CN108048418B - Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof - Google Patents
Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof Download PDFInfo
- Publication number
- CN108048418B CN108048418B CN201810027037.1A CN201810027037A CN108048418B CN 108048418 B CN108048418 B CN 108048418B CN 201810027037 A CN201810027037 A CN 201810027037A CN 108048418 B CN108048418 B CN 108048418B
- Authority
- CN
- China
- Prior art keywords
- tumor
- protein
- fmbp
- bran
- active fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y111/00—Oxidoreductases acting on a peroxide as acceptor (1.11)
- C12Y111/01—Peroxidases (1.11.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides a bran coat source peroxidase anti-tumor active fragment, and a preparation method and application thereof. The preparation method of the fragment comprises the following steps: mRNA of millet seedling tissue is extracted by a Trizol method, and is catalyzed by enzyme and is reversely transcribed into cDNA by taking the mRNA as a template. According to the identification result of the millet anti-tumor activity protein FMBP mass spectrum, obtaining the gene sequence of the protein from Genebank, respectively truncating and screening according to different functional regions of the protein, and determining Ca2+The gene sequence of the binding site is an anti-tumor effect structural domain, a specific primer is designed according to the anti-tumor effect structural domain, the millet cDNA is taken as a template, and the FMBP-C gene sequence is amplified by a PCR method; introducing BamH I and Hind III enzyme cutting sites to the upstream and downstream of the sequence, connecting with a pMal-s vector to construct a pMal-s-FMBP-C recombinant plasmid, transferring into E.coli DH5 alpha competent cells, and screening to obtain positive transformants; IPTG induces and expresses target protein, the target protein is subjected to affinity purification, desalination and concentration, and MTT method detects the functions of resisting tumor and reversing tumor multidrug resistance, and the result shows that the active fragment has obvious activity of resisting tumor and reversing tumor multidrug resistance.
Description
Technical Field
The invention relates to the field of biotechnology and medicine, and particularly belongs to a bran-derived peroxidase anti-tumor active fragment, and a preparation method and application thereof.
Background
Millet, school name: setaria italica, also called millet after peeling, belongs to the Panicum of Gramineae in botany, originates from China, is a dominant crop in the north and is one of special agricultural products in Shanxi province. The bran coat is a by-product obtained in the process of processing the millet into millet. At present, few developments and researches on bran coats are made. The bran coat is rich in nutrients and beneficial components. Such as: triglyceride, lipoprotein, oryzanol, vitamin B, vitamin E, glucose, cellulose, trace elements, etc. In recent years, a series of active molecules with medicinal value in millet are discovered, and the active molecules have antioxidant activity, antibacterial activity, antihyperglycemic activity and the like.
No research report about the antitumor active protein molecules in the bran coat is found at home and abroad. In the previous research, the group of our subjects found that the bran coat-derived peroxidase protein FMBP has significant anti-tumor activity for the first time, and the invention patent of the country is granted. In order to reduce the possibility of immunogenicity generated by the natural protein in vivo and simultaneously to realize large-scale production of the protein in the later period, functional genes and recombinant proteins of active fragments of FMBP exerting an anti-tumor effect are obtained through recombination truncation optimization, and the recombinant proteins are applied to preparation of anti-tumor drugs and drug resistance reversal agents.
Disclosure of Invention
The invention aims to provide a gene of a bran-derived peroxidase anti-tumor active fragment, a recombinant protein, a preparation method of the recombinant protein and application of the recombinant protein in preparation of anti-tumor drugs and drug resistance reversal agents by utilizing a genetic engineering technology.
In order to achieve the purpose, the technical scheme provided by the invention is as follows:
an anti-tumor active fragment of bran-derived peroxidase has an amino acid sequence shown as SEQ ID No. 1.
An anti-tumor active fragment gene of bran-derived peroxidase, which is characterized by having a nucleotide sequence shown in SEQ ID No. 2.
A vector containing the bran-derived peroxidase anti-tumor active fragment gene as described above.
An engineering bacterium containing the vector as described above.
A preparation method of bran-derived peroxidase anti-tumor active fragments comprises the following steps:
(1) grinding millet seedlings into powder in liquid nitrogen, extracting total RNA by a Trizol method, and obtaining a cDNA template by using reverse transcriptase;
(2) according to the identification result of millet antitumor activity protein FMBP (MALDI-TOF-MS), obtaining the protein gene sequence in Genebank, respectively truncating and screening according to different functional regions thereof, and determining Ca2+The gene sequence of the binding site is an anti-tumor effect structural domain, and upstream and downstream primers SEQ ID No.3 and SEQ ID No.4 are designed according to the anti-tumor effect structural domain; establishing a PCR reaction system by taking cDNA as a template, recovering a PCR product, and sequencing and identifying;
(3) the PCR product is subjected to double enzyme digestion by BamH I and Hind III, is connected with a pMal-s vector which is also subjected to double enzyme digestion, and is transformed into E.coli DH5 alpha, so that a recombinant strain E.coli DH5 alpha-pMal-s-FMBP-C is obtained;
(4) culturing recombinant strain E.coli DH5 alpha-pMal-s-FMBP-C overnight, transferring into LB culture medium containing ampicillin, culturing at 37 deg.C and 200rpm/min for a period of time, measuring OD value of the strain at 600nm, adding inducer IPTG with final concentration of 0.2-0.4mmol/L when OD value reaches 0.6-0.8, continuing induction culture for 4-5h, centrifuging, and collecting thallus;
(5) adding preloaded material, Amylose Resin, to an empty column, and equilibrating the column with equilibration buffer; then the thalli is subjected to ultrasonic crushing and centrifugation, and the centrifuged supernatant is loaded into the well-balanced affinity chromatographic column for purification;
(6) eluting non-specifically bound hybrid protein with an equilibrium buffer solution, eluting the target protein with an equilibrium buffer solution containing 10mmol/L maltose, repeatedly purifying for 2-3 times, dialyzing with PBS overnight, concentrating with a 10KD ultrafiltration tube, and centrifuging to obtain the target protein Re-FMBP-C.
The active fragment Re-FMBP-C of the bran-derived peroxidase obtained by the invention is detected by SDS-PAGE electrophoresis, and a sample eluted by 10mmol/L maltose buffer solution has an obvious band, and the purity is more than 90%. Through the detection of anti-tumor activity, the Re-FMBP-C has good anti-tumor and anti-tumor multi-drug resistance reversing activity. Re-FMBP-C can be applied in preparing antineoplastic medicament, can also be applied in preparing tumor drug resistance reversal agent.
Compared with the prior art, the invention has the beneficial effects that:
the invention provides a bran coat source peroxidase active fragment, and the protein is obtained through cloning, expressing and purifying. The Re-FMBP-C active polypeptide is detected to have obvious anti-tumor effect, can obviously reverse the activity of tumor multidrug resistance, the reversing multiple reaches 19 times, and the protein can be prepared into anti-tumor drugs or tumor resistance reversing agents. The method for recombining the active fragments of the bran peroxidase by utilizing the genetic engineering technology is simple and easy to implement and has low cost.
Drawings
FIG. 1: PCR results for pMal-s-FMBP-C (where Mr is standard DNA Marker, and FMBP-C is Lane 1)
FIG. 2: restriction enzyme identification of pMal-s-FMBP-C recombinant plasmid (where Mr is Standard DNA Marker, Lane 1 is a positive plasmid, Lane 2 is pMal-s-FMBP-C recombinant plasmid, Lane 3 is recombinant plasmid digested by BamH I and Hind III)
FIG. 3: purification on an Amylose column (where Mr is the standard protein Marker, lane 1 is unpurified Re-FMBP-C, lane 2 is the third purified Re-FMBP-C, lane 3pMal-s tag protein)
FIG. 4: effect of Re-FMBP-C on tumor cell viability
FIG. 5: reversal of resistance of Re-FMBP-C to multidrug resistant cell lines
Detailed Description
Example 1: cloning and sequence analysis of the recombinant bran-derived peroxidase gene are carried out by the following steps:
(1) and (4) extracting total RNA of millet seedling tissues (both using a special gun head and an EP tube). Taking 0.3g millet seedling, adding liquid nitrogen, grinding into fine powder, adding 5ml RNA iso plus (trizol), and subpackaging in imported EP tube (preservation at-80 deg.C without immediate RNA extraction); adding 200 μ l chloroform, shaking vigorously for 15s, and standing for 5 min; centrifugation was carried out at 13000rpm at 4 ℃ for 15 min. The supernatant (500-; adding isopropanol with the same volume, turning the centrifuge tube upside down, mixing, and standing at 15-30 deg.C for 10 min; centrifuging at 13000rpm and 4 deg.C for 10min to obtain white precipitate; carefully pour off the supernatant and slowly add 1ml of 75% ethanol along the tube wall (can be turned upside down gently); centrifuging at 13000rpm and 4 deg.C for 5min, discarding the supernatant, and sucking up with a gun; exhausting air in a super clean bench, drying the precipitate until the precipitate becomes transparent; adding appropriate amount of DEPC water, dissolving precipitate, blowing slightly for several times, and dissolving in 55-60 deg.C metal bath for 10 min.
(2) And (5) obtaining cDNA. The total RNA of millet extracted by the above method was subjected to reverse transcription using Takala's reverse transcription kit in 10. mu.l PCR system (RNase Free H)2O5. mu.l, RNA 3. mu.l, 5 XPrime script RT Master Mix 2. mu.l) were reverse transcribed under the following conditions: 15min at 37 ℃ and 5s at 85 ℃, and after the reaction is finished, the CDNA is placed at-80 ℃ for long-term storage.
(3) Cloning of recombinant bran peroxidase gene. Ca according to FMBP protein obtained in Genebank2+Binding site gene sequence, designing specific primer, FMBP-C-Forward: CGC GGA TCC
GACTGCTTCGTCCAGGGCTG；FMBP-C-Reverse：CCC AAG CTT
GTCGAAGGTGTTGGGGGT are provided. Using the cDNA obtained in (2) as a template and a high fidelity enzyme kit from Takala, a 50. mu.1 PCR reaction system was set up containing 4. mu.l of cDNA, 10. mu.1 of 5 XPrime star GXL buffer, 3. mu.l of primer star GXL DNA polymerase, 2. mu.1 of each of the upstream and downstream primers, ddH2024 mu 1. And (3) PCR reaction conditions:
10s at 98 ℃, 15s at 55 ℃, 1min at 68 ℃ for 6s, and 35 cycles;
the PCR products were separated by electrophoresis on a 1% agarose gel (see FIG. 1 for results). The PCR product was cut and recovered according to the DNA gel recovery kit (Sangon) Bio-engineering INC (Canada). After recovery of the gel, the DNA concentration was measured using a Nanotrop 2000.
(4) Expression, purification and identification of bran peroxidase active fragment in escherichia coli
Construction of prokaryotic expression vector of recombinant bran-derived peroxidase
And (3) carrying out double enzyme digestion on the PCR product recovered from the gel cutting in the step (3) by BamH I and HindIII, connecting the product with a pMal-s vector subjected to double enzyme digestion, transforming the product into E.coli DH5 alpha competent cells, screening transformants, extracting plasmids to obtain recombinant plasmids pMal-s-FMBP-C, and carrying out double enzyme digestion to identify the recombinant plasmids (the result is shown in figure 2).
② culture and induced expression of recombinant strain
Recombinant strain E.coliDH5 alpha (pMal-s-FMBP-C) is subjected to shake cultivation at 37 ℃ and 200rpm overnight, is transferred to 500m1 LB culture medium containing ampicillin according to the inoculum concentration of 1%, is cultured at 37 ℃ and 200rpm/min for a period of time, then the OD value of the bacterial liquid is measured at 600nm, when the OD value reaches 0.6-0.8, an inducer IPTG is added, the final concentration is 0.2-0.4mmol/L, after culture for 4 hours at 37 ℃ and 200rpm/min, the bacterial liquid is centrifuged at 8000r/min for 0min to collect the bacterial liquid, after suspension by PBS, centrifugation is carried out for 10min under the same conditions, and Tris buffer solution (20mmol/L, 1mol/L NaCl, 1mmol/L EDTA, pH 7.4) of Tris Resin is used for suspension and precipitation.
Purification and desalination concentration of expression protein
Adding 10mmol/L PMSF into the bacterial liquid, crushing thallus with an ultrasonic crusher until the bacterial liquid is crushed and clarified, then centrifuging at 4 ℃ and 13000r/min for 30min, taking supernatant, loading the supernatant on an amyloseResin affinity chromatography column which is well balanced by buffer, combining for 1-2h, eluting the hybrid protein with the amyloseResin column buffer, and then eluting the target protein with buffer containing 10mmol/L maltose (10mmol/L maltose, 20mmol/L Tris, 0.2mol/L NaCl, 1mmol/L EDTA, pH 7.4). After 2 times of purification, collecting the target protein, dialyzing and concentrating to finally obtain the desalted and concentrated protein solution. The protein concentration was determined by Coomassie Brilliant blue method. SDS-PAGE showed that the eluted sample had a distinct band (see FIG. 3).
Activity identification of Peroxidase (POD)
The peroxidase activity of Re-FMBP-C was determined using a plant peroxidase assay kit (purchased from Nanjing Biotechnology Ltd.). The unit of enzyme activity is defined as: the amount of enzyme that catalyzes the reaction of 1. mu.g of substrate per minute per mg of protein at 37 ℃ is defined as one unit of enzyme activity. The results of the enzyme activity measurement showed that: the POD activity of Re-FMBP-C was 1185.64 + -34.5U/mgprot.
Example 2: functional verification of bran peroxidase active fragment (Re-FMBP-C)
Firstly, functional verification of Re-FMBP-C anti-tumor
Subjecting HCT-116, Hela, DLD1 in logarithmic growth phase to reaction at 6X 103One/well was transferred into a 96-well culture plate. 5% CO at 37 ℃2After incubation in an incubator for 24h, Re-FMBP-C was added at concentrations of 0.025, 0.05, 0.1. mu.g/. mu.l, in five wells, and pMal-s-tag protein (MBP) was used as a control. HCT-8/MDR was incubated for 48 hours with 0.025, 0.05, 0.1. mu.g/. mu.l Re-FMBP-C, and then the medium was aspirated from the wells, washed 2 times with PBS, and then fresh medium was added, 20. mu.l MTT solution (5mg/ml) was added to each well, and the incubation was continued for 4 hours, and then the incubation was terminated. Carefully removing culture supernatant in each well, adding 150 μ l DMSO into each well, shaking for 10min with shaking table to dissolve the crystals sufficiently, and measuring the light absorption value of each well on an enzyme-linked immunosorbent monitor at 570nm wavelength. The results show that: the recombinant bran peroxidase active fragment has obvious inhibition effect on different tumor cell strains and has concentration dependence. (results are shown in FIG. 4)
Functional verification of Re-FMBP-C reversal drug-resistant cell strain HCT-8/MDR on 5-fu drug resistance
Subjecting HCT-8/MDR, HCT-8 in logarithmic growth phase to reaction at 6 × 103One/well was transferred into a 96-well culture plate. 5% CO at 37 ℃2After 24h incubation in the incubator, the medium was aspirated, 100. mu.l of medium containing 5-fu at various concentrations, Re-FMBP-C (final concentration 0.1. mu.g/. mu.l) and medium containing 5-fu at various concentrations were added, five duplicate wells were set, and pMal-s-tag protein (MBP) was used as a control. After 48h incubation, the medium was aspirated from the wells, washed 2 times with PBS and fresh medium was added, 20. mu.l of MTT solution (5mg/ml) was added to each well, and incubation was continued for 4h before termination. Carefully removing culture supernatant in each well, adding 150 μ l DMSO into each well, shaking for 10min with shaking table to dissolve the crystals sufficiently, and measuring the light absorption value of each well on an enzyme-linked immunosorbent monitor at 570nm wavelength. The results show that: Re-FMBP-C can remarkably reverse swellingThe tumor multidrug resistance activity reaches 19-fold reversal times (the results are shown in tables 1-1, 1-2 and figure 5).
TABLE 1-1
Tables 1 to 2
Sequence listing
<110> university of Shanxi
<120> bran coat source peroxidase anti-tumor active fragment, preparation method and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 184
<212> PRT
<213> millet (Setaria italica)
<400> 1
Ala Cys Pro Val Gly Gly Cys Ala Ala Ser Val Leu Leu Ala Gly Ser
1 5 10 15
Ala Thr Gly Pro Gly Gly Leu Gly Ala Pro Pro Ala Leu Thr Leu Ala
20 25 30
Pro Ser Ala Pro Leu Ala Ile Ala Ala Ile His Ala Ala Leu Thr Ala
35 40 45
Gly Cys Gly Gly Pro Val Val Ser Cys Ser Ala Val Leu Ala Leu Ala
50 55 60
Ala Ala Ala Ser Val Val Val Ser Gly Gly Pro Ser Thr Ala Val Pro
65 70 75 80
Leu Gly Ala Ala Ala Ser Thr Ser Pro Ala Thr Gly Gly Ala Val Leu
85 90 95
Gly Gly Leu Pro Pro Pro Thr Ala Thr Val Pro Ala Leu Leu Gly Val
100 105 110
Leu Ser Leu Ile Ala Leu Ala Ala Thr Ala Leu Val Ala Leu Ser Gly
115 120 125
Gly His Thr Ile Gly Leu Gly His Cys Thr Ser Pro Gly Gly Ala Leu
130 135 140
Pro Pro Ala Pro Ala Pro Thr Leu Ala Ala Thr Pro Ala Gly His Leu
145 150 155 160
Ala Gly Thr Cys Pro Ala Leu Gly Thr Ala Ala Ala Thr Pro Leu Ala
165 170 175
Val Ala Thr Pro Ala Thr Pro Ala
180
<210> 2
<211> 552
<212> DNA
<213> millet (Setaria italica)
<400> 2
gactgcttcg tccagggctg cgacgcctcc gtgctgctgg acggctccgc caccggcccc 60
ggcgagaagc aggcgccgcc caacctcacg ctccgcccct ccgccttcaa ggccatcaac 120
gacatccacg accgcctcac cagggagtgc ggaggacccg tcgtctcatg ctccgacgtc 180
ctcgcgctcg ccgcccgcga ctccgtagtc gtgtcgggag ggccgagcta ccgggtgccc 240
cttggccggc gcgacagcac cagcttcgcg acgcagcagg acgtcctcgg cggcctgccg 300
ccgccgaccg ccaccgtccc ggcgctcctc ggcgtgctgt ccaagatcaa cctggacgcc 360
accgacctgg tggcgctctc cggcggccac accatcgggc tcggccactg cacctccttc 420
gagggccgcc tcttcccgcg cccggacccc accctcaacg ccaccttcgc cggccacctc 480
aggcagacct gcccggccaa gggcaccgac cggaggacgc cgctggacgt ccgcaccccc 540
aacaccttcg ac 552
<210> 3
<211> 29
<212> DNA
<213> millet (Setaria italica)
<400> 3
cgcggatccg actgcttcgt ccagggctg 29
<210> 4
<211> 27
<212> DNA
<213> millet (Setaria italica)
<400> 4
cccaagcttg tcgaaggtgt tgggggt 27
Claims (6)
1. An anti-tumor active fragment gene of bran-derived peroxidase, which is characterized in that the nucleotide sequence is a sequence shown as SEQ ID No. 2.
2. A vector comprising the bran-derived peroxidase anti-tumor active fragment gene according to claim 1.
3. An engineered bacterium comprising the vector of claim 2.
4. A preparation method of bran-derived peroxidase anti-tumor active fragments is characterized by comprising the following steps:
(1) grinding millet seedlings into powder in liquid nitrogen, extracting total RNA by a Trizol method, and obtaining a cDNA template by using reverse transcriptase;
(2) according to the identification result of the millet anti-tumor activity protein FMBP mass spectrum, obtaining the gene sequence of the protein from Genebank, respectively truncating and screening according to different functional regions of the protein, and determining Ca2+The gene sequence of the binding site is an anti-tumor effect structural domain, and upstream and downstream primers SEQ ID No.3 and SEQ ID No.4 are designed according to the anti-tumor effect structural domain; establishing a PCR reaction system by taking cDNA as a template, recovering a PCR product, and sequencing and identifying;
(3) PCR product viaBamH IAnd HindⅢdouble enzyme digestion, connection with pMal-s vector which is also double enzyme digested, transformationE.coli DH5 alpha to obtain a recombinant strainE.coli DH5α-pMal-s-FMBP-C；
(4) Recombinant strainE.coli Culturing DH5 alpha-pMal-s-FMBP-C overnight, transferring into LB culture medium containing ampicillin, culturing at 37 deg.C under 200rpm/min for a period of time, measuring bacterial liquid OD value at 600nm, adding inducer IPTG with final concentration of 0.2-0.4mmol/L when OD value reaches 0.6-0.8, continuing induction culture for 4-5h, centrifuging, and collecting thallus;
(5) adding a preloaded material, Amylose Resin, to an empty affinity chromatography column, and equilibrating the column with equilibration buffer; then the thalli is subjected to ultrasonic crushing and centrifugation, and the centrifuged supernatant is loaded into the well-balanced affinity chromatographic column for purification;
(6) eluting non-specifically bound hybrid protein with an equilibrium buffer solution, eluting the target protein with an equilibrium buffer solution containing 10mmol/L maltose, repeatedly purifying for 2-3 times, dialyzing with PBS overnight, concentrating with a 10KD ultrafiltration tube, and centrifuging to obtain the target protein FMBP-C.
5. The use of the bran-derived peroxidase anti-tumor active fragment gene as claimed in claim 1, in the preparation of an anti-tumor medicament, wherein the tumor is colorectal cancer, cecum cancer or cervical cancer.
6. The use of the bran-derived peroxidase anti-tumor active fragment gene as defined in claim 1, in the preparation of a tumor drug resistance reversal agent, wherein said tumor is cecum cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810027037.1A CN108048418B (en) | 2018-01-11 | 2018-01-11 | Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810027037.1A CN108048418B (en) | 2018-01-11 | 2018-01-11 | Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108048418A CN108048418A (en) | 2018-05-18 |
| CN108048418B true CN108048418B (en) | 2021-02-02 |
Family
ID=62126432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810027037.1A Active CN108048418B (en) | 2018-01-11 | 2018-01-11 | Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108048418B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110101850B (en) * | 2019-05-07 | 2023-03-10 | 山西大学 | Application of bran coat peroxidase in preparation of product for preventing and treating atherosclerosis |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561299A (en) * | 2014-12-30 | 2015-04-29 | 新疆农业大学 | Molecular marker used for identifying POD (peroxidase) activity of wheat grain and application of molecular marker |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5583107A (en) * | 1990-09-04 | 1996-12-10 | Cor Therapeutics, Inc. | Agents affecting thrombosis and hemostasis |
| CN1223607C (en) * | 2001-07-11 | 2005-10-19 | 第二军医大学免疫学研究所 | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application |
| WO2003007953A1 (en) * | 2001-07-18 | 2003-01-30 | Washington University | Methods and compositions for modulating t-type calcium channels |
| GB0404369D0 (en) * | 2004-02-26 | 2004-03-31 | Hamlet Ltd | Novel therapies |
| CN100460014C (en) * | 2006-07-20 | 2009-02-11 | 中国人民解放军第三军医大学 | Helicobacter pylori vaccine based on urease B subunit active segment and its prepn process |
| CN102617718B (en) * | 2012-03-27 | 2014-04-09 | 山西大学 | Bran coat antitumor active protein, as well as preparation method and applications thereof |
-
2018
- 2018-01-11 CN CN201810027037.1A patent/CN108048418B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561299A (en) * | 2014-12-30 | 2015-04-29 | 新疆农业大学 | Molecular marker used for identifying POD (peroxidase) activity of wheat grain and application of molecular marker |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108048418A (en) | 2018-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20070293660A1 (en) | Method for purifying granulocyte-colony stimulating factor | |
| CN110117602B (en) | Maitake mushroom UDP-glucose pyrophosphorylase and application thereof | |
| CN108048418B (en) | Bran coat source peroxidase anti-tumor active fragment, and preparation method and application thereof | |
| CN101665798B (en) | Method for preparing recombinant human serum albumin and interferon alpha fusion protein | |
| CN110563822B (en) | Ganoderma lucidum immunomodulatory protein mutant and application thereof | |
| CN112553231A (en) | Recombinant human heat shock protein HSP90-His and expression and purification method thereof | |
| CN108265064B (en) | Recombinant artemisia annua 3-class allergen protein and application thereof | |
| CN107828749B (en) | Low-temperature-resistant superoxide dismutase (MnSOD) from deep sea cucumber and preparation method thereof | |
| CN110759986A (en) | Efficient preparation method of reversible self-assembled protein | |
| CN102628058A (en) | Preparation of recombinant human nerve growth factor ( rhNGF ) protein and renaturation solution | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN111410693B (en) | CDK5 resistant nano antibody and application thereof | |
| CN103923938A (en) | Cloning and expression of beta-subunit gene of phycocyanin | |
| CN104894200B (en) | Preparation method of cartilage angiogenesis inhibiting factor of Sphyrna lewini | |
| CN115386009A (en) | Construction method and application of annexin V and angiogenesis inhibitor fusion protein | |
| CN103509100A (en) | Interleukin-1acceptor antagonist mutant | |
| CN103865899B (en) | There is VEGFR 2the fusion toxin of/KDR receptor-specific and encoding gene thereof and application | |
| Jebur et al. | Cloning and expression of l-Asparaginase gene from Aspergillus terreus in E. coli | |
| CN115125260B (en) | Phycomyces stolonifer polyketide synthase gene PKS1 and application thereof | |
| EP2128172A1 (en) | Preparation process of recombinant human p43 protein | |
| CN102559725A (en) | Human stem cell growth factor as well as production method and application of polyethylene glycol (PEG) modified human stem cell growth factor | |
| CN113493745B (en) | Genetically engineered bacterium for producing cephalosporin C and construction method thereof | |
| CN104878021A (en) | Latcripin-11 gene fragment of lentinula edodes C91-3 strain, and encoding protein, preparation method and application of Latcripin-11 gene fragment | |
| CN114249816B (en) | Molecular design of recombinant protein medicine | |
| CN102703489B (en) | Construction method for prokaryotic secretory expression vector of protein transduction domain-Apoptin (PTD-Apoptin) fusion protein and application of prokaryotic secretory expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |