CN1208344C - Novel human cell endocytic regulatory protein, its coding sequence and use - Google Patents
Novel human cell endocytic regulatory protein, its coding sequence and use Download PDFInfo
- Publication number
- CN1208344C CN1208344C CN 01105500 CN01105500A CN1208344C CN 1208344 C CN1208344 C CN 1208344C CN 01105500 CN01105500 CN 01105500 CN 01105500 A CN01105500 A CN 01105500A CN 1208344 C CN1208344 C CN 1208344C
- Authority
- CN
- China
- Prior art keywords
- rab39
- polypeptide
- sequence
- people
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a novel cell endocytic regulatory protein(Rab39). The present invention provides polynucleotide for coding the molecule of the protein and a method for producing the protein by recombination technology. The present invention also discloses the applications of the polynucleotide for coding the molecule of the novel cell cycle regulatory protein. The present invention also relates to the functions of the molecule in regulating the protein. The present invention also discloses the diagnosis and therapeutic strategies of diseases by molecules resisting the protein. The present invention can be particularly used for diagnosing and treating inflammation, tumors, diseases of the nervous system, the respiratory system and the endocrine system and cardiovascular diseases.
Description
The invention belongs to biotechnology and medical field, specifically, the present invention relates to the polynucleotide of new coding human cell endocytic regulatory protein Rab39, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Specifically, polypeptide of the present invention is a kind of new and cell endocytic, particularly tumour cell, secretory cell, relevant intracellular protein of neurocyte protein transport.
In recent years, protein transport has caused numerous scientists' attention gradually, and this relates to the essence of life, and upgrade, experience exchanging of the transhipment of material inside and outside external stimulus, the cell and information with cellular material closely related.Secretion, modification, the location of the proteic picked-up of external environment, transfer, metabolism and cell self synthetic proteins is the process of strict regulation and control.On molecular level, think that at present a Rab gene family does not play very key of person therein.
The Rab gene is a small molecular weight protein with GTP enzymic activity that is subordinated to the Ras superfamily.On gene level, characteristics of this family are to have multiple isomer, and gene order is different in size, and function is also had nothing in common with each other; On protein level, the molecule of this family all has phosphoric acid/magnesium ion binding sequence and GTP bonded functional domain, have in addition also have Sulfated decorating site; On biochemical activity, its typical feature is to combine with GTP, and self has slow GTP hydrolytic activity again, forms the existence form of GDP-Rab behind the dephosphorylation, and along with the conversion of GTP-Rab to GDP-Rab, this albumen also changes the endochylema existence form into from film combining form; On cell levels, a distinguishing feature of this family protein is all to be positioned on specific organoid or the ubcellular membranous structure, and is responsible for some specific protein transport steps; On biological function, think that at present Rab family plays main regulating and controlling effect in the formation of vesica, directed anchor committed step with protein transports such as merging.Though Rab is significant in the process of modulin transhipment, but this function still needs the effect of relevant modulin, GTP enzyme activation albumen (GTPase activating protein for example, GAP), GDP arrestin (the GDP dissoci ationinhibitor that dissociates, GDI), (guanine nucleotide exchange factor, GEF) equimolecular all promotes or suppresses the biological behaviour of Rab to the guanylic acid exchange factor.At present, the member of this family has reached nearly more than 40 (comprising its isomer separately).Research to the Rab gene mainly concentrates on basic life science, has found the effect of many Rab molecules in the specific protein transport process.For example Rab1a, Rab1b, Rab2 are positioned endoplasmic reticulum and golgi body and mediate substance transportation between the two; Rab6, Rab8, Rab12 are relevant with golgi body, mediate the substance transportation between the different gorky position.As alternative origination event between cell and the external environment, the Rab relevant with endocytosis also has been found that.For example, Rab4a is positioned early stage endocytosis body, and the film component that mediates early stage endocytosis body can arrive after birth; Rab9 is positioned endocytosis body in late period, and the mediation vesica is to the transhipment of high ear matrix.(Neuron，1993，Vol.11，789-799)。Though research concentrates on the preclinical medicine field, yet also there is report to show the clinical potential significance of Rab gene under pathology or physiological conditions.For example it is found that relevant (the Biochemical and Biophysical Research communications of the pernicious shaft-like tumour of Rab36 and children's's neural system, 1999,254,594-600), Rab37 shows as the mastocyte distribution of specific, point out be related between itself and anaphylaxis, asthma, the inflammation (FEBS Letters, 2000,470 61-64); Rab5a may be relevant with the granule secretion of neutrophil leucocyte, point out its potential significance in non-specific anti-infectious immunity (Experimental Cell Research, 1996,227,367-373); Rab18 is up-regulated after histamine stimulates, point out its effect in inflammation (FEBS Letters 2000,466,148-154.).Studies show that in addition Rab albumen has important effect in the synthetic and secretion of hormone (Regular Insulin, somatomedin etc.), neuropeptide, neurotransmitter.
The multiple disease that will cause a plurality of systems unusually of Rab gene regulating is as multiple diseases such as asthma, diabetes, inflammation, tumour, neuropsychiatric abnormalities.Therefore, significant for the people Rab albumen of diagnosing and the therapeutic purpose research and development is new.
The purpose of this invention is to provide a kind of new people's cell protein transhipment modulin-Rab39 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.Rab39 albumen of the present invention is a kind of Rab GTP enzyme homolgous molecule.
The Nucleotide, protein sequence that the invention provides a kind of new Rab gene-Rab39 with and the analysis of constitutional features; And make model with cervical cancer cell system-HeLa and confirm that first this albumen may participate in the endocytosis of foreign protein; And estimated the Application Areas that it is possible according to these data.
In a first aspect of the present invention, novel isolated Rab39 polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 50% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people Rab39 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 300-935 position among the SEQ ID NO:1; (b) has the sequence of 1-1251 position among the SEQID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people Rab39 protein-active, this method comprises: (a) under the proteic condition of suitable expressing human Rab39, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people Rab39 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people Rab39 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 300-935 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people Rab39 polypeptide active is provided, and the compound that suppresses people Rab39 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people Rab39 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of Rab39 in the test sample, it comprises: sample is contacted with the proteic specific antibody of Rab39, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample Rab39 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people Rab39 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people Rab39 polypeptide active, and perhaps screening suppresses the antagonist of people Rab39 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people Rab39 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people Rab39 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated inflammation, tumour, neural system, respiratory system, the multiple disease of endocrine system and cardiovascular disorder.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is people Rab39 albumen of the present invention and the proteic amino acid sequence homology comparison diagram of Rab.The top sequence is people Rab39, and the below sequence is the albumen of Rab family.Identical amino acid marks with black matrix between two sequences, and similar amino acid marks with grey body.
Fig. 2 is the conservative characteristic motif analysis of Rab39 albumen of the present invention.PM represents phosphoric acid/magnesium ion binding motif; G represents the GTP binding motif; CMTS representation carboxy end microbody location motif; PKC-PS represents the protein kinase C phosphorylation site; TK represents the tyrosine phosphorylation site.
Fig. 3 is Rab39 mRNA Northern trace figure of the present invention.
Fig. 4 is a HeLa cell endocytic Excel chart of the present invention.
In the present invention, term " Rab39 albumen ", " Rab39 polypeptide " or " albumen transhipment modulin Rab39 " Be used interchangeably, all refer to have the albumen of people's albumen transhipment modulin Rab39 amino acid sequence (SEQ ID NO:2) Or polypeptide. They comprise the albumen transhipment modulin Rab39 that contains or do not contain initial methionine.
As used herein, " separation " refer to material from its original environment, separate (if natural material, Original environment namely is natural environment). Not divide such as the polynucleotide under the natural state in the active somatic cell and polypeptide From purifying, but same polynucleotide or polypeptide as from natural state with in other materials that exist separately, Then for separation and purification.
As used herein, " Rab39 albumen or the polypeptide of separation " refer to the Rab39 polypeptide be substantially free of natural with Other albumen, lipid, carbohydrate or other material that it is relevant. Those skilled in the art can use the protein of standard Purification technique purifying Rab39 albumen. Basically pure polypeptide can produce single on non-reduced polyacrylamide gel Master tape. The purity of Rab39 polypeptide can be used amino acid sequence analysis.
Polypeptide of the present invention can be restructuring polypeptide, natural polypeptide, synthetic polypeptide, the polypeptide of preferably recombinating. The present invention Polypeptide can be the product of natural purifying, or the product of chemical synthesis, or use the restructuring technology from protokaryon or true Produce among the nuclear host (for example, bacterium, yeast, higher plant, insect and mammalian cell). Give birth to according to restructuring The host that the product scheme is used, polypeptide of the present invention can be the sugar baseization, maybe can be nonglycosylated. The present invention Polypeptide also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the similar thing of people Rab39 albumen. As used herein, term " sheet Section ", " derivative " refer to basically keep natural human Rab39 albumen of the present invention identical with " similar thing " Biology function or active polypeptide. Polypeptide fragment of the present invention, derivative or similar thing can be that (i) has one or many The individual conservative or substituted polypeptide of non-conservation amino acid residue (preferred conservative amino acid residue), and such replacement Amino acid residue can be also can be by the genetic code coding, or (ii) at one or more amino acid residues In have the polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the chemical combination that prolongs the polypeptide half-life Thing, for example polyethylene glycol) merge formed polypeptide, or (iv) additional amino acid sequence be fused to this peptide sequence and The polypeptide that forms (such as leading sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or with anti-The fusion albumen of the formation of former IgG fragment). According to the instruction of this paper, these fragments, derivative and similar thing belong to The known scope of those skilled in the art.
In the present invention, term " people Rab39 polypeptide " refers to have the SEQ ID NO.2 of people Rab39 protein active The polypeptide of sequence. This term also comprise have with people Rab39 albumen identical function, SEQ ID NO.2 sequence Variant form. These variant forms comprise (but being not limited to): some (be generally 1-50, better ground 1-30, 1-20 more preferably, 1-10 best) amino acid whose disappearance, insertion and/or replacement, and at C terminal and/or One of the terminal interpolation of N or several (be generally in 20, are in 10 goodly, more preferably are in 5) Amino acid. For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change The function of kink of preserved egg white matter. Again such as, add one or several amino acid and usually also can not in that C end and/or N are terminal Change the function of protein. This term also comprises active fragment and the reactive derivative of people Rab39 albumen.
The variant form of this polypeptide comprises: same source sequence, conservative variant, allelic variant, natural mutation, The egg of inducing mutant, can be coded with the DNA of people Rab39 DNA hybridization under high or low stringency condition In vain and the polypeptide or the albumen that utilize the antiserum of anti-people Rab39 polypeptide to obtain. The present invention also provides other many Peptide, as comprise the fusion albumen of people Rab39 polypeptide or its fragment. Except the polypeptide of total length almost, the present invention also The soluble fragments that has comprised people Rab39 polypeptide. Usually, this fragment has at least about 10 of people Rab39 peptide sequence Individual continuous amino acid, common at least about 30 continuous amino acids, at least about 50 continuous amino acids in better ground, more At least about 80 continuous amino acids in good ground, best at least about 100 continuous amino acids.
Invention also provides the similar thing of people Rab39 albumen or polypeptide. These similar things and natural human Rab39 polypeptide Difference can be the difference on the amino acid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps Have both at the same time. These polypeptide comprise hereditary variant natural or that induce. Induce the variant can be by various technology Obtain, as by radiation or be exposed to mutagens and produce at random mutagenesis, also can be by direct mutagenesis method or other Know molecular biological technology. Similar thing also comprises having and is different from the amino acid whose residue of natural L-(such as D-amino acid) Similar thing, and the similar thing with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid). Should Understand, polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing a level structure) form of modification comprises: chemically derived form such as the acetyl of the polypeptide that body is interior or external Change or carboxylated. Modify and also to comprise sugar baseization, as those polypeptide synthesize and process in or further process step In carry out glycosylation modified and polypeptide that produce. This kind modification can by polypeptide is exposed to carry out sugar baseization enzyme (as Mammiferous sugar baseization enzyme or deglycosylating enzyme) and finish. Modified forms also comprises having the phosphorylated amino acid residue The sequence of (such as phosphoric acid tyrosine, phosphoserine, phosphoric acid threonine). Thereby also comprise being modified and improved its anti-egg Plain boiled water solution performance or optimized the polypeptide of solubility property.
In the present invention, " people Rab39 albumen conservative variation polypeptide " refers to the amino acid sequence with SEQ ID NO:2 Compare, have 10 at the most, 8 at the most on better ground, more preferably at the most 5, best at the most 3 amino acid by character Similar or close amino acid is replaced and is formed polypeptide. These conservative variation polypeptide preferably carry out amino according to table 1 Acid is replaced and is produced.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, gene Group DNA or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or Noncoding strand. The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 Or letter variant also. As used herein, " letter variant also " refers to that in the present invention coding has SEQ The protein of ID NO:2, but with the differentiated nucleic acid sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence of an encoding mature polypeptide; The coded sequence of mature polypeptide and various additional code sequence; The coded sequence of mature polypeptide is (with optional additional code Sequence) and non-coding sequence.
Term " polynucleotides of coded polypeptide " can be the polynucleotides that comprise this polypeptide of encoding, and also can be also The polynucleotides that comprise additional code and/or non-coding sequence.
The invention still further relates to the variant of above-mentioned polynucleotides, its coding has identical amino acid sequence with the present invention The fragment of polypeptide or polypeptide, similar thing and derivative. The variant of these polynucleotides can be the equipotential of natural generation The variant that variant or non-natural take place. These nucleotides variants comprise replace variant, deletion mutation body and Insert variant. As known in the art, allelic variant is the replacement form of polynucleotides, and it may be The replacement of one or more nucleotides, disappearance or insertion, but can be from the function of the polypeptide that changes in fact its coding.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, better ground is at least 70%, the polynucleotides of at least 80% phase same sex more preferably. The present invention be more particularly directed under strict condition and institute of the present invention State the interfertile polynucleotides of polynucleotides. In the present invention, " strict condition " refers to: (1) is than LIS With hybridization and the wash-out under the higher temperatures degree, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) when hybridization be added with denaturant, Such as 50% (v/v) formyl amine, 0.1% little cow's serum/0.1%Ficoll, 42 ℃ etc.; Or (3) are only between two sequences The phase same sex is at least more than 90%, is more preferably 95% and just hybridizes when above. And interfertile polynucleotides are compiled The polypeptide of code has identical biology function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding Rab39.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People Rab39 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or Rab39 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the Rab39 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people Rab39 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people Rab39 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et a1.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people Rab39 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary 1ac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people Rab39 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism Rab39 protein function as pharmacological agent Rab39 protein function.The peptide molecule that can suppress or stimulate people Rab39 protein function that can be used for seeking therapeutic value with the recombinant human Rab39 protein screening peptide library of expressing.
On the other hand, the present invention also comprises people Rab39 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people Rab39 gene product or fragment.Preferably, refer to that those can combine with people Rab39 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people Rab39, comprise that also those do not influence the antibody of people Rab39 protein function.The present invention also comprise those can with modify or without the people Rab39 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people Rab39 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human Rab39 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people Rab39 protein function and the antibody that does not influence people Rab39 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people Rab39 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people Rab39 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people Rab39 can be used in the immunohistochemistry technology, detects the people Rab39 albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of people Rab39, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people Rab39 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people Rab39 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people Rab39 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of people Rab39 protein positive.
The production of polyclonal antibody can choose Rab39 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with Rab39 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for inflammation, tumour, neural system, respiratory system, multiple treatment of diseases such as endocrine system and cardiovascular disorder.
The treatment of aspect.When using Rab39 albumen of the present invention, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains Rab39 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the Rab39 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people Rab39 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell endocytic, secretion or the metabolic disturbance due to the proteic expression of Rab39 of the proteic nothing expression of Rab39 or unusual/non-activity.The Rab39 albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic Rab39 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the Rab39 transgenosis to cell.The method that structure carries the recombinant viral vector of Rab39 gene is found in existing document (Sambrook, et al.).Recombinant human Rab39 gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people Rab39 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people Rab39 obtains.During screening, must carry out mark to people Rab39 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people Rab39 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people Rab39 protein level that is detected in the test can be with laying down a definition the importance of people Rab39 albumen in various diseases and be used to the disease of diagnosing Rab39 albumen to work.
Whether having the proteic method of Rab39 in a kind of detection test sample is to utilize the proteic specific antibody of Rab39 to detect, and it comprises: sample is contacted with the Rab39 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample Rab39 albumen.
The proteic polynucleotide of Rab39 can be used for the diagnosis and the treatment of Rab39 protein related diseases.Aspect diagnosis, the proteic polynucleotide of Rab39 can be used for detecting the proteic expression of Rab39 Rab39 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of Rab39 as the Rab39 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of Rab39 albumen and also can detect the proteic transcription product of Rab39.
The sudden change that detects the Rab39 gene also can be used for the disease of diagnosing Rab39 albumen relevant.The form of Rab39 protein mutation comprises that the point mutation compared with normal wild type Rab39 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of Rab39 prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritance inMan (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.Polynucleotide of the present invention are isolated from human dendritic cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 1251 bases, and its open reading frame is positioned at the 300-935 position, and the coding total length is 211 amino acid whose people Rab39 albumen (SEQ ID NO:2).This Rab39 albumen belongs to protein transport modulin Rab family molecule, with Rah, and Rab36 aminoacid sequence height homology, consistence can be up to 80%, and similarity then can reach 90%.In addition, Rab39 albumen also comprises two GTP binding motifs, three phosphoric acid/Mg2+ binding motifs, two phosphorylation regulatory sites.The Northern engram analysis shows wide expression in tissue, the especially abundant liver that is expressed in.The research carried out prompting, Rab39 may be the albumen of modulin transhipment, can technology such as build by a minute submodule, competitive its short endocytosis of blocking-up, the effect of the antitumor and anti-cardiovascular disease of tool potential.Therefore, Rab39 albumen or its relevant antagonist, agonist etc. can be treatment inflammation, tumour, neural system, respiratory system, the diagnosis and the treatment of endocrine system and cardiovascular disorder are offered help, and may directly be inflammation, tumour, neural system, respiratory system, diseases such as endocrine system and cardiovascular disorder provide new treatment approach, thereby have great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of people Rab39 cDNA
Extract the total RNA of human dendritic cell with Trizol (Gibco company).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (available from Gibco) with SuperScriptII cDNA fragment orientation is inserted on the multiple clone site of carrier, transform DH5 α bacterium and form the cDNA plasmid library.Measure the sequence of random choose clone's 5 ' end with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained full-length cDNA is a new cDNA sequence (shown in SEQ ID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein is named as people's protein transport modulin Rab39, and its encoding gene name is people's protein transport modulin Rab39 gene.
Sequence SEQ ID NO:1 total length is 1251bp, comprises 5 ' the end non-coding region of 299bp and 3 ' the end non-coding region of 316bp, and coding contains 211 amino acid whose polypeptide.Calculating not in theory, the molecular weight of glycosylated ripe molecule is about 23kD.
They are different with known for the BLAST analysis revealed, and with people Rab36 aminoacid sequence height homology, consistence reaches 62%, and similarity reaches 76%, (Fig. 1) belongs to protein transport modulin Rab family molecule.In addition, in Rab39 albumen, also comprise two GTP binding motifs, three phosphoric acid/Mg2+ binding motifs, two phosphorylation regulatory sites, this also further points out its regulation and control (Fig. 2) that may participate in protein transport.
Embodiment 2: with the encoding sequence of RT-PCR method human cloning Rab39
Be in logarithmic phase HeLa cell total rna with Trizol (Gibco company) extraction, get 6mg cell total rna and 0.5 μ g Oligo-dT
12-
18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing
2O dilutes.The used primer of pcr amplification is as follows: adopted primer 5 ' TGCAAGGCCGCAGAGGGAATGAACATTCTG (SEQ ID NO:3) is arranged, antisense primer 5 ' TGCAAATGTCCAGGGGTCAAGCTCTGGAGG (SEQ ID NO:4).The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.4mM primer, 0.2mM dNTP and 1U ExTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, capable 2% agarose gel electrophoresis of PCR product is tentatively confirmed after 25 circulations.The dna sequence analysis result shows that the coding region dna sequence dna of this PCR product and the coding region shown in the SEQ ID NO:1 are identical.
The Northern engram analysis of embodiment 3Rab39
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95～100 ℃ of sex change 2～5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.
Northern blot hybridization result shows: in many healthy tissuess such as liver, heart, lung, placenta, skeletal muscle, kidney expression is arranged all, this shows that Rab39 albumen is a kind of albumen (Fig. 3) of wide expression.
In this embodiment, be template with the pcr amplification product among the embodiment 2, increase with the PCR Oligonucleolide primers of 5 ' and 3 following ' end of sequence, obtain people Rab39 DNA as inserting fragment.
5 ' end Oligonucleolide primers sequence of using in the PCR reaction is:
5’-ggatccGGCCGCAGAGGGAATGAACATTCT-3’(SEQ?ID?NO：5)
This primer contains the restriction enzyme site of BamH I restriction enzyme, is the part encoding sequence that is begun by initiator codon after this restriction enzyme site;
3 ' end primer sequence is:
5’-ggatcc?TGTCCAGGGGTCAAGCTCTGGAGG-3’(SEQ?ID?NO：6)
This primer contains whole encoding sequences of restriction enzyme site, translation termination and the people Rab39 of BamH I restriction enzyme.
With the PCR product purification that obtains after BamH I enzyme cut and recombinate according to a conventional method with plasmid pUC18 again and be converted into the competence bacillus coli DH 5 alpha, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The people Rab39 cDNA BamH I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia company), forms carrier pGEX-2T-Rab39, transform people DH5 α then.Positive colony is cut the evaluation direction of insertion with Pst I enzyme, and enzyme is cut the capable 2% agarose gel electrophoresis analysis of product.Confirm through order-checking, inserted complete Rab39 encoding sequence.
Choosing the positive DH5 α clone who expresses Rab39 is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA the substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mMIPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,000g4 ℃ of centrifugal 10min, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, (pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant for 10mM gsh, 50mMTris-HCl to add 500ul gsh elution buffer, repeat wash-out 2-3 time, obtain people Rab39 albumen.
Carry out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 10 amino-acid residues of N-end shown in 10 amino acid of N-end and the SEQ ID NO:2 are identical as a result.
Embodiment 5: anti-people Rab39 production of antibodies
The recombinant protein people Rab39 that obtains among the embodiment 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people Rab39 gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
The research of embodiment 6:Rab39 mediation endocytosis function.
The correct BamH I fragment that obtains among the embodiment 4 further is cloned into the pcDNA3.1 carrier for expression of eukaryon, and identifies direction.Get the HeLa cell and make model, adopt liposome-mediated electroinjection transient transfection.After 48 hours, with the DMEM serum starvation 24 hours that contains 0.5%FCS.Then, with containing 5%BSA, the fresh DMEM of i%FCS and 100 μ g/mlFITC-OVA acts on 15 minutes respectively in 37 ℃, 30 minutes, 60 minutes and 90 minutes, collecting cell was done facs analysis, obtain average fluorescent strength (MFI), and with the height of this index expression endocytosis ability.
The result shows that rab39 improves the endocytosis ability of cell as shown in Figure 4.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
(1) general information:
(ii) denomination of invention: new human cell endocytic regulatory protein, its encoding sequence and purposes
(iii) sequence number: 6
(2) information of SEQ ID NO:1:
(i) sequence signature:
(A) length: 1251bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ii) molecule type: cDNA
(xi) sequence description: SEQ ID NO:1:
CGGGACTCCC?CGCCCCCAAT?TGGCGGCCGA?AGAGTCTCCT?CGCCCCAGAG?TCATCTTCGG 60
GACGCCCAGG?GCCCGGGTGA?TTTTGGGCTC?GCCGCGGCCC?CGGGTGATTG?TTTCATCTCC 120
GTGGCCCGCG?GTGGTCGTAG?CGTCTCCGAG?ACCGCGGACT?CCCGTAGGTC?CCCCGTGGCC 180
CCGAGTTGTA?GTCGGGACAC?CCCGGCCGCG?GGTGATCGTC?GGGTCTCCAC?GCGCCCGGGT 240
CGCTGACGCG?GATCCGGCCT?CGGCGCCTTC?TCAGGGCGCC?CTGCAAGGCC?GCAGAGGGAA 300
TGAACATTCT?GGCACCCGTG?CGGAGGGATC?GCGTCCTGGC?GGAGCTGCCC?CAGTGCCTGA 360
GGAAGGAGGC?CGCTTTGCAC?GGGCACAAAG?ACTTCCACCC?CCGCGTCACC?TGCGCCTGCC 420
AGGAGCACCG?GACAGGCACC?GTGGGCAGAT?TTAAGATCTC?CAAGGTCATT?GTGGTGGGGG 480
ACCTGTCGGT?GGGGAAGACT?TGCCTCATTA?ATAGGTTCTG?CAAAGACACC?TTTGATAAGA 540
ATTACAAGGC?CACCATTGGA?GTGGACTTCG?AGATGGAACG?ATTTGAGGTG?CTGGGCATTC 600
CCTTCAGTTT?GCAGCTTTGG?GATACCGCTG?GGCAGGAGAG?GTTCAAATGC?ATTGCATCAA 660
CCTACTATAG?AGGAGCTCAA?GCCATCATCA?TTGTCTTCAA?CCTGAATGAT?GTGGCATCTC 720
TGGAACATAC?CAAGCAGTGG?CTGGCCGATG?CCCTGAAGGA?GAATGACCCT?TCCAGTGTGC 780
TTCTCTTCCT?TGTAGGTTCC?AAGAAGGATC?TGAGTACCCC?TGCTCAGTAT?GCGCTGATGG 840
AGAAAGACGC?CCTCCAGGTG?GCCCAGGAGA?TGAAGACTGT?TCAGAGACTG?CCCAGCCCTA 900
GGGCACTGTG?CCACCCTCAT?TCCTCCAGAG?CTTGACCCCT?GGACATTTGC?ACTGACTTTA 960
TCCAGACCAA?AGAGCTGCCT?CTTGGTGGCA?GTATTCCCAC?AGAGGGGTAG?CTGGGATCAT 1020
GCTAGTCACT?TCCTGCCCCC?AGGCACCGTG?CCAAAGACTG?GATGCCCCCT?ACTCCTCAGG 1080
GGACTGTCCA?GGGCGCCCAG?TGGTAGTGAG?GGAGAGTGTC?TCTGTTCTTT?TGCTCAGCCT 1140
GCTGGGCCCT?TTGTGTTTGA?GGATGCTTAA?TGATTCCAGC?CTCTCACTGT?GCCTTATGCA 1200
TTAAAATTTC?TTTGTTACGA?GCAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?A 1251
(2) information of SEQ ID NO:2:
(i) sequence signature:
(A) length: 211 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide
(xi) sequence description: SEQ ID NO:2:
MNILAPVRRD?RVLAELPQCL?RKEAALHGHK?DFHPRVTCAC?QEHRTGTVGR 50
FKISKVIVVG?DLSVGKTCLI?NRFCKDTFDK?NYKATIGVDF?EMERFEVLGI 100
PFSLQLWDTA?GQERFKCIAS?TYYRGAQAII?IVFNLNDVAS?LEHTKQWLAD 150
ALKENDPSSV?LLFLVGSKKD?LSTPAQYALM?EKDALQVAQE?MKTVQRLPSP 200
RALCHPHSSR?A 211
(2) information of SEQ ID NO:3
(i) sequence signature
(A) length: 30 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:3
TGCAAGGCCG?CAGAGGGAAT?GAACATTCTG 30
(2) information of SEQ ID NO:4
(i) sequence signature
(A) length: 30 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:4
TGCAAATGTC?CAGGGGTCAA?GCTCTGGAGG 30
(2) information of SEQ ID NO:5
(i) sequence signature
(A) length: 30 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:5:
GGATCCGCCG?CAGAGGGAAT?GAACATTCTG 30
(2) information of SEQ ID NO:6
(i) sequence signature
(A) length: 30 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:6:
GGATCCTGTC?CAGGGGTCAA?GCTCTGGAGG 30
Claims (12)
1. isolating people Rab39 polypeptide is characterized in that it is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through disappearance, insertion or the replacement of 1-10 amino-acid residue, and have mediate the endocytosis function by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, it is selected from down group:
(a) polynucleotide of polypeptide according to claim 1 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 300-935 position among the SEQ ID NO:1;
(b) has the sequence of 1-1251 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method of the described people Rab39 of claim 1 polypeptide is characterized in that this method comprises:
(a) under the proteic condition of suitable expressing human Rab39, cultivate the described host cell of claim 7;
(b) from culture, isolate people Rab39 polypeptide.
9. energy and the described people Rab39 of claim 1 protein-specific bonded antibody.
10. whether there is the proteic method of Rab39 in a test sample, it is characterized in that, comprising:
The described antibody of sample and claim 9 is contacted,
Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample Rab39 albumen.
11. the purposes of polypeptide as claimed in claim 1 is characterized in that, it is used to screen the agonist that promotes people Rab39 protein-active, and perhaps screening suppresses the antagonist of people Rab39 protein-active or is used to the peptide finger print identification.
12. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01105500 CN1208344C (en) | 2001-02-28 | 2001-02-28 | Novel human cell endocytic regulatory protein, its coding sequence and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01105500 CN1208344C (en) | 2001-02-28 | 2001-02-28 | Novel human cell endocytic regulatory protein, its coding sequence and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1371915A CN1371915A (en) | 2002-10-02 |
| CN1208344C true CN1208344C (en) | 2005-06-29 |
Family
ID=4654578
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01105500 Expired - Fee Related CN1208344C (en) | 2001-02-28 | 2001-02-28 | Novel human cell endocytic regulatory protein, its coding sequence and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1208344C (en) |
-
2001
- 2001-02-28 CN CN 01105500 patent/CN1208344C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1371915A (en) | 2002-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1212334C (en) | Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use | |
| CN1208344C (en) | Novel human cell endocytic regulatory protein, its coding sequence and use | |
| CN1300170C (en) | Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application | |
| CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
| CN1408724A (en) | Novel testicular function relative protein and its use | |
| CN1299823A (en) | New human cell factor and its code sequence and use | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN1148381C (en) | New human chemotaxis factor macrophage inflammatory protein, its coding sequence and use | |
| CN1273485C (en) | Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application | |
| CN1477115A (en) | Novel human cyclin, its coding sequence and application | |
| CN1152957C (en) | Human 6-phosphoglucosamine isomerase, its code sequence and application | |
| CN1377891A (en) | Zinc finger protein from dendritic cell, its coding sequence and use | |
| CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use | |
| CN1151251C (en) | New human-phosphoguanosine reductase, its coding sequence and application | |
| CN1299830A (en) | New human heat shock protein and its code sequence and use | |
| CN1325874A (en) | Human C-type lectin-like receptor and its coding sequence and application | |
| CN1287170A (en) | New human nerve mass-transferring protein and its code sequence | |
| CN1302895A (en) | Human UDP glucose-glycoprotein glycosyl transferase and itscoding sequence | |
| CN1477193A (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1299832A (en) | New human cell cycle regulating protein and its code sequence and use | |
| CN1603341A (en) | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use | |
| CN1475503A (en) | New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use | |
| CN1431306A (en) | Derivatization growth factors 5 of human liver cancer, its coding sequence, preparing method and usage | |
| CN1477119A (en) | Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050629 Termination date: 20170228 |