CN1223607C - Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application - Google Patents
Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application Download PDFInfo
- Publication number
- CN1223607C CN1223607C CN 01113357 CN01113357A CN1223607C CN 1223607 C CN1223607 C CN 1223607C CN 01113357 CN01113357 CN 01113357 CN 01113357 A CN01113357 A CN 01113357A CN 1223607 C CN1223607 C CN 1223607C
- Authority
- CN
- China
- Prior art keywords
- cam
- kiin
- polypeptide
- cell
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to a novel calcium ion/calmodulin dependent protein kinase II inhibitor protein (CaM-KIIN). The present invention provides polynucleotide for coding the protein molecule and a method for generating the protein molecule by a recombination technology. The present invention also discloses purposes of the novel calcium ion/calmodulin dependent protein kinase II inhibitor protein and coding sequences thereof. The present invention also verifies that the CaM-KIIN can inhibit cell growth. The present invention also discloses a strategy for resisting the protein molecule and diagnosing and treating diseases especially cancers.
Description
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to new coding human calcium ion/calmodulin dependent protein kinase II repressible protein (Calcium/Calmodulin-DependentProtein Kinase II Inhibitor, abbreviate " CaM-KIIN " as) polynucleotide of polypeptide, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.The invention still further relates to the inhibition activity of CaM-KIIN cell growth.CaM-KIIN of the present invention is a soluble proteins in a kind of new cell relevant with cell proliferation, growth and cell cycle signal.
Background technology
Calcium ion/calmodulin dependent protein kinase II (CaMKII) is a kind of multi-functional serine/threonine protein kitase, is an important component part of signal transducting system in the cell, is Ca
2+/ CaM regulates a main member in the protein family.CaMKII is one of important target enzyme of CaM, and many enzymes or protein can be as its substrates.CaMKII is by α, beta, gamma, and four kinds of subunits of δ form more than the ten kind of isozyme of encoding.Nearly all subunit all includes catalytic domain, regulatory region and land, and regulatory region is again by self inhibitory area (281-309), calmodulin land (296-311) and autophosphorylation site (Threonine 286,305,306; Serine 314) forms.
CaMKII mainly is present in nervous tissue, can account for 2% (as the hippocampal gyrus of mouse) of total protein concentration in some zone.In addition, in the tissues such as brush border of mammalian skeleton flesh, heart, lung, liver, pancreas, retina, kidney, parathyroid gland, mammary gland, uterus, testis, small intestine, all can detect.The subunit of CaMKII distributes different because of tissue, and α and β subunit only are present in nervous tissue, and γ and delta-subunit can be present in other tissue except that brain.Along with going deep into that structure, tissue distribution and the biological function of CaMKII are studied, it is found that CaMKII all brings into play critical function in the various biological incident.It is regulating neuronic activity, the contraction of muscle, and the control of cell cycle, the secretion of cell, the repairing of dna damage, the metabolism of carbohydrate, there is important biological action aspects such as expression of gene.
The inhibitor of CaMKII is one of effective way of research CaMKII physiological function.The inhibitor of CaMKII has multiple, mainly contains inhibitor KN-62, KN-93, KN-92 and the biosynthetic inhibitory polypeptide AIP of chemosynthesis.The natural endogenous repressible protein of report only has the calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN β and the CaM-KIIN α in rat cerebral cell source at present.Domestic and international report is not then seen in the endogenous repressible protein in people source and biological function thereof and application.
The endogenous CaMKII repressible protein CaM-KIIN β in known rat source and CaM-KIIN α have specificity and suppress the active ability of CaMKII.The effect of CaMKII inhibitor KN-62, the KN-93 of chemosynthesis be by with the interaction of CaM binding site, stop combining of CaM and CaMKII, make that CaMKII can not autophosphorylation and be not activated.For the cells physiological function, the growth that the two can stop cell in the dose-dependently mode causes the retardance of cell cycle G1 or S phase, thereby causes cell generation apoptosis.KN-62 can also overcome the opposing of Proliferation of Human Ovarian Cell for a kind of antitumour drug (Zorubicin), and important effect is being arranged aspect the oncotherapy.This specific specificity of CaMKII inhibition agent suppresses the regulating effect that the active ability of CaMKII points out these materials may participate in tumor growth and transfer, becomes the effector of antineoplaston thus.
Research shows that calcium ion/calmodulin dependent protein kinase II repressible protein is relevant with multiple vital movement.Therefore, significant for the calcium ion/calmodulin dependent protein kinase II repressible protein of diagnosing and the therapeutic purpose research and development is new.Yet, but still do not have finder's calcium ion/calmodulin dependent protein kinase II repressible protein so far.
Summary of the invention
The purpose of this invention is to provide a kind of new human calcium ion/calmodulin dependent protein kinase II repressible protein (CaM-KIIN albumen) with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
The present invention has found novel human calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN through extensive and deep research, and the homologous protein that it and known rat are originated has high homology.Similar to the effect of chemical inhibitor pair cell, people source CaM-KIIN can check cell proliferation, has cell growth inhibiting activity.Therefore, can people source CaM-KIIN be the same with other inhibitor can be by specificity in conjunction with CaMKII, stop the phosphorylation of CaMKII to activate, regulate and control multiple physiology and pathology activity, play a significant role, and may be worth having important development and application aspect the immunodiagnosis in a plurality of fields such as anti-infective, anti-inflammatory response, antitumor and nerve growth reparation, immunologic function adjusting and the immunotherapy.
In a first aspect of the present invention, novel isolated CaM-KIIN polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 80% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people CaM-KIIN of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 179-415 position among the SEQ ID NO:1; (b) has the sequence of 1-591 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people CaM-KIIN protein-active, this method comprises: (a) under the proteic condition of suitable expressing human CaM-KIIN, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people CaM-KIIN protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people CaM-KIIN polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-591 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people CaM-KIIN polypeptide active is provided, and the compound that suppresses people CaM-KIIN polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people CaM-KIIN polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of CaM-KIIN in the test sample, it comprises: sample is contacted with the proteic specific antibody of CaM-KIIN, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaM-KIIN albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people CaM-KIIN polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people CaM-KIIN polypeptide active, and perhaps screening suppresses the antagonist of people CaM-KIIN polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people CaM-KIIN of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people CaM-KIIN polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, neural system and cardiovascular diseases.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the cDNA sequence of people CaM-KIIN of the present invention, and wherein non-coding sequence is represented with lowercase, and encoding sequence is with capitalizing conventional letter representation.
Fig. 2 is the proteic full length amino acid sequence of people CaM-KIIN of the present invention.
Fig. 3 is the originate amino acid sequence homology comparison diagram of other calcium ion/calmodulin dependent protein kinases II repressible protein of people CaM-KIIN albumen of the present invention and rat.The top sequence is people CaM-KIIN, and the below sequence is the CaM-KIIN albumen in rat source.Identical amino acid marks with black matrix between a plurality of sequences, and similar amino acid marks with grey body.
Fig. 4 is a people CaM-KIIN RT-PCR expression analysis collection of illustrative plates of the present invention.Prompting CaM-KIIN is expressed in some tumour cell; In the maturing dendritic cell in human peripheral blood mononuclear cell source and the reactivation process that stimulated by KLH, has the certain expression pattern.
Fig. 5 is the shown distribution plan of people CaM-KIIN Northern blot hybridization of the present invention.Prompting CaM-KIIN is a kind of molecule that distributes in particular organization.
Fig. 6 is the om observation photo of people CaM-KIIN transfectional cell of the present invention.Point out it to have cell growth inhibiting activity.
Fig. 7 is the analysis of cell proliferation experiment of people CaM-KIIN transfectional cell of the present invention.Point out it to have cell growth inhibiting activity.
Embodiment
In the present invention, term " CaM-KIIN albumen ", " CaM-KIIN polypeptide " or " calcium ion/calmodulin dependent protein kinase II repressible protein " are used interchangeably, and all refer to have the albumen or the polypeptide of human calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN aminoacid sequence (SEQ ID NO:2).They comprise the calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN that contains or do not contain initial methionine.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating CaM-KIIN albumen or polypeptide " is meant that the CaM-KIIN polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying CaM-KIIN albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people CaM-KIIN, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human CaM-KIIN albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people CaM-KIIN polypeptide " refers to have the SEQ IDNO.2 polypeptide of sequence of people CaM-KIIN protein-active.This term also comprises having and variant form people CaM-KIIN albumen identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-20, more preferably 1-10,1-5 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people CaM-KIIN and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people CaM-KIIN DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people CaM-KIIN polypeptide to obtain.The present invention also provides other polypeptide, as comprises people CaM-KIIN polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people CaM-KIIN polypeptide.Usually, this fragment have people CaM-KIIN peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, best at least about 70 continuous amino acids.
Invention also provides the analogue of people CaM-KIIN albumen or polypeptide.The difference of these analogues and natural human CaM-KIIN polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people CaM-KIIN albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding CaM-KIIN.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People CaM-KIIN Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or CaM-KIIN albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the CaM-KIIN polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people CaM-KIIN polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people CaM-KIIN polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people CaM-KIIN DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people CaM-KIIN albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism CaM-KIIN protein function as pharmacological agent CaM-KIIN protein function.The peptide molecule that can suppress or stimulate people CaM-KIIN protein function that can be used for seeking therapeutic value with the recombinant human CaM-KIIN protein screening peptide library of expressing.
On the other hand, the present invention also comprises people CaM-KIIN DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people CaM-KIIN gene product or fragment.Preferably, refer to that those can combine with people CaM-KIIN gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people CaM-KIIN, comprise that also those do not influence the antibody of people CaM-KIIN protein function.The present invention also comprise those can with modify or without the people CaM-KIIN gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people CaM-KIIN gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human CaM-KIIN albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Monoclonal antibody of the present invention can utilize hybridoma technology to prepare.Antibody of the present invention comprises the antibody that can block people CaM-KIIN protein function and the antibody that does not influence people CaM-KIIN protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people CaM-KIIN gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people CaM-KIIN gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people CaM-KIIN can be used in the immunohistochemistry technology, detects the people CaM-KIIN albumen in the biopsy specimen.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people CaM-KIIN albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people CaM-KIIN or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people CaM-KIIN albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell of people CaM-KIIN protein positive.
The production of polyclonal antibody can choose CaM-KIIN albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with CaM-KIIN albumen interactional material takes place, as part, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for the treatment of aspects such as tumour.When using CaM-KIIN albumen of the present invention, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains CaM-KIIN polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the CaM-KIIN albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people CaM-KIIN also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of CaM-KIIN of the proteic nothing expression of CaM-KIIN or unusual/non-activity.The CaM-KIIN albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic CaM-KIIN protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the CaM-KIIN transgenosis to cell.The method that structure carries the recombinant viral vector of CaM-KIIN gene is found in existing document (Sambrook, et al.).Recombinant human CaM-KIIN gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people CaM-KIIN mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people CaM-KIIN obtains.During screening, must carry out mark to people CaM-KIIN protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people CaM-KIIN protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people CaM-KIIN protein level that is detected in the test can be with laying down a definition the importance of people CaM-KIIN albumen in various diseases and be used to the disease of diagnosing CaM-KIIN albumen to work.
Whether having the proteic method of CaM-KIIN in a kind of detection test sample is to utilize the proteic specific antibody of CaM-KIIN to detect, and it comprises: sample is contacted with the CaM-KIIN protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaM-KIIN albumen.
The proteic polynucleotide of CaM-KIIN can be used for the diagnosis and the treatment of CaM-KIIN protein related diseases.Aspect diagnosis, the proteic polynucleotide of CaM-KIIN can be used for detecting the proteic expression of CaM-KIIN CaM-KIIN abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of CaM-KIIN as the CaM-KIINDNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of CaM-KIIN albumen and also can detect the proteic transcription product of CaM-KIIN.
The sudden change that detects the CaM-KIIN gene also can be used for the disease of diagnosing CaM-KIIN albumen relevant.The form of CaM-KIIN protein mutation comprises that the point mutation compared with normal wild type CaM-KIIN dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of CaM-KIIN prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritancein Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.Polynucleotide of the present invention are isolated from human dendritic cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 591 bases, and its open reading frame is positioned at the 179-415 position, and the coding total length is 79 amino acid whose people CaM-KIIN albumen (SEQ IDNO:2).This CaM-KIIN albumen belongs to calcium ion/calmodulin dependent protein kinase II repressible protein family molecule, calcium ion/calmodulin dependent protein kinase II repressible protein alpha (CaM-KIIN alpha) and calcium ion/calmodulin dependent protein kinase II repressible protein beta (CaM-KIIN beta) aminoacid sequence height homology with the rat source, wherein can be up to 98% with CaM-KIIN beta consistence and similarity, with CaM-KIIN alpha consistence be 65%, similarity then is 78%.People CaM-KIIN protein molecular weight is 8.6kDa, iso-electric point 5.16.The RT-PCR analysis revealed, CaM-KIIN has expression in some tumour cell, simultaneously in non-maturation, maturation and existence expression in various degree in the dendritic cell in antigen KLH stimulated peripheral mononuclear cells source.The Northern engram analysis shows in tissues such as kidney, liver, heart, skeletal muscle and placenta, and has particular expression in HeLa cell S3, MOLT-4, Raji and the K-562 clone.The cell growth experiment confirms that CaM-KIIN can check cell proliferation, has cell growth inhibiting activity.The research prompting of having carried out, CaM-KIIN may be the same with other inhibitor can be by specificity in conjunction with CaMKII, stop the phosphorylation of CaMKII to activate, regulate and control multiple physiology and pathology activity, play a significant role, and may be worth having important development and application aspect the immunodiagnosis in a plurality of fields such as anti-infective, anti-inflammatory response, antitumor and nerve growth reparation, immunologic function adjusting and the immunotherapy.Therefore, CaM-KIIN albumen or its relevant antagonist, agonist etc. can be diseases such as treatment tumour, inflammation, neural system and cardiovascular diseases new immunodiagnosis and targeted therapy approach are provided, thereby have great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone of people CaM-KIIN cDNA
Extract the total RNA of human dendritic cell with Trizol reagent (Life Technologies company).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (available from Gibco) with SuperScriptII cDNA fragment orientation is inserted on the multiple clone site of carrier, transform DH5 α bacterium and form the cDNA plasmid library.Measure random choose clone's 5 ' terminal sequence with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained full-length cDNA is a new cDNA sequence (shown in SEQ ID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein is named as human calcium ion/calmodulin dependent protein kinase H repressible protein (Calcium/Calmodulin-Dependent Protein Kinase II Inhibitor, CaM-KIIN), its encoding gene called after human calcium ion/calmodulin dependent protein kinase II repressible protein gene, i.e. CaM-KIIN gene.
The sequence SEQ ID NO:1 total length of CaM-KIIN is 591bp (Fig. 1), comprises 3 ' end non-coding region of 5 of 178bp ' end non-coding region and 173bp, and the coding region is the 179-415 position, and coding contains 79 amino acid whose polypeptide (Fig. 2).Calculating not in theory, the molecular weight of glycosylated ripe molecule is about 8.6kD.
The calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN beta height homology in BLAST analysis revealed itself and rat source, consistence and similarity can be up to 98% (Fig. 3); The calcium ion/calmodulin dependent protein kinase II repressible protein CaM-KIIN alpha consistence of originating with rat is 65%, and similarity then is 78% (Fig. 3).This coding people CaM-KIIN belongs to calcium ion/calmodulin dependent protein kinase II repressible protein family molecule.
Embodiment 2
Obtain the analysis of people's CaM-KIIN encoding sequence and pair cell expression with the RT-PCR method
(1) obtains people CaM-KIIN encoding sequence with the RT-PCR method
Extract the total RNA of dendritic cell that is in the corresponding clone of logarithmic phase, human peripheral blood mononuclear cell and stimulates the human peripheral blood mononuclear cell source of different time with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT through LPS
12-
18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing
2O dilutes.The used primer of pcr amplification CaM-KIIN is as follows: adopted primer 5 ' ATGTCCGAGATCCTGCCCTA (SEQ ID NO:3) is arranged, antisense primer 5 ' TGGTGCTGAAGCGGACAGCT (SEQID NO:4), simultaneously with beta-actin as positive control.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.5mM primer, 0.2mM dNTP and 1U rTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, capable 1.5% agarose gel electrophoresis of PCR product is tentatively confirmed after 28 circulations.Dna sequence dna to amplified production checks order, and the result shows that the DNA sequences encoding of this PCR product and the 179-591 shown in the SEQ ID NO:1 are identical.
(2) with of the analysis of RT-PCR method to the CaM-KIIN cell expressing
Get different tissues and cell, carry out RT-PCR, obtain people's CaM-KIINRT-PCR expression analysis collection of illustrative plates (Fig. 4) by above-mentioned same reaction conditions.Results suggest.CaM-KIIN is expressed in some tumour cell, as MCF-7, A172, HeLa, SMMC7721, PC-3, A549, THP-1, U937, Jurkat, Raji, Daudi clone; In the maturing dendritic cell in human peripheral blood mononuclear cell source and the reactivation process that stimulated by KLH, has the certain expression pattern; In the T in human peripheral source, B cell, do not see Table and reach.
Embodiment 3
The Northern engram analysis of people CaM-KIIN
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95～100 ℃ of sex change 2～5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.
Northern blot hybridization result shows: in kidney, liver, heart, skeletal muscle and placenta (5.2kb), and expression is in various degree arranged in brain many healthy tissuess such as (1.65kb); In HeLa cell S3, lymphoblast leukemia MOLT-4, Burkitt lymphoma Raji and chronic myelogenous leukemia K-562 clone (5.2kb), and in various degree expression (Fig. 5) is arranged in HeLa cell S3 and the Burkitt lymphoma Raji tumor cell lines such as (1.65kb).This shows that CaM-KIIN albumen is a kind of albumen of particular expression.
Embodiment 4
The cell growth inhibiting activity of CaM-KIIN
The plasmid DNA that will contain total length CaM-KIIN is with LipofectAMINE reagent (Life Technologies company) transfection LoVo cell, with the untransfected group as blank group (control), with the pcDNA3.1 plasmid vector as simulation control group (mock).Carried out in 24,48 and 72 hours after the transfection observing under the mirror: observation of cell growth conditions and taking pictures under mirror.
The result as shown in Figure 6, transfection after 24 hours the LoVo cell show as stretch relatively poor, cell generation shrinkage, intracytoplasmic particle increases; After the transfection 48 hours, cell attachment is not firm, a large amount of cell suspension and have a lot of dead cells to occur; After the transfection 72 hours, as seen a large amount of LoVo necrocytosiss is arranged, the LoVo cell of survival is few and form is very irregular.On form, there is not significant difference before and after blank group and the transfection of simulation cellular control unit.This shows that the CaM-KIIN cell growth has the activity of inhibition.
Embodiment 5
The cell growth inhibiting activity of CaM-KIIN detects
As embodiment 4, the plasmid DNA that will contain total length CaM-KIIN is with LipofectAMINE reagent (LifeTechnologies company) transfection HeLa cell and LoVo cell, with the untransfected group as blank group (control), with the pcDNA3.1 plasmid vector as the simulation control group (mock).The MTT that carried out cell proliferation after the transfection in 0,24,48 and 72 hour detects (thiazole south colorimetry detects), and the result is expressed as the curve of OD value to the time.
The result is shown in Fig. 7 A and 7B, and behind the transfection people total length CaM-KIIN cDNA, the growth curve of LoVo cell significantly reduces than blank group and simulation control group.The LoVo cell transfection after 24 hours growth curve promptly be obvious downtrending, after 48 hours the cell count of experimental group approximately be the blank group and the simulation control group half, only be again 1/3 after 72 hours.The growth curve of LoVo cell blank control group and simulation control group does not have significant difference.The HeLa cell does not have a considerable change in that transfection people total length CaM-KIIN cDNA is forward and backward.
Embodiment 6
CaM-KIIN's is recombinant expressed
In this embodiment, be template with the RT-PCR amplified production that obtains among the embodiment 2,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains people CaM-KIIN DNA as inserting fragment.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:
5’-ACGAATTCCCATGTCCGAGATCCTGC-3’(SEQ ID NO：5)
This primer contains the restriction enzyme site of EcoR I restriction enzyme, is the part encoding sequence of people CaM-KIIN after this restriction enzyme site;
3 ' end primer sequence is:
5’-ACGAATTCGCACTCCGGACGGCGGCT-3’(SEQ ID NO：6)
This primer contains the restriction enzyme site of EcoR I restriction enzyme and the part encoding sequence of people CaM-KIIN.
With the PCR product purification that obtains after the EcoRI enzyme cut and recombinate according to a conventional method with plasmid pGEM-3ZF again and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The people CaM-KIIN cDNAEcoR I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia company), forms carrier pGEX-2T-people CaM-KIIN, then transformed into escherichia coli BL21.Positive colony is cut evaluation with EcoR I enzyme, and the forward clone cuts evaluation with BamH I enzyme, the capable 0.8% agarose gel electrophoresis analysis of product.Confirm through order-checking, inserted designed CaM-KIIN encoding sequence.
Choosing the positive BL21 clone who expresses CaM-KIIN is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA the substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mMIPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml 1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, (pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant for 10mM gsh, 50mM Tris-HCl to add 500ul gsh elution buffer, repeat wash-out 2-3 time, obtain people CaM-KIIN albumen.
Carry out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 10 amino-acid residues of N-end shown in 10 amino acid of N-end and the SEQ IDNO:2 are identical as a result.
Embodiment 7
The preparation of anti-CaM-KIIN antibody
The recombinant protein people CaM-KIIN that obtains among the embodiment 6 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people CaM-KIIN gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Immunology Inst., No.2 Military Medical Univ.
＜120〉human calcium ion/calmodulin dependent protein kinase II repressible protein and purposes
<130>013728
<160>6
<170>PatentIn version 3.0
<210>1
<211>591
<212>DNA
<213>Homo sapiens
<220>
<221>CDS
<222>(179)..(415)
<400>1
cggcccggga ggcggaggcg cgggggagga ggccccgctt ggctcctcag ccccggatgc 60
tgcatgactt catccttccg ccggctcccc tgctgaggta gggccggtcc ggcagcaagc 120
ccgccgcccg cgccccgccg cagtcccgct cccgccccgc gcccaccccg cgcccgcc 178
atg tcc gag atc ctg ccc tac agc gaa gac aag atg ggc cgc ttc ggc 226
Met Ser Glu Ile Leu Pro Tyr Ser Glu Asp Lys Met Gly Arg Phe Gly
1 5 10 15
gca gac ccc gag ggc tcc gac ctc tcc ttc agc tgc cgc ctg cag gac 274
Ala Asp Pro Glu Gly Ser Asp Leu Ser Phe Ser Cys Arg Leu Gln Asp
20 25 30
acc aac tcc ttc ttc gcg ggc aac cag gcc aag cga ccc ccc aag ctg 322
Thr Asn Ser Phe Phe Ala Gly Asn Gln Ala Lys Arg Pro Pro Lys Leu
35 40 45
ggc cag atc ggc cga gcc aag cga gtg gtg atc gag gat gac cgg ata 370
Gly Gln Ile Gly Arg Ala Lys Arg Val Val Ile Glu Asp Asp Arg Ile
50 55 60
gac gac gtg ctg aag ggg atg ggg gag aag ccg ccg tcc gga gtg 415
Asp Asp Val Leu Lys Gly Met Gly Glu Lys Pro Pro Ser Gly Val
65 70 75
tagacgcgcc ggctcgggcg gcgggctccg ggcccagcct cgcagcggcc aggagcgcgg 475
gccggcgatg cggctgccgg cgcccccccg ccccggccca ggcgcccgcg ggcgggggct 535
gcagggccgt gccgccgccg ccgccaggca ctccggagct gtccgcttca gcacca 591
<210>2
<211>79
<212>PRT
<213>Homo sapiens
<400>2
Met Ser Glu Ile Leu Pro Tyr Ser Glu Asp Lys Met Gly Arg Phe Gly
1 5 10 15
Ala Asp Pro Glu Gly Ser Asp Leu Ser Phe Ser Cys Arg Leu Gln Asp
20 25 30
Thr Asn Ser Phe Phe Ala Gly Asn Gln Ala Lys Arg Pro Pro Lys Leu
35 40 45
Gly Gln Ile Gly Arg Ala Lys Arg Val Val Ile Glu Asp Asp Arg Ile
50 55 60
Asp Asp Val Leu Lys Gly Met Gly Glu Lys Pro Pro Ser Gly Val
65 70 75
<210>3
<211>20
<212>DNA
＜213〉synthetic oligonucleotide
<400>3
atgtccgaga tcctgcccta 20
<210>4
<211>20
<212>DNA
＜213〉synthetic oligonucleotide
<400>4
tggtgctgaa gcggacagct 20
<210>5
<211>26
<212>DNA
＜213〉synthetic oligonucleotide
<400>5
acgaattccc atgtccgaga tcctgc 26
<210>6
<211>26
<212>DNA
＜213〉synthetic oligonucleotide
<400>6
acgaattcgc actccggacg gcggct 26
Claims (2)
1. the purposes of an isolating people CaM-KIIN polypeptide, it is characterized in that, described CaM-KIIN polypeptide is used to prepare cytostatic composition, and wherein said CaM-KIIN polypeptide has SEQ ID NO:2 aminoacid sequence, and wherein said cell is the LoVo cell.
2. cytostatic composition, wherein said cell is the LoVo cell, it is characterized in that described composition contains the isolating people CaM-KIIN polypeptide and the acceptable carrier of significant quantity, wherein said CaM-KIIN polypeptide has SEQ ID NO:2 aminoacid sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01113357 CN1223607C (en) | 2001-07-11 | 2001-07-11 | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01113357 CN1223607C (en) | 2001-07-11 | 2001-07-11 | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1394873A CN1394873A (en) | 2003-02-05 |
| CN1223607C true CN1223607C (en) | 2005-10-19 |
Family
ID=4660091
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01113357 Expired - Lifetime CN1223607C (en) | 2001-07-11 | 2001-07-11 | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1223607C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100408597C (en) * | 2003-09-29 | 2008-08-06 | 第二军医大学免疫学研究所 | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use |
| CN108048418B (en) * | 2018-01-11 | 2021-02-02 | 山西大学 | Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof |
-
2001
- 2001-07-11 CN CN 01113357 patent/CN1223607C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1394873A (en) | 2003-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1212334C (en) | Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use | |
| CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
| CN1300170C (en) | Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application | |
| CN1273485C (en) | Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN1408724A (en) | Novel testicular function relative protein and its use | |
| CN1148381C (en) | New human chemotaxis factor macrophage inflammatory protein, its coding sequence and use | |
| CN1290861C (en) | New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use | |
| CN1477115A (en) | Novel human cyclin, its coding sequence and application | |
| CN1208344C (en) | Novel human cell endocytic regulatory protein, its coding sequence and use | |
| CN1152957C (en) | Human 6-phosphoglucosamine isomerase, its code sequence and application | |
| CN1603341A (en) | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use | |
| CN1151251C (en) | New human-phosphoguanosine reductase, its coding sequence and application | |
| CN1377891A (en) | Zinc finger protein from dendritic cell, its coding sequence and use | |
| CN1345798A (en) | Novel human Cdc2 related protein kinase, its coding sequence and use | |
| CN1299830A (en) | New human heat shock protein and its code sequence and use | |
| CN1990504A (en) | Earthworm protein suppressing cancer cell accretion by road spectrum | |
| CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use | |
| CN1511847A (en) | Ubiquitin-like molecule coming from human dendritic cell and its codnig sequence and use | |
| CN1477193A (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1292420A (en) | New human NADH oxido-reductase composite I subunit and its code sequence | |
| CN1325874A (en) | Human C-type lectin-like receptor and its coding sequence and application | |
| CN1475503A (en) | New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use | |
| CN1475568A (en) | New type human death resist protein, its coded sequence and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term |
Granted publication date: 20051019 |
|
| CX01 | Expiry of patent term |