people PAK7 gene small molecules interference RNA as claimed in claim 3, it is characterized in that, the sequence of described people PAK7 gene small molecules interference RNA is SEQIDNO:51.
7. a people PAK7 Gene interfere nucleic acid construct, comprises the genetic fragment of people PAK7 gene small molecules interference RNA described in the arbitrary claim of coding claim 3-6, can express people PAK7 gene small molecules interference RNA.
8. people PAK7 Gene interfere nucleic acid construct as claimed in claim 7, is characterized in that, described people PAK7 Gene interfere nucleic acid construct behaviour PAK7 Gene interfere slow virus carrier.
9. people PAK7 Gene interfere nucleic acid construct as claimed in claim 8, it is characterized in that, described slow virus carrier is selected from:
pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、
pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-TagCFP、
pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-TagFP635、
pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-1xLacO、
pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、
pLenti6/BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、
Arbitrary in pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
10. a people PAK7 Gene interfere slow virus, by people PAK7 Gene interfere nucleic acid construct described in the arbitrary claim of claim 7-9 slow virus packaging plasmid, cell line auxiliary under, form through virus packaging.
11. 1 kinds of pharmaceutical compositions, people PAK7 Gene interfere slow virus described in people PAK7 gene small molecules interference RNA or claim 10 described in the arbitrary claim of claim 3-6 containing treatment effective dose, and pharmaceutically acceptable carrier, diluent or excipient.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110425877.1A CN102552937B (en) | 2011-12-19 | 2011-12-19 | The purposes of people PAK7 gene and related drugs thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110425877.1A CN102552937B (en) | 2011-12-19 | 2011-12-19 | The purposes of people PAK7 gene and related drugs thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102552937A CN102552937A (en) | 2012-07-11 |
CN102552937B true CN102552937B (en) | 2016-01-06 |
Family
ID=46400385
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201110425877.1A Active CN102552937B (en) | 2011-12-19 | 2011-12-19 | The purposes of people PAK7 gene and related drugs thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102552937B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103623426B (en) * | 2012-08-29 | 2019-03-12 | 上海吉凯基因化学技术有限公司 | The purposes and its related drugs of people's PPP5C gene |
CN107083428B (en) * | 2017-04-10 | 2020-09-25 | 徐州医科大学 | Application of PAK5 in cancer diagnosis prognosis treatment and drug screening |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1923276A (en) * | 2005-09-02 | 2007-03-07 | 上海睿星基因技术有限公司 | Important regulation protein PAK7 of NF[kappa]B signal path |
-
2011
- 2011-12-19 CN CN201110425877.1A patent/CN102552937B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1923276A (en) * | 2005-09-02 | 2007-03-07 | 上海睿星基因技术有限公司 | Important regulation protein PAK7 of NF[kappa]B signal path |
Non-Patent Citations (4)
Title |
---|
A role for p21-activated kinase 7 in the development of gastric cancer;Jun Gu等;《FEBS Journal》;20130131;第280卷;46-55 * |
Combined inhibition of PAK7, MAP3K7 and CK2a kinases inhibits the growth of MiaPaCa2 pancreatic cancer cell xenografts;V Giroux等;《Cancer Gene Therapy》;20090410;第16卷;731页,摘要;732页左栏第2段至739页右栏第2段,图1-6 * |
P21-activated kinase 5 is overexpressed during colorectal cancer progression and regulates colorectal carcinoma cell adhesion and migration;Wei Gong等;《Int. J. Cancer》;20091231;第125卷;548页,摘要 * |
Targeted genetic dependency screen facilitates identification of actionable mutations in FGFR4, MAP3K9, and PAK5 in lung cancer;Shameem Fawdar等;《PNAS》;20130723;第110卷(第30期);12426-12431 * |
Also Published As
Publication number | Publication date |
---|---|
CN102552937A (en) | 2012-07-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
CN104225619B (en) | The purposes and its related drugs of people's ILK gene therapy tumours | |
CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
CN103667430A (en) | Application and relevant medicament of nucleotide octamer binding protein expression gene | |
CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
CN103667422A (en) | Use and related medicament of human CUL4B gene | |
CN103421887B (en) | The purposes and its related drugs of CIT gene | |
CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
CN105803053A (en) | Uses and related drugs of human RBM17 gene | |
CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CP01 | Change in the name or title of a patent holder | ||
CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |