CN104225617B - The purposes and its related drugs of people's AURKA gene therapy tumours - Google Patents
The purposes and its related drugs of people's AURKA gene therapy tumours Download PDFInfo
- Publication number
- CN104225617B CN104225617B CN201310230959.XA CN201310230959A CN104225617B CN 104225617 B CN104225617 B CN 104225617B CN 201310230959 A CN201310230959 A CN 201310230959A CN 104225617 B CN104225617 B CN 104225617B
- Authority
- CN
- China
- Prior art keywords
- aurka
- genes
- gene
- slow virus
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to biological technical field, single people AURKA genes are specifically disclosed；And people AURKA genes and Human epidermal growth factor receptor gene are used as cooperateing with dispenser target, the purposes in preparing or screening anti-tumor medicine.The present invention also further constructs AURKA genes siRNA, AURKA genes interference slow virus carrier, AURKA genes interference slow virus, and discloses their purposes in EGFR gene Synergistic treatment tumour.SiRNA that the present invention is provided or the slow virus carrier comprising the siRNA sequence, slow virus can specificity suppress the expression of people AURKA genes and/or Human epidermal growth factor receptor gene, especially slow virus, AURKA genes interference slow virus of the invention can cooperate with the growth for suppressing tumour cell individually or with EGFR gene interference slow virus, promote apoptosis of tumor cells, it is significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, more particularly to single people AURKA genes；And people AURKA genes and
The purposes and its related drugs of Human epidermal growth factor receptor gene Synergistic treatment tumour.
Background technology
The gene therapy of current tumour has been achieved for flourishing quickly development, but so far, however it remains it is a lot
The problem for needing to solve.Currently used for therapy of tumor gene very little, the gene that can suppress tumour growth is few in number, anxious
More available genes need to be provided.Further, since the process such as the generation of tumour, development, transfer is a polygenes and participating in, relating to
And the complex networks system of many signal paths, therefore individual gene treatment or single therapy method often offer limited effectiveness.Therefore,
The emphasis of following gene therapy development will be to excavate and identify the gene for clinically having important value, explore multiple with not
With the gene association treatment of Antitumor Mechanism and by polygenes targeted drug therapeutic alliance etc..
AURKA gene codes one evolve on the serine/threonine kinase guarded, be Aurora A family member it
One.In mitosis, AURKA is by participating in the separation of centerbody and the foundation at ripe and spindle the two poles of the earth, it is ensured that have silk
Properly separating for chromosome and smoothly completing for cytokinesis, play an important role in the cell cycle in division.AURKA's is different
Often amplification and/or expression high are common in various human tumors（KamadaK, Yamada Y, Hirao T, et
al.Amplification/overexpression of Aurora-A in human gastric careinoma:
Potential role in differentiated tyPe gastric eareinogenesis.Oncol Rep.2004;
12(3):593-599.）.Recent studies indicate that, AURKA may participate in a plurality of important cell-signaling pathways, straight as kinases
Connect or activate various carcinogenic proteins indirectly or inactivate various cancer suppressor proteins, so as to promote tumour to develop.There is research
It was found that in AURKA siRNA suppression HEP-2 cells after AURKA gene expressions, laryngocarcinoma HEP-2 cell transplantation knurls are in nude mice by subcutaneous
The speed of growth is remarkably decreased compared with control group, and 28 days after tumor inoculation, the average weight of tumour is also significantly reduced compared with control group, explanation
AURKA gene silencings can suppress laryngeal cancer cell growth in vivo.The research discovery of Hata and Tanaka, suppresses cancer of pancreas and food
After AURKA genes in pipe JEG-3, it is seeded to the tumour formed after nude mice and is obviously reduced even complete inhibition（Hata T,
FurukawaT, Sunamura M, etal.RNA interference targeting aurora kinase a
suppresses tumor growth and enhanees the taxane chemosensitivity in human
Pancreatic cancer cells.Caneer Res.2005;65(7):2899-905.Tanaka E, Hashimoto Y,
Ito T, etal.The suPPression of aurora-A/STK15/BTAK exPression enhances
chemosensitivity to docetaxel in human esophageal squamous cell
carcinoma.Clin Caneer Res.2007;13(4):1331-40.）, these results point out AURKA expression high and body
Interior one-tenth knurl ability is significantly correlated.Therefore, AURKA is the potential ideal targets of oncotherapy.
EGF-R ELISA（epidermalgrowth factor receptor,EGFR）EGFR is a kind of cross-film
Protein, belongs to ErbB receptor family member, and its part (EGF, TGF- α etc.) is combined with EGFR extracellular fragments is allowed to dimerization, by
This causes the cascade reaction of intracellular section tyrosine kinase activation and a series of signal transduction, promotes cell to breed, angiogenesis,
Shift and suppress Apoptosis（Liang Houjie, Zou Lan .EGFR targeted drugs treatment advanced colorectal cancer latest developments China prescription
Medicine 2009;84:58-61.）, so as to lead oncogenic generation.Numerous studies find that EGFR gene crosses table in kinds of tumors tissue
Up to or abnormal activation so that tumor cell proliferation, invasion and attack and transfer ability enhancing.It is various that EGFR has turned into according to clinical verification
The therapy target of tumor types（Ciardiello F,Tortora G.EGFR antagonists in cancer
treatment.N Engl J Med2008;358:1160-1174.）.
RNAi is the PTGS phenomenon using the sequence-specific of double chain RNA mediate, it has also become research gene
A kind of emerging effective means of function, and it is expected to turn into the instrument of the disease genes such as tumour treatment（Izquierdo M.Short
interfering RNAs as a tool for cancer gene therapy.Cancer Gene Ther.2005;12
(3):217-27.）.Slow virus（lentivirus）Carrier is efficient gene transfer instrument, is mainly used in infection to conventional side
The relatively low cell of method transfection efficiency, such as primary cell.Lentiviral particle can infection development and non-proliferative simultaneously cell, and sense
Dye is more stable, lasting.With slow virus carrier, the expression high of specific gene is capable of achieving, it is also possible to express hairpin RNA
（short hairpin RNA,shRNA）Disturbed with RNA（RNA interference, RNAi）Mode lowers the table of certain gene
Reach.The present invention intends cooperateing with suppression tumour cell with EGFR gene using the RNAi technology research AURKA genes of lentivirus mediated
Function in propagation, for the No operation clinical treatment of malignant tumour provides theoretical foundation.
The content of the invention
It is an object of the invention to disclose target of the AURKA genes as treatment of cancer, treat tumour purposes and its
Related drugs；And by AURKA genes and EGFR gene collectively as treatment of cancer target, by silence AURKA bases simultaneously
The expression of cause and EGFR gene, realizes the purposes of Synergistic treatment tumour, and its anti-tumor medicine.
The present invention have studied effect of the single AURKA genes in tumour occurrence and development with RNA interference as means,
And, AURKA genes and synergy of the EGFR gene in tumour occurrence and development disclose and a kind of suppress or reduce tumour
The method of cell growth, propagation, differentiation and/or survival, the method includes：Applying one kind to tumour cell being capable of specificity suppression
The transcription of AURKA genes and/or EGFR gene, translation, or being capable of specificity suppression AURKA albumen and/or EGFR protein expressions
Active material, the growth of tumour cell, propagation, differentiation are suppressed with this or are survived.
First aspect present invention, the people AURKA genes for disclosing separation are being prepared or are screening anti-tumor medicine, Huo Zhe
Prepare the purposes in diagnosing tumor medicine.
In the present invention, the people AURKA genes are applied to prepare or screen swollen as the action target for tumour cell
Knurl medicine, or prepare diagnosing tumor medicine.Further, the action target for tumour cell is RNA interference
Action target.
The people AURKA genes by separation include both sides content for preparing or screening anti-tumor medicine：Its
One, it is applied to prepare anti-tumor medicine for the action target of tumour cell using people AURKA genes as medicine or preparation；Its
Two, it is applied to screen anti-tumor medicine for the action target of tumour cell using people AURKA genes as medicine or preparation.
It is described to be applied to prepare oncotherapy for the action target of tumour cell using AURKA genes as medicine or preparation
Medicine is specifically referred to：AURKA genes are developed into medicine or preparation for tumour cell as the target of RNA interference effects,
So as to improve or reduce the expression of AURKA genes in tumour cell.
It is described to be applied to screen oncotherapy for the action target of tumour cell using AURKA genes as medicine or preparation
Medicine is specifically referred to：Using AURKA genes as effective object, medicine or preparation are screened, can suppress or promote to find
Enter the medicine of people's AURKA gene expressions as oncotherapy drug candidate.AURKA genes small molecule interference as described in the present invention
RNA（siRNA）It is to be obtained by effective object screening of people AURKA genes, can be used as that there is suppression tumor cell proliferation to make
Medicine.In addition, such as antibody drug, small-molecule drug etc. also can be right as acting on using AURKA genes and its albumen
As.
It is described to be used to AURKA genes prepare diagnosing tumor medicine, refer to swollen using AURKA gene expression products as one
Knurl diagnosis index is applied to the preparation of diagnosing tumor medicine.
The anti-tumor medicine is the transcription or translation for being capable of specificity suppression AURKA genes, or specific can be pressed down
The expression of AURKA albumen processed or the molecule of activity, so as to reduce the expression of AURKA genes in tumour cell, reach suppression
The purpose of the propagation of tumour cell, growth, differentiation and/or survival.
Described tumour can be that any one related to the expression of people's AURKA genes of propagation of its tumour cell is swollen
Knurl；Further, it is a kind of malignant tumour, is selected from：Lung cancer or colon cancer.
First aspect present invention, the people AURKA genes and Human epidermal growth factor receptor gene for also disclosing separation is being prepared or is screening tumour
Medicine, or the purposes in diagnosing tumor medicine is prepared.
In the present invention, the people AURKA genes and Human epidermal growth factor receptor gene are applied to as the action target for tumour cell
Prepare or screening anti-tumor medicine, or prepare diagnosing tumor medicine.Further, the effect target for tumour cell
It is designated as RNA interference effect targets.
The people AURKA genes and Human epidermal growth factor receptor gene by separation includes two sides for preparing or screening anti-tumor medicine
The content in face：First, should for the action target of tumour cell as medicine or preparation using people AURKA genes and Human epidermal growth factor receptor gene
For preparing anti-tumor medicine；Second, people AURKA genes and Human epidermal growth factor receptor gene are directed into tumour cell as medicine or preparation
Action target be applied to screen anti-tumor medicine.
The action target application that people AURKA genes and Human epidermal growth factor receptor gene are directed to tumour cell as medicine or preparation
Specifically referred in anti-tumor medicine is prepared：By AURKA genes and Human epidermal growth factor receptor gene collectively as RNA interference effects target,
Developing can simultaneously for two kinds of anti-tumor medicines or preparation of gene, so as to improve or reduce AURKA genes in tumour cell
With the expression of Human epidermal growth factor receptor gene；Or, using AURKA genes and Human epidermal growth factor receptor gene as the target of RNA interference effects,
To develop respectively for two kinds of anti-tumor medicines of gene, so as to obtain can improve or reduce AURKA genes in tumour cell
With the anti-tumor medicine or preparation of Human epidermal growth factor receptor gene expression dose.
The action target application that people AURKA genes and Human epidermal growth factor receptor gene are directed to tumour cell as medicine or preparation
Specifically referred in screening anti-tumor medicine：Using people AURKA genes and Human epidermal growth factor receptor gene simultaneously as effective object, medicine is entered
Row screening, can be influenceed respectively with finding（Suppress or promote）The medicine of people's AURKA gene expressions and influence（Suppress or promote）
The medicine of Human epidermal growth factor receptor gene expression, then as oncotherapy alternative compositions medicine；Or find can be while influence（Suppress
Or promote）People AURKA genes and the medicine of Human epidermal growth factor receptor gene expression are used as oncotherapy drug candidate.As described in the present invention
AURKA gene small molecules interference RNAs（siRNA）, gene RNA construct, slow virus, and EGFR gene small molecule is dry
Disturb RNA（siRNA）, gene RNA construct, slow virus, be with AURKA genes and EGFR gene be respectively effect it is right
As screening is obtained；When they are used in conjunction with, there is the effect of synergy, than a kind of single using effect of material more
It is good；Can be used as that there is the medicine for suppressing tumor cell proliferation effect.In addition, such as antibody drug, small-molecule drug etc.
Can be using people AURKA genes and Human epidermal growth factor receptor gene and its albumen as effective object.
It is described to be used to prepare diagnosing tumor medicine by people AURKA genes and Human epidermal growth factor receptor gene, refer to by AURKA gene expressions
Product and Human epidermal growth factor receptor gene expression product are applied to the preparation of tumour diagnostic reagent as diagnosing tumor index.
The anti-tumor medicine of the invention is being capable of specificity suppression people AURKA genes and/or Human epidermal growth factor receptor gene
Transcription is translated, or can specificity suppress expression or the molecule of activity of people AURKA genes and/or Human epidermal growth factor receptor gene so that
Reduce the expression of tumour cell people AURKA genes and/or Human epidermal growth factor receptor gene, reach suppress the propagation of tumour cell, growth,
Differentiation, the purpose of survival.
Prepared by the present invention or the anti-tumor medicine of screening is included but is not limited to：Nucleic acid molecules, carbohydrate, lipid,
Small-molecule chemical medicine（Such as inhibitor）, antibody medicine, polypeptide, albumen or interference slow virus.
The nucleic acid molecules are included but is not limited to：ASON, double-stranded RNA（dsRNA）, ribozyme, in ribonucleic acid
SiRNA prepared by enzyme cutting III（esiRNA）Or short hairpin RNA（shRNA）.
The amount of application of the anti-tumor medicine is to reduce the transcription of people AURKA genes and Human epidermal growth factor receptor gene enough or turn over
Translate, or reduce expression or the dosage of activity of people AURKA albumen and Human epidermal growth factor receptor albumen enough.To make one AURKA genes and people
The expression of EGFR gene is at least lowered 50%, 80%, 90%, 95% or 99%.
In the present invention, when people AURKA genes and Human epidermal growth factor receptor gene carry out oncotherapy and medicine as collaboration dispenser target
It is the method disturbed by RNA during screening, using the target gene that people AURKA genes and EGFR gene are disturbed as RAN, reduces this
Two expressions of gene.
Described tumour can be that the propagation of its tumour cell is related to the expression of people AURKA genes and Human epidermal growth factor receptor gene
Any one tumour；Further, it is a kind of malignant tumour, is selected from：Lung cancer or colon cancer.
It is the expression by individually reducing people's AURKA genes using the method for forgoing neoplasms medicine treatment tumour
Suppress the propagation of tumour cell to reach the purpose for the treatment of, or by reducing people AURKA genes and Human epidermal growth factor receptor gene simultaneously
Expression suppresses the propagation of tumour cell to reach the purpose for the treatment of.Specifically, during treatment, can effectively reduce people AURKA
The material of gene expression dose；Or, can will effectively reduce the administering substances of people AURKA genes and Human epidermal growth factor receptor gene expression dose
In patient.
Second aspect present invention discloses a kind of nucleic acid molecules of the separation for reducing AURKA gene expressions in tumour cell,
The nucleic acid molecules are included：
B) AURKA genes double-stranded RNA, in the AURKA genes double-stranded RNA containing can under stringent condition with AURKA
The nucleotide sequence of gene recombination；Or
C) AURKA genes shRNA, in the AURKA genes shRNA containing can under stringent condition with AURKA genes
The nucleotide sequence of hybridization.
Preferably, the AURKA genes double-stranded RNA includes the first chain and the second chain, first chain and second chain
Complementation is collectively forming RNA dimers, and the sequence of first chain is essentially identical with the target sequence of AURKA genes.
Preferably, the AURKA genes shRNA includes positive-sense strand fragment and antisense strand fragment, and connects the justice
The sequence of the loop-stem structure of chain fragment and antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and institute
The sequence for stating positive-sense strand fragment is essentially identical with the target sequence of AURKA genes.
More excellent, the sequence of the loop-stem structure of the shRNA may be selected from following any：UUCAAGAGA、AUG、CCC、
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
More excellent, the target sequence of the AURKA genes is SEQ ID NO:Sequence shown in 1.
It is and described when the target sequence of the AURKA genes is siRNA for specific silence AURKA gene expressions
The fragment in AURKA genes corresponding to the complementary mRNA fragments for combining of siRNA.
The length of the chain of the double-stranded RNA first and the second chain is 15-27 nucleotides；Preferably, length is 19-23
Individual nucleotides；Optimal, length is 19,20 or 21 nucleotides.
Further, the double-stranded RNA is siRNA（siRNA）.
Optimal, the sequence such as SEQ ID NO of AURKA genes the first chain of siRNA：Shown in 9, specially 5 '-
GAAAGCUCCACAUCAAUAA-3’.SEQ ID NO：First chain of the AURKA gene siRNAs shown in 9 is with SEQ ID NO:1
Shown sequence is a chain in the siRNA for people's AURKA genes of RNA interference target sequence designs, first chain
The siRNA constituted with the second chain can play a part of endogenous AURKA gene expressions in specific silence tumour cell.
Optimal, the sequence such as SEQ ID NO of the AURKA genes shRNA:Shown in 11, specially：5’-
caGAAAGCUCCACAUCAAUAA CUCGAGUUAUUGAUGUGGAGCUUUCUG-3’。
Third aspect present invention, discloses a kind of AURKA genes RNA construct, contains the core for encoding foregoing separation
The genetic fragment of the AURKA genes shRNA in acid molecule, can express the AURKA genes shRNA.
More excellent, the AURKA genes RNA construct is that AURKA genes disturb slow virus carrier.
The AURKA genes interference slow virus carrier is to be cloned into the DNA fragmentation for encoding foregoing AURKA genes shRNA
Known carrier is obtained, and the known carrier is generally slow virus carrier, and the AURKA genes interference slow virus carrier is wrapped by virus
Dress up as after infectious virion, infected tumor's cell, and then transcribe out the shRNA, step is processed etc. by digestion
Suddenly, the AURKA genes siRNA is finally obtained, for the expression of specific silence AURKA genes.
The DNA sequence dna for encoding the AURKA genes shRNA genetic fragments contains SEQ ID NO:Sequence shown in 1 and its mutually
Complementary series.
Further, the AURKA genes interference slow virus carrier also contains promoter sequence and/or codes for tumor cell
In the nucleotide sequence of label that can be detected；Preferably, the label the being detected such as green fluorescent protein
（GFP）.
Further, the slow virus carrier can be selected from：pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
Fourth aspect present invention, discloses a kind of AURKA genes interference slow virus, by foregoing AURKA genes RNA
AURKA genes in construct disturb slow virus carrier under slow virus packaging plasmid, the auxiliary of cell line, are packed by virus
Form.
Slow virus medicine of the invention can infected tumor's cell and produce for AURKA genes small molecules interference RNA, from
And suppress the propagation of tumour cell.AURKA genes interference slow virus can be used for the medicine for preparing prevention or treatment tumour.
Fifth aspect present invention, discloses a kind of pharmaceutical composition for treating lung cancer or colon cancer, its active principle
Nucleic acid molecules, AURKA gene RNAs construct containing the foregoing separation for reducing AURKA gene expressions in tumour cell,
At least one in AURKA genes interference slow virus.
Preferably, the pharmaceutical composition of the treatment lung cancer or colon cancer, its active ingredient also includes reducing tumour cell
The nucleic acid molecules of the separation of middle EGFR gene expression, EGFR gene RNA construct and EGFR gene interference slow virus
In at least one.
More excellent, the AURKA genes RNA construct is that AURKA genes disturb slow virus carrier.
Further, the nucleic acid molecules of the separation for reducing EGFR gene expression in tumour cell are：
1）EGFR gene double-stranded RNA, in the EGFR gene double-stranded RNA containing can under stringent condition with EGFR gene
The nucleotide sequence of hybridization；Or
2）EGFR gene shRNA, containing in the EGFR gene shRNA can hybridize under stringent condition with EGFR gene
Nucleotide sequence.
Preferably, the EGFR gene double-stranded RNA includes the first chain and the second chain, and first chain and second chain are mutual
Benefit is collectively forming RNA dimers, and the sequence of first chain is essentially identical with the target sequence of EGFR gene.
Preferably, the EGFR gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects the positive-sense strand
The sequence of the loop-stem structure of fragment and antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and described
The sequence of positive-sense strand fragment is essentially identical with the target sequence of EGFR gene.
It is furthermore preferred that the sequence of the loop-stem structure of the shRNA may be selected from it is following any：UUCAAGAGA、AUG、CCC、
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
It is furthermore preferred that the target sequence of the EGFR gene, is SEQ ID NO:Sequence shown in 2.
When the target sequence of the EGFR gene is siRNA for specific silence EGFR gene expression, with the siRNA
Fragment in the EGFR gene corresponding to mRNA fragments that complementation is combined.
The length of the chain of the double-stranded RNA first and the second chain is 15-27 nucleotides；Preferably, length is 19-23
Individual nucleotides；Optimal, length is 19,20 or 21 nucleotides.
Further, the double-stranded RNA is siRNA（siRNA）.
Most preferably, the sequence of the chain of EGFR gene siRNA first such as SEQ ID NO：Shown in 10, specially 5 '-
GGCUGGUUAUGUCCUCAUU-3’.SEQ ID NO：First chain of the EGFR gene siRNA shown in 10 is with SEQ ID NO:2
Shown sequence be RNA interference target sequence design the siRNA for Human epidermal growth factor receptor gene in a chain, first chain with
The siRNA of the second chain composition can play a part of endogenous EGFR gene expression in specific silence tumour cell.
Most preferably, the sequence of the EGFR gene shRNA such as SEQ ID NO:Shown in 12, specially：5’-
GUGGCUGGUUAUGUCCUCAUUCUCGAG AAUGAGGACAUAACCAGCCAC-3’。
It is that the double-stranded RNA of safe and effective amount, shRNA or slow virus are applied to the food in one's mouth when the medicine as treatment tumour
Newborn animal.Specific dosage is also contemplated that the factors such as method of administration, patient health situation, these be all skilled practitioners technical ability scope it
Interior.
Preferably, the EGFR gene RNA construct is to contain the gene piece for encoding foregoing EGFR gene shRNA
Section, can express the EGFR gene shRNA.
More excellent, the EGFR gene RNA construct is that EGFR gene disturbs slow virus carrier.
Preferably, the EGFR gene interference slow virus packs matter by EGFR gene interference slow virus carrier in slow virus
Under grain, the auxiliary of cell line, formed by virus packaging.
More excellent, the EGFR gene interference slow virus carrier contains the foregoing point of gene piece of EGFR gene shRNA of coding
Section, can express the EGFR gene shRNA.
The DNA sequence dna for encoding the EGFR gene shRNA genetic fragments contains SEQ ID NO:Sequence shown in 2 and its complementation
Sequence.
In pharmaceutical composition of the invention, specific silence AURKA gene expressions, and specific silence EGFR gene table
The active ingredient for reaching has played the effect of Synergistic treatment；The embodiment of the present invention is recorded, the dual-gene growth of cancer cells suppression struck after subtracting
Rate processed be significantly greater than single-gene strike subtract group plus and, show the material of specific silence AURKA gene expressions with specific silence
The material collaboration of EGFR gene expression suppresses the propagation of tumour cell.
Further, medicine of the present invention or pharmaceutical composition contain siRNA described in 1~99wt%, shRNA, base
Because of RNA construct and/or gene interference slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
When preparing medicine, generally active ingredient is mixed with excipient, or use figuration dilution agent, or Bao Ke with capsule or
In the carrier that sachet is present.When excipient plays diluent, it can be solid, semi-solid or fluent material conduct
The medium of excipient, carrier or active component.Therefore, composition can be tablet, pill, pulvis, solution, syrup, go out
Bacterium injection solution etc..The example of suitable excipient includes:Lactose, glucose, sucrose, sorbierite, mannitol, starch, crystallite
Cellulose, polyvinylpyrrolidone, cellulose, water etc..Preparation may also include：Wetting agent, emulsifying agent, preservative (such as hydroxy benzenes
Methyl formate and propyl ester), sweetener etc..
Beneficial effects of the present invention are：SiRNA or the nucleic acid construct comprising the sequences of small interfering RNAs that the present invention is provided
Body, slow virus are capable of the expression of specificity suppression people's AURKA genes, especially slow virus, individually, or can be targetted with EGFR slow
Virus collaboration suppresses the growth of tumour cell, promotes apoptosis of tumor cells, significant in oncotherapy.In the present invention
AURKA genes may act as single oncotherapy target, it is also possible to as EGFR gene Synergistic treatment target, in tumour
It is significant in treatment.
Brief description of the drawings
Fig. 1：GV115 Plasmid diagrams
Fig. 2：GV113 Plasmid diagrams
Fig. 3：AURKA shRNA plasmid identification figures
1#：Negative control（ddH2O）；2#：Negative control（It is unloaded to connect control group certainly）
3#：Marker is followed successively by 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp from top to bottom
4#~8#：AURKA shRNA1-5 transformants are identified
Fig. 4：EGFR shRNA plasmid identification figures
1#：Negative control（ddH2O）
2#：Negative control（It is unloaded to connect control group certainly）
3#：Marker is followed successively by 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp from top to bottom
4#~8#：EGFR shRNA1-5 transformants are identified
Fig. 5：AURKA shRNA slow virus and EGFR shRNA slow virus contaminated human lung cancer H1299 cells after 5 days simultaneously,
Significantly inhibit cell propagation
Fig. 6：AURKA shRNA slow virus and EGFR shRNA slow virus contaminated human colon carcinoma RKO cells after 5 days simultaneously,
Significantly inhibit cell propagation
Specific embodiment
The present invention is expanded on further with reference to embodiment.It should be understood that embodiment is merely to illustrate the present invention, and it is unrestricted
The scope of the present invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared formula is according to conventional strip in embodiment
Part, such as ［ beautiful ］ Sambrook.J write；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing：Science Press
The condition of condition or the manufacturer suggestion described in 2002 is carried out or configured.
Preparation of the embodiment 1 for people AURKA genes and EGFR gene RNAi slow virus
1. slow virus carrier builds
1）Build the slow virus carrier for people AURKA genes and EGFR gene
AURKA is transferred from Genbank（NM_177990）And EGFR gene（NM_201282）Information；Using Shanghai Ji Kaiji
Because the design software Genechem designs of chemical technology Co., Ltd are for AURKA genes and the effective siRNA of EGFR gene
Target spot.Preliminary screening obtains having the siRNA target sequences for substantially suppressing AURKA gene expression functions（SEQ ID NO.1）With
Substantially suppress the siRNA target sequences of EGFR gene expressive function（SEQ ID NO.2）.Carried out by Genbank databases
BLAST is analyzed, and determines that it does not produce interference effect to any other gene.
Table 1siRNA target sequences
| SEQ ID NO. | TargetSeq | Initiation site | Target gene |
| 1 | GAAAGCTCCACATCAATAA | 1731 | AURKA |
| 2 | GGCTGGTTATGTCCTCATT | 499 | EGFR |
For siRNA target spots（SEQ ID NO：1）Synthesize the double-strand of two ends I containing Age and EcoR I restriction enzyme site cohesive ends
DNA Oligo sequences（Table 2）；GV115 carriers are acted on Age I and EcoR I restriction enzymes（Belt carrier green fluorescence
Mark, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 1）, linearize it, agarose gel electrophoresis identification digestion
Fragment, identifies positive fragment size for 341bp, and qualification result is shown in Fig. 3.
For siRNA target spots（SEQ ID NO：2）Synthesize the double-strand of two ends I containing Age and EcoR I restriction enzyme site cohesive ends
DNA Oligo sequences（Table 3）.GV113 carriers are acted on Age I and EcoR I restriction enzymes（Belt carrier red fluorescence
Mark, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 2）, linearize it, agarose gel electrophoresis identification digestion
Fragment, identifies positive fragment size for 341bp, and qualification result is shown in Fig. 4.
The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 2
The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 3
Double digestion is linearized by T4DNA ligases（Digestion system as shown in table 4,37 DEG C, reacts 1h）Carrier DNA
Connected with the double-stranded DNA Oligo for having purified, in appropriate buffer system（Linked system is as shown in table 5）In connected in 16 DEG C
At night, reclaim connection product.Fresh competent escherichia coli cell prepared by connection product conversion calcium chloride（Conversion operation is joined
Examine：55-56 pages of the Molecular Cloning:A Laboratory guide second edition）.
Bacterium clone surface being grown in connection converted product to be stained with, being dissolved in 10 μ l LB culture mediums, mixing takes 1 μ l as mould
Plate；The upstream and downstream of RNAi sequences in slow virus carrier, designs general PCR primer upstream primer sequence：5’-
CCTATTTCCCATGATTCCTTCATA-3’（SEQ ID NO：7）；Downstream primer sequence：5’-
GTAATACGGTTATCCACGCG-3’（SEQ ID NO：8）, enter performing PCR identification experiment（PCR reaction systems such as table 6, reacts bar
Part such as table 7）.Identify that PCR positive clone is sequenced and is compared analysis, what the correct clone of comparison as successfully constructed contains
There are SEQ ID NO:1 or SEQ ID NO:2 RNAi carrier, is respectively designated as AURKA-shRNA-plasmid and EGFR-
shRNA-plasmid。
2）Build GV115 negative control plasmids
Negative control siRNA target sequences are 5 '-TTCTCCGAACGTGTCACGT-3 '（SEQ ID NO：13）.Build negative
During control plasmid, the double-stranded DNA Oligo of two ends I containing Age and EcoR I restriction enzyme site cohesive ends is synthesized for Scr siRNA target spots
Sequence（Table 8）, remaining construction method, authentication method and condition are with AURKA-shRNA-plasmid and EGFR-shRNA-
plasmid。
The vector plasmid endonuclease reaction system of table 4
| Reagent | Volume (μ l) |
| Vector plasmid (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| ddH2O | 40.5 |
| Total | 50.0 |
The carrier DNA of table 5 and double-stranded DNA Oligo coupled reaction systems
| Reagent | Positive control (μ l) | From even control (μ l) | Connection group (μ l) |
| The carrier DNA (100ng/ μ l) of linearisation | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer solutions | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligases | 1.0 | 1.0 | 1.0 |
| ddH2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6PCR reaction systems
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Sense primer | 0.4 |
| Anti-sense primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 7PCR reaction system program settings
The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 8
| Numbering | 5’ | Neck | Ring | Neck | 3’ | |
| 14 | Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | CTCGAG | ACGTGACACGTTCGGAGAA | TTTTTG |
| 15 | Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | CTCGAG | ACGTGACACGTTCGGAGAA |
2. packaging obtains AURKA genes interference slow virus and EGFR gene interference slow virus
1）AURKA genes disturb slow virus
RNAi plasmids AURKA-shRNA-plasmid is extracted with the plasmid extraction kit of Qiagen companies to be configured to
100ng/ μ l storing liquids.24h before transfection, with HEKC's 293T cells of Trypsin Induced exponential phase, with containing 10%
The DMEM complete mediums adjustment cell density of hyclone is 1.5 × 105Cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO2Training
Support culture in case.Can be used to transfect when cell density reaches 70%-80%.2h before transfection, suctions out original culture medium, adds
1.5ml fresh complete medium.
According to the explanation of the MISSION Lentiviral Packaging Mix kits of Sigma-aldrich companies,
To addition Packing Mix in a sterile centrifugation tube（PVM）20 μ l, PEI12 μ l, the μ l of plasma-free DMEM medium 400, take 20 μ l
The DNA of above-mentioned extracting, adds to above-mentioned PVM/PEI/DMEM mixed liquors.Above-mentioned transfection mixture is incubated at room temperature
15min, is transferred in the culture medium of HEKC's 293T cells, 37 DEG C, 5%CO2Culture 16h in incubator.Discard containing turn
The culture medium of mixture is contaminated, PBS solution washing adds complete medium 2ml, continues to cultivate 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration units（Millipore）Purifying and the slow disease of concentration
Poison, step is as follows：（1）4 DEG C, 4000g centrifugation 10min remove cell fragment；（2）0.45 μm of filter filtering supernatant is in 40ml
In ultracentrifugation pipe；（3）4000g is centrifuged, 10-15min, to the viral concentration volume for needing；（4）After centrifugation terminates, will filter
Cup and following filtered solution collection cups are separated, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than
1000g；（5）Centrifuge Cup is removed from sample collection cup, the interference slow virus concentration of AURKA genes is in sample collection cup
Liquid.By the packing of viral concentration liquid after -80 degrees Celsius of preservations.
2）The packaging process of EGFR gene interference slow virus disturbs slow virus with AURKA genes.
3）Negative control slow virus packaging process disturbs slow virus with CALM1 genes.
Embodiment 2AURKA genes disturb the oncotherapy synergy of slow virus and EGFR slow virus
1. experimental technique
Pancreatin digestion is carried out to the human lung cancer H1299 cells in exponential phase and colon cancer RKO cells respectively, is made
Cell suspension（Cell number is about 5 × 104/ml）It is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infection
Plural number（H1299MOI is that the MOI of 5, RKO is 5）, while set experimental group and control group, experimental group with the titre of 0.025uL be 6
×108The AURKA genes interference slow virus of TU/mL and the titre of 0.03uL are 5 × 108The EGFR gene interference slow virus of TU/mL
Be added in cancer cell nutrient solution, control group with the titre of 0.03uL be 5 × 108The comparison virus of TU/mL are added to cancer cell
In nutrient solution.
Culture medium is changed after culture 24h, after time of infection reaches 5 days, each experimental group in exponential phase is collected.
Complete medium is resuspended into cell suspension（2×104/ml）, 2000/hole is about with cell density, it is inoculated with 96 orifice plates.Every group 5
Individual multiple holes, per the μ l of hole 100.After completing plate, 37 DEG C, 5%CO are put2Incubator culture.Since after bed board second day, use daily
Cellomics ArrayScan VTI High content screening analyzers（Thermo Fisher）Detection read plate once, read by continuous detection
Plate 5 days.By adjusting the |input paramete of Cellomics arrayscan, each scanning holes in each experimental group is calculated exactly
The independent quantity with green cells in plate（Only infection AURKA genes disturb the cell of slow virus）, and individually redly
The quantity of fluorecyte（Only infection EGFR gene disturbs the cell of slow virus）, and it is simultaneously thin with green fluorescence and red fluorescence
The quantity of born of the same parents（AURKA genes interference slow virus is infected simultaneously and EGFR gene disturbs the cell of slow virus）, data are united
Meter is drawn, and draws cell growth curve.
2. experimental result
The result of cell growth curve is shown in Fig. 5-6, as a result shows：Infect AURKA shRNA slow virus and EGFR simultaneously
After the human lung cancer H1299 cells of shRNA slow virus cultivate 5 days in vitro, vigor cell proliferation times decline compared with control group
88.96%, individually infect EGFR shRNA slow virus human lung cancer H1299 cells cultivate 5 days in vitro after, vigor cell
Proliferation times have dropped 37.69% compared with control group, individually infect the human lung cancer H1299 cells of AURKA shRNA slow virus
After cultivating 5 days in vitro, vigor cell proliferation times have dropped 43.01% compared with control group；Infect AURKA simultaneously
After the human colon carcinoma RKO cells of shRNA slow virus and EGFR shRNA slow virus cultivate 5 days in vitro, vigor cell propagation times
Number have dropped 71.21% compared with control group, individually infect the human colon carcinoma RKO cells of EGFR shRNA slow virus in vitro
After culture 5 days, vigor cell proliferation times have dropped 26.67% compared with control group, individually infect AURKA shRNA sick slowly
After the human colon carcinoma RKO cells of poison cultivate 5 days in vitro, vigor cell proliferation times have dropped 32.05% compared with control group；
Should test result indicate that, the dual-gene inhibitory rate of cell growth struck after subtracting struck more than single-gene subtract group plus and, table
Bright AURKA genes shRNA slow virus can cooperate with the propagation for suppressing tumour cell with EGFR gene shRNA slow virus.
Claims (7)
1. people AURKA genes and Human epidermal growth factor receptor the gene collaboration for separate are directed to tumour cell RNA interference effects as medicine or preparation
Purposes of the target in preparing or screening anti-tumor medicine, the tumour is selected from lung cancer or colon cancer；The people AURKA that will be separate
Gene and Human epidermal growth factor receptor gene include both sides content for preparing or screening anti-tumor medicine：First, by people's AURKA genes
It is applied to prepare anti-tumor medicine for the action target of tumour cell as medicine or preparation with Human epidermal growth factor receptor gene；Second,
People AURKA genes and Human epidermal growth factor receptor gene are applied into screening tumour for the action target of tumour cell as medicine or preparation to control
Treat medicine；People AURKA genes and Human epidermal growth factor receptor gene are applied to system as medicine or preparation for the action target of tumour cell
Standby anti-tumor medicine is specifically referred to：By AURKA genes and Human epidermal growth factor receptor gene collectively as the target of RNA interference effects, develop
Can simultaneously for two kinds of anti-tumor medicines or preparation of gene, so as to reduce AURKA genes and Human epidermal growth factor receptor base in tumour cell
The expression of cause；Or, develop difference using AURKA genes and Human epidermal growth factor receptor gene as the target of RNA interference effects
For two kinds of anti-tumor medicines of gene, so as to obtaining, AURKA genes and Human epidermal growth factor receptor gene expression in tumour cell can be reduced
The anti-tumor medicine or preparation of level, the target sequence of the AURKA genes is SEQ ID NO:Sequence shown in 1；The EGFR
The target sequence of gene, is SEQ ID NO:Sequence shown in 2.
2. a kind of nucleic acid molecules medicine for treating tumour, its active ingredient contains reduces AURKA gene expressions in tumour cell
The nucleic acid molecules of separation, and reduce the nucleic acid molecules of the separation of EGFR gene expression in tumour cell；
The nucleic acid molecules of the separation of AURKA gene expressions are included in the reduction tumour cell：
A) AURKA genes double-stranded RNA, in the AURKA genes double-stranded RNA containing can under stringent condition with AURKA genes
The nucleotide sequence of hybridization, the AURKA genes double-stranded RNA includes the first chain and the second chain, first chain and described second
Chain complementation is collectively forming RNA dimers, and the sequence of first chain is essentially identical with the target sequence of AURKA genes；Or
B) AURKA genes shRNA, in the AURKA genes shRNA containing can under stringent condition with AURKA gene recombinations
Nucleotide sequence, the AURKA genes shRNA includes positive-sense strand fragment and antisense strand fragment, and connects the positive-sense strand
The sequence of the loop-stem structure of fragment and antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and described
The sequence of positive-sense strand fragment is essentially identical with the target sequence of AURKA genes；The target sequence of the AURKA genes is SEQ ID NO:
Sequence shown in 1；
The nucleic acid molecules of the separation of EGFR gene expression are included in the reduction tumour cell：
1) EGFR gene double-stranded RNA, containing in the EGFR gene double-stranded RNA can hybridize under stringent condition with EGFR gene
Nucleotide sequence；The EGFR gene double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary
RNA dimers are collectively forming, and the sequence of first chain is essentially identical with the target sequence of EGFR gene；Or
2) EGFR gene shRNA, contains the core that can hybridize with EGFR gene under stringent condition in the EGFR gene shRNA
Nucleotide sequence；The EGFR gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connect the positive-sense strand fragment and
The sequence of the loop-stem structure of antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and the positive-sense strand
The sequence of fragment is essentially identical with the target sequence of EGFR gene；The target sequence of the EGFR gene, is SEQ ID NO:Sequence shown in 2
Row.
3. the nucleic acid molecules medicine of tumour is treated as claimed in claim 2, it is characterised in that the double-stranded RNA is small interference
RNA, and AURKA genes the first chain of siRNA sequence such as SEQ ID NO：Shown in 9；The AURKA genes shRNA's
Sequence such as SEQ ID NO:Shown in 11.
4. a kind of slow virus carrier medicine for treating tumour, its active ingredient contain AURKA gene RNA constructs and
EGFR gene RNA construct, the AURKA genes RNA construct contains the coding claim any rights of 2-3
It is required that the genetic fragment of the AURKA genes shRNA in the nucleic acid molecules of the separation, can express the AURKA genes shRNA；
The EGFR gene RNA construct contains in nucleic acid molecules medicine described in coding claim 2-3 any claims
The genetic fragment of EGFR gene shRNA.
5. the slow virus carrier medicine of tumour is treated as claimed in claim 4, it is characterised in that the AURKA genes interference
Nucleic acid construct is that AURKA genes disturb slow virus carrier；The EGFR gene RNA construct is disturbed for EGFR gene
Slow virus carrier.
6. a kind of slow virus medicine for treating tumour, its active ingredient contains AURKA genes interference slow virus and EGFR gene is dry
Slow virus is disturbed, the AURKA genes interference slow virus is as in the slow virus carrier medicine that tumour is treated described in claim 5
AURKA genes disturb slow virus carrier under slow virus packaging plasmid, the auxiliary of cell line, are formed by virus packaging；It is described
EGFR gene disturbs slow virus as the slow disease of EGFR gene interference in the slow virus carrier medicine that tumour is treated described in claim 5
Poisonous carrier is formed under slow virus packaging plasmid, the auxiliary of cell line by virus packaging.
7. a kind of pharmaceutical composition for treating lung cancer or colon cancer, its active ingredient contains claim 2-3 any claims
The slow virus carrier medicine of the nucleic acid molecules medicine of the treatment tumour, treatment tumour described in claim 4-5 any claims
At least one in the slow virus medicine of tumour is treated described in thing and claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310230959.XA CN104225617B (en) | 2013-06-09 | 2013-06-09 | The purposes and its related drugs of people's AURKA gene therapy tumours |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310230959.XA CN104225617B (en) | 2013-06-09 | 2013-06-09 | The purposes and its related drugs of people's AURKA gene therapy tumours |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104225617A CN104225617A (en) | 2014-12-24 |
| CN104225617B true CN104225617B (en) | 2017-07-07 |
Family
ID=52215087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310230959.XA Active CN104225617B (en) | 2013-06-09 | 2013-06-09 | The purposes and its related drugs of people's AURKA gene therapy tumours |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104225617B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803053B (en) * | 2014-12-31 | 2021-03-16 | 上海吉凯基因科技有限公司 | Application of human RBM17 gene and related medicine thereof |
| CN110872599A (en) * | 2018-08-29 | 2020-03-10 | 徐州医科大学 | AURKA/UHRF1 double-gene co-interference lentivirus and application thereof in drugs for treating colorectal cancer |
| CN109197781B (en) * | 2018-09-14 | 2021-04-06 | 徐州医科大学 | Construction method of AURKA-CKO1-N conditional gene knockout mouse model |
| CN112980840A (en) * | 2019-12-17 | 2021-06-18 | 南京大学 | Multi-targeted siRNA for cancer therapy |
| CN114875032B (en) * | 2022-06-30 | 2022-11-11 | 浙江省肿瘤医院 | Overexpression AURKA gene plasmid and construction method and application thereof |
-
2013
- 2013-06-09 CN CN201310230959.XA patent/CN104225617B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| AURKA在CD24表型乳腺癌干细胞发展、EMT和远处转移中的作用;刘铁菊;《中国博士学位论文全文数据库（医药卫生科技辑）》;20101215;E072-119 * |
| 以 EGFR 为靶点的肿瘤分子靶向药物研究进展;杨雅琼等;《中国生物工程杂志》;20121231;91-96 * |
| 以EGFR为靶点siRNA的初步研究;江智茂;《中国优秀硕士学位论文全文数据库（医药卫生科技辑）》;20070915;E059-31 * |
| 癌基因AURKA在肿瘤发生发展中作用机制的研究;何顺;《中国博士学位论文全文数据库（医药卫生科技辑）》;20111215;E072-7 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104225617A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN104225619B (en) | The purposes and its related drugs of people's ILK gene therapy tumours | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN104225618B (en) | Application of human NLK gene and EGFR gene in curing tumors and related drugs | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN104232744B (en) | Application of human CIT gene and EGFR gene in curing tumors and related drugs | |
| CN104232743B (en) | People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN103301474B (en) | Usage and related drugs of human RNF40 gene | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
| CN103421887B (en) | The purposes and its related drugs of CIT gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: SHANGHAI JIKAI GENE CHEMICAL TECHNOLOGY INC. Free format text: FORMER OWNER: SUZHOU GENECHEM TECHNOLOGY CO., LTD. Effective date: 20150722 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150722 Address after: 200233 room 619-21, Guiping Road, Shanghai, Xuhui District, 680 Applicant after: Shanghai Genechem Co., Ltd. Address before: 215316 No. 757 North Gate Road, Suzhou, Jiangsu, Yushan Applicant before: Suzhou Jikai Gene Technology Co., Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200603 Address after: 201203 room 101-A, 328 Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI GENECHEM TECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |