CN1923276A

CN1923276A - Important regulation protein PAK7 of NF[kappa]B signal path

Info

Publication number: CN1923276A
Application number: CN 200510029343
Authority: CN
Inventors: 秦燕; 孙筱清; 罗楹; 吴骏
Original assignee: Shanghai Genomics Inc
Current assignee: Shanghai Genomics Inc
Priority date: 2005-09-02
Filing date: 2005-09-02
Publication date: 2007-03-07

Abstract

The invention relates to an important regulation protein of NFkB signal path, especially a method for suppressing cell apoptosis, influencing cell frame, accelerating cell accretion and growth through screening NFkB signal path.

Description

The important regulation protein PAK7 of NF κ B signal path

Technical field

The present invention relates to the important regulation protein of NF κ B signal path, relate in particular to a kind of screening and suppress apoptosis by influencing NF κ B signal path, influence the method that cytoskeleton forms, promotes the g and D of cell.

Background technology

Gene functional research because of its secret that can disclose human health and disease on the molecule aspect, is sought out most important Disease-causing gene, determines that can gene become the committed step of medicine target and become.External large-scale pharmaceutical factory finds, though depend merely on the gene order data and analysis of biological information can find a large amount of potential drug target spot genes, this genoid can only be classified as " low quality " medicine target.The drug development personnel press for a large amount of gene functional research and are verified in the face of the low quality medicine target of huge amount becomes at a loss as to what to do, just can filter out new drug development reliable " high-quality " target spot.So huge using value and commercial promise are being contained in functional genomics research.

Can be used as 5 of target spot at present, in 000 gene, the sequence of phosphokinase (kinase) has very big conservative, is the drug screening gene target spot of generally acknowledging, is referred to as a class target spot with phosphatase (phosphatase), protease (protease) and each receptoroid.Phosphokinase (kinase) with the phosphide group-transfer of ATP or GTP position to substrate gal4 amino acid residue, the catalytic proteins phosphorylation.Proteinic phosphorylation and dephosphorylation are that protein is regulated its function/active a kind of important way.As MAPK and transcription factor CREB, Jun etc. have activity, and do not have activity when the non-phosphorylating states when phosphorylation state; Transcription factor IkBa etc. are then opposite, do not have activity when phosphorylation state, and have activity when the non-phosphorylating state.

Proteinic phosphorylation-dephosphorylation is the important step in the cell signalling process.Cell signalling is that phalangeal cell is by being positioned at after birth or born of the same parents' receptor, the stimulation of receptor cell external information molecule, conversion through the intracellular signal transduction system of complexity, bring into play biological effect, and then almost regulating all processes of vital movement, comprise propagation, growth and the differentiation of cell, neural activity, muscle contraction, metabolism, tumor generation etc.Human a lot of disease is all closely related with signal transduction pathway, in the inflammatory reaction that causes at tumor necrosis factor (TNF), tumor necrosis factor activates interaction between a series of protein phosphatase kinases by bind receptor, finally activates NF κ B and the reaction that causes inflammation.Biochemist and many companies are all disclosing the key position of signal transmission path by the interaction between the research albumen, and develop the medicine that influences the signal transmission, to reach the purpose of treatment disease.The phosphorylation that depends on the multiple protein substrate smoothly of signal transduction process comprises tyrosine phosphorylation, threonine residues phosphorylation and serine residue phosphorylation, and this process is finished by phosphokinase catalysis just.

In view of the important even conclusive effect of signal transduction pathway in cell proliferation, differentiation and multiple disease generating process, and phosphokinase is in the extremely important status of signal transduction pathway, design and exploitation are the new drug of target spot with the phosphokinase, by adjusting, control signal transduction path treatment disease, be undoubtedly a kind of with strong points, desirable approach efficiently, have the potential prospect of the multiple disease of treatment.Comprise PKC active regulator, PKA inhibitor, ptk inhibitor and receptor-mediated calcium channel modulators etc. at kinase whose medicine at present, wherein part has entered clinical trial.But existing kinases drug target still can not satisfy human Fighting Disease far away, capture the demand of tumor, and this area still needs more special, more effective new kinases as the medicine target, thereby the approach of effective broadening treatment disease is promoted human beings'health.

PAK7 has another name called PAK5, is exactly that we utilize clone's platform that our company set up and a kinases that new function is not bright that obtains.It has complete kinases territory and GTPase in conjunction with the territory, belongs to silk/Soviet Union's kinase amino acid-PAK family (p21-activated protein kinases, the activated protease of p21, Paks) member of second family.PAK family combines with RAC/CDC42 GTPase in the presence of GTP and is activated, and might participate in the adjusting of cytoskeleton power, and is relevant with cell proliferation and cells survival signal etc.

But PAK7 and PAK4 as second family, PAK6 is the same, the regulation and control of its kinase activity might be regulated and control with RAC/CDC42 GTPase mode with different, and, PAK7 is high expressed in the mammal cerebral tissue, and in other most tissues, do not express, estimate that it participates in the advolution of neural dendron.But for PAK7 is how to participate in and exercise these functions, does not see bibliographical information.

NF κ B can activate anti-accent of many participations and die the expression of inflammation and immunoreactive important gene.The modulin that searching can be regulated and control NF κ B signal conduction has become a focus of current excavation drug target, and the bio-engineering corporation of several U.S. maximum that comprises Genentech, Amgen/Immunex and Tularik is all at the molecular compound of screening regulation and control NF κ B signal transduction path.It is worthy of note especially, utilize NF κ B antagonism to transfer the activation of the gene of dying also can be used in the partner treatment (avoiding) of tumor normal histiocytic damage.

Summary of the invention

We have found the activity of the stimulation NF κ B that PAK7 can be very strong first.PAK7 might regulate and control some gene transcription by the signal path of NF κ B, thereby the accent that suppresses cell is died and influence the formation of cytoskeleton, the g and D of promotion cell.Because PAK7 is high expressed in human brain tissue only, the growth of prompting PAK7 and brain tissue cell, anti-transfer die, and the function signal conduction closely related, this is important to be found to be the function of the thorough PAK7 of research and even to develop new drug target on this basis and lay a good foundation.

Therefore, one aspect of the present invention relates to a kind of PAK7 albumen of novelty, and it has the aminoacid sequence shown in SEQ ID NO:2.

On the other hand, the present invention relates to a kind of pharmaceutical composition, it contains the PAK7 albumen shown in the SEQ ID NO:2 or its conservative variation polypeptide and pharmaceutically acceptable carrier.

On the other hand, the present invention relates to the proteic purposes of PAK7, be used to prepare medicine with NF κ B passage diseases associated.In one embodiment, described disease is inflammation or tumor.

On the other hand, the present invention relates to the proteic purposes of PAK7, be used to screen the material that influences the NF kB activity by it.

On the one hand, the present invention relates to a kind of screening and pass through the method that PAK7 albumen influences the material of NF κ B expression, described method comprises:

(1) under the condition that is suitable for the PAK7 expression, PAK7 is transfected in the host cell, adds determinand simultaneously, as the test group; Under similarity condition, PAK7 is transfected in the host cell, do not add determinand, organize A in contrast; Under similarity condition, determinand is added in the host cell, organize B in contrast;

(2) observe the variation of NF kB activity in each group, test group NF kB activity is active apparently higher than control group A and matched group B statistically, shows that this tester by the expression that PAK7 has stimulated NF κ B, is agonist; Test group NF kB activity is starkly lower than control group A and matched group B's statistically, shows that this determinand by the expression that PAK7 has suppressed NF κ B, is antagonist.

In a preferred embodiment, described host cell is the 293T cell.

In another preferred embodiment, described method also comprises, observes the expression of NF κ B in the host cell that untransfected PAK7 do not add determinand yet, as the blank group.

In a preferred embodiment, the step of the inventive method (2) is to realize that by the expression of observing luciferase described luciferase is under the control of NF κ B transcription factor.

In another embodiment, use adding to have the PAK7 mutant of K478A sudden change as another matched group.

Description of drawings

Fig. 1 shows that the ATP-binding site K478 in the kinases territory of PAK7 becomes A through the improved expression that suddenlys change.Express the same normal with wild type (wt).

Fig. 2 demonstration is carried out the correlated result of homology to coding region and the mice gene order of people PAK7, and its homology reaches 94%.Among the figure, " Homo Sapiens " refers to people's PAK7 coding region, and " mus musculus " refers to the gene order of mice.

Fig. 3 shows PAK7 influence to the NF kB activity in the 293t cell." mock " refers to negative control among the figure, vertical coordinate " LUC " expression uciferase activity.

The specific embodiment

PAK7 albumen and coded sequence thereof are shown in SEQ ID NO:2 and 1.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide.Polypeptide of the present invention can be the product of natural purification, or the product of chemosynthesis, or uses recombinant technique to produce from protokaryon or eucaryon host (for example, antibacterial, yeast, higher plant, insecticide and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivant and the analog of PAK7.As used herein, term " fragment ", " derivant " are meant with " analog " and keep identical biological function of natural PAK7 of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivant or analog can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino acid residue, and the amino acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another chemical compound (such as the chemical compound that prolongs the polypeptide half-life, Polyethylene Glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as targeting sequencing or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purification or fusion rotein).According to the instruction of this paper, these fragments, derivant and analog belong to the known scope of those skilled in the art.

In the present invention, term " PAK7 " refers to have the active SEQ ID of PAK7 NO:2 polypeptide of sequence.This term also comprises having and the variant form PAK7 identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and at C-terminal and/or N-terminal interpolation one or several (being generally in 20, preferably is in 10, more preferably is in 5) aminoacid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar aminoacid of performance.Again such as, add one or several aminoacid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises active fragment and the reactive derivative of PAK7.

The variant form of polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of the DNA hybridization of PAK7 and the polypeptide or the albumen that utilize the antiserum of anti-PAK7 to obtain.The present invention also provides other polypeptide, as comprises PAK7 or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of PAK7.Usually, this fragment have the PAK7 sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analog of PAK7 or polypeptide.The difference of these analog and natural PAK7 can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic agent and produce random mutagenesis, also can pass through direct mutagenesis method or the biological technology of other known moleculars.Analog also comprises having the analog that is different from the amino acid whose residue of natural L-(as D-aminoacid), and has non-natural analog that exist or synthetic aminoacid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylation or carboxylated of the polypeptide that body is interior or external.Modify and also comprise glycosylation.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as phosphotyrosine, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-Proteolytic enzyme performance or optimized solubility property by modifying.

In the present invention, " PAK7 conservative variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 aminoacid is replaced by similar performance or close aminoacid and is formed polypeptide at the most best.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic DNA or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the variant of degeneracy.As used herein, " variant of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence of an encoding mature polypeptide; The coded sequence of mature polypeptide and various additional code sequence; Coded sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to the variant of above-mentioned polynucleotide, it is encoded fragment, analog and the derivant of the polypeptide or the polypeptide of identical aminoacid sequence with the present invention.The variant of these polynucleotide can be the allelic variant of natural generation or the variant that non-natural takes place.These nucleotide diversity bodies comprise and replace variant, deletion mutation body and insert variant.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the higher temperature and eluting, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturant, as 50% (v/v) Methanamide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 nucleotide at least, better is at least 30 nucleotide, is more preferably at least 50 nucleotide, preferably more than at least 100 nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding PAK7.

PAK7 nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of conventional method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence than long time, usually need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies be stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by conventional method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small fragments, and then connect and to obtain the very long fragment of sequence.

At present, can be fully obtain the DNA sequence of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This DNA sequence can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetic engineering with carrier of the present invention or PAK7 coded sequence, and the method that produces polypeptide of the present invention through recombinant technique.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the PAK7 of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or variant) of coding of the present invention PAK7, or with the recombinant expression carrier that contains these polynucleotide proper host cell that transforms or transduce;

(2). the host cell of in proper culture medium, cultivating;

(3). separation, protein purification from culture medium or cell.

Among the present invention, the PAK7 polynucleotide sequence can be inserted in the recombinant expression carrier.Term " recombinant expression carrier " refers to bacterial plasmid well known in the art, phage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain origin of replication, promoter, marker gene and translation control element usually.

Method well-known to those having ordinary skill in the art can be used to make up and contains PAK7 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technique of body etc.Described DNA sequence can effectively be connected on the suitable promoter in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome binding site and the transcription terminator that translation initiation is used.

The present invention also provides a kind of pharmaceutical composition, and it comprises PAK7 albumen of the present invention or its coded sequence, and pharmaceutically acceptable carrier.When giving this pharmaceutical composition, can strengthen the expression of NK κ B, thereby realization suppresses apoptosis, influences the purposes such as g and D that cytoskeleton forms, promotes cell.

Pharmaceutical composition can be prepared into various dosage forms, as granule, tablet, capsule, suspension, spraying, suppository, transdermal drug (as paster etc.), ointment, lotion etc.

In addition, the preparation of pharmaceutical composition of the present invention also can contain other composition, comprises as adjuvant, stabilizing agent, pH regulator agent, antiseptic etc.These compositions are that the vaccine those skilled in the art are known.

Usually, the routine of administration and pharmaceutically acceptable approach comprise: intranasal, intramuscular, trachea are interior, subcutaneous, in the Intradermal, lung, intravenous, per nasal, oral administration or other parenteral approach.If desired can the combination medicine-feeding approach.

Pharmaceutical composition can single dose or multiple dose give.The dosage that gives should be enough to cause the expression of enough NF kB activities.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment

The acquisition of embodiment 1.PAK7 gene

We are from, the cDNA library of having set up without any functional annotation or note incomplete " newly " gene synthetic by the est sequence the Genebank, using modern bioinformatics PFAM/Profile pattern preferentially screens phosphokinase, phosphatase, protease, single membrane receptor of crossing, obtain a gene that does not have functional annotation, contain the phosphokinase domain, be PAK7.In order to obtain the total length of PAK7 gene, we have designed following primer, and mixing RNA with tissue is template, increases by conventional PCR method.

Forward primer (SEQ ID NO:3):

5’ACGCTGGCCAATCCGGCCATGTTTGGGAAGAAAAAGAAAAAGATTGAAATATCTGG?3’

Downstream primer (SEQ ID NO:4):

5’ACGCTGGCCTCTAACGGCCTCAGTGATGCCTGTATTGTCTCATGAGGGG?3’

This contains SfiI shuttle back and forth cloning site, start codon and termination codon to primer, is the coded sequence of PAK7 between this restriction enzyme site.Utilize this that primer PCR amplification has been obtained the band that a size is about 2.1kb, this segment is reclaimed, is cloned into the full length sequence that order-checking behind the carrier obtains the PAK7 gene, 2160bp altogether.

Embodiment 2.PAK7 and do not have the protein expression of kinase activity form

The sequence of the 2160bp that embodiment 1 is obtained is shown in SEQ ID NO:1, and wherein the 1-2157 position is the complete coding region of PAK7 gene, the protein of forming by 719 aminoacid of encoding, and aminoacid sequence is shown in SEQ ID NO:2.According to sequence analysis, kinase domain ATP-binding site K478 is become A (this paper also is expressed as K478A), make its forfeiture kinase activity (for further research function is done the basis, adopt the design mutant primer, through PCR, sub-clone obtains) Western-Blot that expresses the (see figure 1) routine by transient transfection (calcium phosphate, conventional method are seen molecular cloning) in mammalian cell detects its expression.People's coding region and mice gene order are carried out the homology comparison, and homology reaches 94% (Fig. 2) (Bioedit Sequence Alignment Editor).

The Function Identification of embodiment 3.PAK7 gene

Utilize the wild type or the ATP-binding site saltant of reporter gene systematic study overexpression PAK7 gene in the 293T cell.Plasmid (NF κ B-Luc) and PAK7, PAK7ATP binding site saltant cotransfection (fugen 6 lipofectamine (deriving from Roche) to the 293T cell of luciferase gene that will contain the binding site of NF κ B, DNA: liposome=1: 5), the activity of its luciferase can obtain after 24 hours in transfection.Add the luciferase substrate after the lysis, detect.Every group of experimental data independence triplicate is above in the hope of meansigma methods.The result is influential at the NF kB activity that the 293T transit cell dyes the PAK7 gene pairs.

The result is presented among Fig. 3.Show among the figure that wild type PAK7 can greatly stimulate the activity of NF κ B, mutant form does not then stimulate the activity of NF κ B.

Embodiment 4. screenings influence the material that NF κ B expresses by PAK7 albumen

With the PAK7 transfection to the 293T cell that contains NF κ B-Luc stably express, with certain cell quantity (1-2 * 10 ⁵) bed board (96 orifice plate), medicine to be measured is added in the cell with the finite concentration gradient hatches, according to matched group, up flow type cell instrument analysis result.Can pass through the height of the power assessment medicine of luciferase (luciferase) fluorescence to 293T cell activation level, and with transfection PAK7 but do not add the host cell of determinand, and the host cell activity level under the same conditions that only adds determinand compares, and finds out promoter or inhibitor in the PAK7-NF κ B path.

Sequence table

＜110〉Shanghai Genomics

＜120〉the important regulation protein PAK7 of NF κ B signal path

<130>054240

<160>4

<170>PatentIn?version?3.1

<210>1

<211>2160

<212>DNA

＜213〉the proteic coded sequence of PAK7

<400>1

atgtttggga?agaaaaagaa?aaagattgaa?atatctggcc?cgtccaactt?tgaacacagg 60

gttcatactg?ggtttgatcc?acaagagcag?aagtttaccg?gccttcccca?gcagtggcac 120

agcctgttag?cagatacggc?caacaggcca?aagcctatgg?tggacccttc?atgcatcaca 180

cccatccagc?tggctcctat?gaagacaatc?gttagaggaa?acaaaccctg?caaggaaacc 240

tccatcaacg?gcctgctaga?ggattttgac?aacatctcgg?tgactcgctc?caactcccta 300

aggaaagaaa?gcccacccac?cccagatcag?ggagcctcca?gccacggtcc?aggccacgcg 360

gaagaaaatg?gcttcatcac?cttctcccag?tattccagcg?aatccgatac?tactgctgac 420

tacacgaccg?aaaagtacag?ggagaagagt?ctctatggag?atgatctgga?tccgtattat 480

agaggcagcc?acgcagccaa?gcaaaatggg?cacgtaatga?aaatgaagca?cggggaggcc 540

tactattctg?aggtgaagcc?tttgaaatcc?gattttgcca?gattttctgc?cgattatcac 600

tcacatttgg?actcactgag?caaaccaagt?gaatacagtg?acctcaagtg?ggagtatcag 660

agagcctcga?gtagctcccc?tctggattat?tcattccaat?tcacaccttc?tagaactgca 720

gggaccagcg?ggtgctccaa?ggagagcctg?gcgtacagtg?aaagtgaatg?gggacccagc 780

ctggatgact?atgacaggag?gccaaagtct?tcgtacctga?atcagacaag?ccctcagccc 840

accatgcggc?agaggtccag?gtcaggctcg?ggactccagg?aaccgatgat?gccatttgga 900

gcaagtgcat?ttaaaaccca?tccccaagga?cactcctaca?actcctacac?ctaccctcgc 960

ttgtccgagc?ccacaatgtg?cattccaaag?gtggattacg?atcgagcaca?gatggtcctc 1020

agccctccac?tgtcagggtc?tgacacctac?cccaggggcc?ctgccaaact?acctcaaagt 1080

caaagcaaat?cgggctattc?ctcaagcagt?caccagtacc?cgtctgggta?ccacaaagcc 1140

accttgtacc?atcacccctc?cctgcagagc?agttcgcagt?acatctccac?ggcttcctac 1200

ctgagctccc?tcagcctctc?atccagcacc?tacccgccgc?ccagctgggg?ctcctcctcc 1260

gaccagcagc?cctccagggt?gtcccatgaa?cagtttcggg?cggccctgca?gctggtggtc 1320

agcccaggag?accccaggga?atacttggcc?aactttatca?aaatcgggga?aggctcaacc 1380

ggcatcgtat?gcatcgccac?cgagaaacac?acagggaaac?aagttgcagt?gaagaaaatg 1440

gacctccgga?agcaacagag?acgagaactg?cttttcaatg?aggtcgtgat?catgcgggat 1500

taccaccatg?acaatgtggt?tgacatgtac?agcagctacc?ttgtcggcga?tgagctctgg 1560

gtggtcatgg?agtttctaga?aggtggtgcc?ttgacagaca?ttgtgactca?caccagaatg 1620

aatgaagaac?agatagctac?tgtctgcctg?tcagttctga?gagctctctc?ctaccttcat 1680

aaccaaggag?tgattcacag?ggacataaaa?agtgactcca?tcctcctgac?aagcgatggc 1740

cggataaagt?tgtctgattt?tggtttctgt?gctcaagttt?ccaaagaggt?gccgaagagg 1800

aaatcattgg?ttggcactcc?ctactggatg?gcccctgagg?tgatttctag?gctaccttat 1860

gggacagagg?tggacatctg?gtccctcggg?atcatggtga?tagaaatgat?tgatggcgag 1920

cccccctact?tcaatgagcc?tcccctccag?gcgatgcgga?ggatccggga?cagtttacct 1980

ccaagagtga?aggacctaca?caaggtttct?tcagtgctcc?ggggattcct?agacttgatg 2040

ttggtgaggg?agccctctca?gagagcaaca?gcccaggaac?tcctcggaca?tccattctta 2100

aaactagcag?gtccaccgtc?ttgcatcgtc?cccctcatga?gacaatacag?gcatcactga 2160

<210>2

<211>719

<212>PRT

＜213〉the proteic aminoacid sequence of PAK7

<400>2

Met?Phe?Gly?Lys?Lys?Lys?Lys?Lys?Ile?Glu?Ile?Ser?Gly?Pro?Ser?Asn

1 5 10 15

Phe?Glu?His?Arg?Val?His?Thr?Gly?Phe?Asp?Pro?Gln?Glu?Gln?Lys?Phe

20 25 30

Thr?Gly?Leu?Pro?Gln?Gln?Trp?His?Ser?Leu?Leu?Ala?Asp?Thr?Ala?Asn

35 40 45

Arg?Pro?Lys?Pro?Met?Val?Asp?Pro?Ser?Cys?Ile?Thr?Pro?Ile?Gln?Leu

50 55 60

Ala?Pro?Met?Lys?Thr?Ile?Val?Arg?Gly?Asn?Lys?Pro?Cys?Lys?Glu?Thr

65 70 75 80

Ser?Ile?Asn?Gly?Leu?Leu?Glu?Asp?Phe?Asp?Asn?Ile?Ser?Val?Thr?Arg

85 90 95

Ser?Asn?Ser?Leu?Arg?Lys?Glu?Ser?Pro?Pro?Thr?Pro?Asp?Gln?Gly?Ala

100 105 110

Ser?Ser?His?Gly?Pro?Gly?His?Ala?Glu?Glu?Asn?Gly?Phe?Ile?Thr?Phe

115 120 125

Ser?Gln?Tyr?Ser?Ser?Glu?Ser?Asp?Thr?Thr?Ala?Asp?Tyr?Thr?Thr?Glu

130 135 140

Lys?Tyr?Arg?Glu?Lys?Ser?Leu?Tyr?Gly?Asp?Asp?Leu?Asp?Pro?Tyr?Tyr

145 150 155 160

Arg?Gly?Ser?His?Ala?Ala?Lys?Gln?Asn?Gly?His?Val?Met?Lys?Met?Lys

165 170 175

His?Gly?Glu?Ala?Tyr?Tyr?Ser?Glu?Val?Lys?Pro?Leu?Lys?Ser?Asp?Phe

180 185 190

Ala?Arg?Phe?Ser?Ala?Asp?Tyr?His?Ser?His?Leu?Asp?Ser?Leu?Ser?Lys

195 200 205

Pro?Ser?Glu?Tyr?Ser?Asp?Leu?Lys?Trp?Glu?Tyr?Gln?Arg?Ala?Ser?Ser

210 215 220

Ser?Ser?Pro?Leu?Asp?Tyr?Ser?Phe?Gln?Phe?Thr?Pro?Ser?Arg?Thr?Ala

225 230 235 240

Gly?Thr?Ser?Gly?Cys?Ser?Lys?Glu?Ser?Leu?Ala?Tyr?Ser?Glu?Ser?Glu

245 250 255

Trp?Gly?Pro?Ser?Leu?Asp?Asp?Tyr?Asp?Arg?Arg?Pro?Lys?Ser?Ser?Tyr

260 265 270

Leu?Asn?Gln?Thr?Ser?Pro?Gln?Pro?Thr?Met?Arg?Gln?Arg?Ser?Arg?Ser

275 280 285

Gly?Ser?Gly?Leu?Gln?Glu?Pro?Met?Met?Pro?Phe?Gly?Ala?Ser?Ala?Phe

290 295 300

Lys?Thr?His?Pro?Gln?Gly?His?Ser?Tyr?Asn?Ser?Tyr?Thr?Tyr?Pro?Arg

305 310 315 320

Leu?Ser?Glu?Pro?Thr?Met?Cys?Ile?Pro?Lys?Val?Asp?Tyr?Asp?Arg?Ala

325 330 335

Gln?Met?Val?Leu?Ser?Pro?Pro?Leu?Ser?Gly?Ser?Asp?Thr?Tyr?Pro?Arg

340 345 350

Gly?Pro?Ala?Lys?Leu?Pro?Gln?Ser?Gln?Ser?Lys?Ser?Gly?Tyr?Ser?Ser

355 360 365

Ser?Ser?His?Gln?Tyr?Pro?Ser?Gly?Tyr?His?Lys?Ala?Thr?Leu?Tyr?His

370 375 380

His?Pro?Ser?Leu?Gln?Ser?Ser?Ser?Gln?Tyr?Ile?Ser?Thr?Ala?Ser?Tyr

385 390 395 400

Leu?Ser?Ser?Leu?Ser?Leu?Ser?Ser?Ser?Thr?Tyr?Pro?Pro?Pro?Ser?Trp

405 410 415

Gly?Ser?Ser?Ser?Asp?Gln?Gln?Pro?Ser?Arg?Val?Ser?His?Glu?Gln?Phe

420 425 430

Arg?Ala?Ala?Leu?Gln?Leu?Val?Val?Ser?Pro?Gly?Asp?Pro?Arg?Glu?Tyr

435 440 445

Leu?Ala?Asn?Phe?Ile?Lys?Ile?Gly?Glu?Gly?Ser?Thr?Gly?Ile?Val?Cys

450 455 460

Ile?Ala?Thr?Glu?Lys?His?Thr?Gly?Lys?Gln?Val?Ala?Val?Lys?Lys?Met

465 470 475 480

Asp?Leu?Arg?Lys?Gln?Gln?Arg?Arg?Glu?Leu?Leu?Phe?Asn?Glu?Val?Val

485 490 495

Ile?Met?Arg?Asp?Tyr?His?His?Asp?Asn?Val?Val?Asp?Met?Tyr?Ser?Ser

500 505 510

Tyr?Leu?Val?Gly?Asp?Glu?Leu?Trp?Val?Val?Met?Glu?Phe?Leu?Glu?Gly

515 520 525

Gly?Ala?Leu?Thr?Asp?Ile?Val?Thr?His?Thr?Arg?Met?Asn?Glu?Glu?Gln

530 535 540

Ile?Ala?Thr?Val?Cys?Leu?Ser?Val?Leu?Arg?Ala?Leu?Ser?Tyr?Leu?His

545 550 555 560

Asn?Gln?Gly?Val?Ile?His?Arg?Asp?Ile?Lys?Ser?Asp?Ser?Ile?Leu?Leu

565 570 575

Thr?Ser?Asp?Gly?Arg?Ile?Lys?Leu?Ser?Asp?Phe?Gly?Phe?Cys?Ala?Gln

580 585 590

Val?Ser?Lys?Glu?Val?Pro?Lys?Arg?Lys?Ser?Leu?Val?Gly?Thr?Pro?Tyr

595 600 605

Trp?Met?Ala?Pro?Glu?Val?Ile?Ser?Arg?Leu?Pro?Tyr?Gly?Thr?Glu?Val

610 615 620

Asp?Ile?Trp?Ser?Leu?Gly?Ile?Met?Val?Ile?Glu?Met?Ile?Asp?Gly?Glu

625 630 635 640

Pro?Pro?Tyr?Phe?Asn?Glu?Pro?Pro?Leu?Gln?Ala?Met?Arg?Arg?Ile?Arg

645 650 655

Asp?Ser?Leu?Pro?Pro?Arg?Val?Lys?Asp?Leu?His?Lys?Val?Ser?Ser?Val

660 665 670

Leu?Arg?Gly?Phe?Leu?Asp?Leu?Met?Leu?Val?Arg?Glu?Pro?Ser?Gln?Arg

675 680 685

Ala?Thr?Ala?Gln?Glu?Leu?Leu?Gly?His?Pro?Phe?Leu?Lys?Leu?Ala?Gly

690 695 700

Pro?Pro?Ser?Cys?Ile?Val?Pro?Leu?Met?Arg?Gln?Tyr?Arg?His?His

705 710 715

<210>3

<211>56

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

acgctggcca?atccggccat?gtttgggaag?aaaaagaaaa?agattgaaat?atctgg 56

<210>4

<211>49

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

acgctggcct?ctaacggcct?cagtgatgcc?tgtattgtct?catgagggg 49

Claims

1. a pharmaceutical composition is characterized in that, it contains the PAK7 albumen shown in the SEQ ID NO:2 or its conservative variation polypeptide and pharmaceutically acceptable carrier.

2.PAK7 proteic purposes is characterized in that, is used to prepare the medicine with NF κ B passage diseases associated.

3. purposes as claimed in claim 2 is characterized in that, described disease is inflammation or tumor.

4.PAK7 proteic purposes is characterized in that, is used to screen the material that influences the NF kB activity by this PAK7 albumen.

5. the method that PAK7 albumen influences the material of NF κ B expression is passed through in a screening, it is characterized in that described method comprises:

6. method as claimed in claim 5 is characterized in that, described host cell is the 293T cell.

7. method as claimed in claim 5 is characterized in that, described method also comprises, observes the expression of NF κ B in the host cell that untransfected PAK7 do not add determinand yet, as the blank group.

8. method as claimed in claim 5 is characterized in that, described step (2) is to realize that by the expression of observing luciferase described luciferase is under the control of NF κ B transcription factor.

9. method as claimed in claim 5 is characterized in that, uses adding to have the PAK7 mutant of K478A sudden change as another matched group.

10. PAK7 albumen, it has the aminoacid sequence shown in the SEQ ID NO:2.