CN104232743B - People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor - Google Patents
People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor Download PDFInfo
- Publication number
- CN104232743B CN104232743B CN201310231941.1A CN201310231941A CN104232743B CN 104232743 B CN104232743 B CN 104232743B CN 201310231941 A CN201310231941 A CN 201310231941A CN 104232743 B CN104232743 B CN 104232743B
- Authority
- CN
- China
- Prior art keywords
- gene
- cdkl3
- slow virus
- medicine
- egfr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Plant Pathology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to biological technical field, specifically disclose single people's CDKL3 gene；And people's CDKL3 gene and Human epidermal growth factor receptor gene are as collaborative dispenser target, the purposes in preparation or screening anti-tumor medicine.The present invention construct the most further CDKL3 gene siRNA, CDKL3 gene interference slow virus carrier, CDKL3 gene interference slow virus, and disclose they with the purposes in EGFR gene Synergistic treatment tumor.SiRNA that the present invention provides or comprise the slow virus carrier of this siRNA sequence, slow virus can specificity suppression people's CDKL3 gene and/or the expression of Human epidermal growth factor receptor gene, especially slow virus, the CDKL3 gene interference slow virus of the present invention individually or can work in coordination with the growth of suppression tumor cell with EGFR gene interference slow virus, promote apoptosis of tumor cells, significant in oncotherapy.
Description
Technical field
The present invention relates to biological technical field, more particularly to single people's CDKL3 gene；And people's CDKL3 gene and
The purposes of Human epidermal growth factor receptor gene Synergistic treatment tumor and related drugs thereof.
Background technology
The gene therapy of tumor at present has been achieved for the most quickly developing, but up to now, however it remains a lot
The problem needing to solve.Being currently used for the gene of therapy of tumor very little, the gene that can suppress tumor growth is few in number, anxious
More available gene need to be provided.Further, since the generation of tumor, develop, the process such as transfer is that a polygenes participates in, relates to
And the complex networks system of many signal paths, therefore individual gene treatment or single therapy method often offer limited effectiveness.Therefore,
The emphasis of following gene therapy development will be to excavate and identify the gene having important value clinically, explore and multiple have not
Treat and by polygenes targeted drug therapeutic alliance etc. with the gene association of Antitumor Mechanism.
CDKL3 is analogous to mitogen activated protein kinases (MAPK) family and cell cycle dependent kinase
(CDK) family serineprotein kinase (Yee KW, Moore SJ, Midmer M, Zanke BW, Tong F, Hedley D,
Minden MD.NKIAMRE,a novel conserved CDC2-related kinase with features of both
mitogen-activated protein kinases and cyc-lin-dependent kinases.Biochem
Biophys Res Commun2003,308:784-792.Hanks SK,Quinn AM,Hunter T.The protein
kinase family:con-served features and deduced phylogeny of the catalytic
Domains.Science1988,241:42-52.), these two extended familys are involved in signal transduction, cell cycle regulating, cell move
Physiological process (Miyata Y, the Nishida E.Distantly related cousins of MAP such as shifting and cell survival
kinase:biochemical properties and possible physiological functions.Biochem
Biophys Res Commun1999,266:291-295.).
CDKL3(cyclin-dependent kinase-like3) gene code one forms many by 455 aminoacid
Peptide, the most named NKIAMRE, it is positioned in Cytoplasm it is considered to be the one of RNA polymerase C-terminal phosphorylating kinase complex
Individual constituent (Yee KW, Moore SJ, Midmer M, Zanke BW, Tong F, Hedley D, Minden
MD.NKIAMRE,a novel conserved CDC2-related kinase with features of both
mitogen-activated protein kinases and cyc-lin-dependent kinases.Biochem
Biophys Res Commun2003;308:784-792.Midmer M,Haq R,Squire JA,Zanke
BW.Identification of NKI-AMRE,the human homologue to the mitogen-activated
pro-tein kinase-/cyclin-dependent kinase-related protein kinase NKIATRE,and
its loss in leukemic blasts with chromosome arm5q deletion.Cancer Res1999;59:
4069-4074.).As shown in gene name, CDKL3 in sequence and CDK3(cyclin-dependent kinase3) phase
Seemingly, and CDK3 be coding one for the mammalian cell G1 phase to S phase change very important kinases (Hofmann F,
Livingston DM.Differential effects of cdk2and cdk3on the control of pBb and
E2F function during G1exit.Genes Dev1996;10:851-861).The protein of CDKL3 coding also contains
The TXY(Threonine-X-Tyrosine of one high conservative also existed in MAPK family and CDK family) motif
(Hanks SK, Quinn AM, Hunter T:The protein kinase family:con-served features and
deduced phylogeny of the catalytic domains.Science1988;241:42-52.).It addition, it is sub-at I
Two aminoacid (serine and tyrosine) residue in district and an ATP binding domain and a typical CDK negative regulator site and
It is similar.NKIAMRE albumen is considered as a cyclin binding structural domain, and this domain is present in CDK too
In (Midmer M, Haq R, Squire JA, Zanke BW.Identification of NKI-AMRE, the human
homologue to the mitogen-activated pro-tein kinase-/cyclin-dependent kinase-
related protein kinase NKIATRE,and its loss in leukemic blasts with
chromosome arm5q deletion.Cancer Res1999;59:4069-4074.).Above research prompting, CDKL3
Gene seems to play cell cycle conversion or the role of cell regulate and control, and it has several different function, including ATP& nucleoside
Acid combination, kinase activity and transferase active, all these function all controls closely with cell cycle regulating and cell proliferation
Relevant.There are some researches show, CDKL3 gene and as the CDK3 gene of its homology, by promoting cell growth rate, shortening stops
Demurrage, improve protein yield affect cell cycle (Matsuoka M, Matsuura Y, Semba K, Nishimoto I:
Molecular cloning of a cyclin-like protein associated with cyclin-dependent
kinase3(cdk3)in vivo.Biochem Biophys Res Commun2000;273:442-447.).Also have research aobvious
Show, and peripheral blood lymphocyte is comparatively speaking, can detect in two aggressive primary cutaneous types
The high expressed of NKIAMRE albumen (Thompson MA, Stumph J, Henrickson SE, Rosenwald A, Wang Q,
Olson S,Brandt SJ,Roberts J,Zhang X,Shyr Y,Kinney MC.Differ-ential gene
expression in anaplastic lymphoma kinase-positive and anaplastic lymphoma
kinase-negative anaplastic large cell lymphomas.Hum Pathol2005;36:494-504.).
These find that prompting CDKL3 gene plays a role in Tumorigenesis and neoplastic process.
EGF-R ELISA (epidermalgrowth factor receptor, EGFR) EGFR is a kind of cross-film
Protein, belongs to ErbB receptor family member, and its part (EGF, TGF-α etc.) is combined with EGFR extracellular fragment and is allowed to dimerization, by
This cause intracellular section tyrosine kinase activation and a series of signal transduction cascade reaction, promote cell proliferation, angiogenesis,
Transfer also inhibited apoptosis (the treatment advanced colorectal cancer latest developments of Liang Houjie, Zou Lan .EGFR targeted drug. China's prescription
Medicine 2009;84:58-61.), thus lead oncogenic generation.Numerous studies find that EGFR gene crosses table in kinds of tumors tissue
Reach or abnormal activation, so that tumor cell proliferation, invasion and attack and transfer ability strengthen.It is multiple that EGFR has become according to clinical verification
Therapy target (Ciardiello F, the Tortora G.EGFR antagonists in cancer of tumor types
treatment.N Engl J Med2008;358:1160-1174.).
RNAi is the sequence-specific PTGS phenomenon utilizing double chain RNA mediate, it has also become research gene
A kind of emerging effective means of function, and it is expected to become instrument (the Izquierdo M.Short of the disease gene treatments such as tumor
interfering RNAs as a tool for cancer gene therapy.Cancer Gene Ther.2005;12
(3): 217-27.).Slow virus (lentivirus) carrier is efficient gene transfer instrument, is mainly used in infecting routine side
The cell that method transfection efficiency is relatively low, such as primary cell etc..Lentiviral particle can simultaneously infection development and the cell of non-proliferative, and sense
It is more stable, lasting to contaminate.Use slow virus carrier, the high expressed of specific gene can be realized, it is also possible to express hairpin RNA
(short hairpin RNA, shRNA) lowers the table of certain gene in RNA interference (RNA interference, RNAi) mode
Reach.The present invention intends the RNAi technology research CDKL3 gene using lentivirus mediated and suppresses tumor cell collaborative with EGFR gene
Function in propagation, the No operation clinical treatment for malignant tumor provides theoretical foundation.
Summary of the invention
It is an object of the invention to the target disclosing CDKL3 gene as treatment of cancer, the purposes for the treatment of tumor and
Related drugs；And by CDKL3 gene and EGFR gene collectively as the target for the treatment of of cancer, by the most reticent CDKL3 base
Cause and the expression of EGFR gene, it is achieved the purposes of Synergistic treatment tumor, and anti-tumor medicine.
The present invention, with RNA interference as means, have studied single CDKL3 gene and occurs and developing effect in tumor,
And, CDKL3 gene occurs and developing synergism in tumor with EGFR gene, discloses a kind of suppression or reduces tumor
The method that cell grows, breeds, breaks up and/or survives, the method includes: using one to tumor cell can specificity suppression
The transcribing of CDKL3 gene and/or EGFR gene, translate, or can specificity suppression CDKL3 albumen and/or EGFR protein expression
Activity material, suppress the growth of tumor cell with this, breed, break up or survive.
First aspect present invention, the people's CDKL3 gene disclosing separation in preparation or screens anti-tumor medicine, or
Prepare the purposes in diagnosing tumor medicine.
Described tumor can be propagation and people's CDKL3 gene of its tumor cell to express relevant any one swollen
Tumor；Further, for a kind of malignant tumor, it is selected from: pulmonary carcinoma.
In the present invention, described people's CDKL3 gene is applied to preparation as the action target for tumor cell or screening is swollen
Tumor medicine, or prepare diagnosing tumor medicine.Further, the described action target for tumor cell is RNA interference
Action target.
Described be used for people's CDKL3 gene of separation preparing or screen anti-tumor medicine include of both content: its
One, it is applied to prepare anti-tumor medicine for the action target of tumor cell as medicine or preparation using people's CDKL3 gene；Its
Two, it is applied to screen anti-tumor medicine for the action target of tumor cell as medicine or preparation using people's CDKL3 gene.
Described it is applied to prepare oncotherapy for the action target of tumor cell as medicine or preparation using CDKL3 gene
Medicine specifically refers to: using CDKL3 gene as the target of RNA interference effect, develop the medicine for tumor cell or preparation,
Thus the expression of CDKL3 gene in improving or reduce tumor cell.
Described it is applied to screen oncotherapy for the action target of tumor cell as medicine or preparation using CDKL3 gene
Medicine specifically refers to: using CDKL3 gene as effective object, screen medicine or preparation, can suppress or promote to find
Enter the medicine of people's CDKL3 gene expression as oncotherapy drug candidate.CDKL3 gene little molecule interference as described in the present invention
RNA(siRNA) i.e. obtain for effective object screening with people's CDKL3 gene, can be used as that there is suppression tumor cell proliferation and make
Medicine.In addition, such as antibody drug, small-molecule drug etc. also can be using right as effect to CDKL3 gene and albumen thereof
As.
Described it is used for preparing diagnosing tumor medicine by CDKL3 gene, refers to swell CDKL3 gene expression product as one
Tumor diagnosis index is applied to the preparation of diagnosing tumor medicine.
Described anti-tumor medicine is can to suppress transcribing or translating of CDKL3 gene by specificity, or can press down by specificity
The expression of CDKL3 albumen processed or the molecule of activity, thus reduce the expression of CDKL3 gene in tumor cell, reach suppression
The propagation of tumor cell, the purpose growing, break up and/or surviving.
First aspect present invention, the people's CDKL3 gene and the Human epidermal growth factor receptor gene that also disclose separation in preparation or screen tumor
Medicine, or the purposes in preparing diagnosing tumor medicine.
In the present invention, described people's CDKL3 gene and Human epidermal growth factor receptor gene are applied to as the action target for tumor cell
Preparation or screening anti-tumor medicine, or prepare diagnosing tumor medicine.Further, the described effect target for tumor cell
It is designated as RNA interference effect target.
Described people's CDKL3 gene by separation and Human epidermal growth factor receptor gene are used for preparing or screen anti-tumor medicine and include two sides
The content in face: one, should for the action target of tumor cell as medicine or preparation using people's CDKL3 gene and Human epidermal growth factor receptor gene
For preparing anti-tumor medicine；Its two, using people's CDKL3 gene and Human epidermal growth factor receptor gene as medicine or preparation for tumor cell
Action target be applied to screen anti-tumor medicine.
Described people's CDKL3 gene and Human epidermal growth factor receptor gene are applied as medicine or preparation for the action target of tumor cell
Specifically refer in preparing anti-tumor medicine: by CDKL3 gene and Human epidermal growth factor receptor gene collectively as the target of RNA interference effect,
Development can be simultaneous for anti-tumor medicine or the preparation of two kinds of genes, thus improve or reduce CDKL3 gene in tumor cell
Expression with Human epidermal growth factor receptor gene；Or, using CDKL3 gene and Human epidermal growth factor receptor gene as the target of RNA interference effect,
Develop the anti-tumor medicine being respectively directed to two kinds of genes, thus obtain and can improve or reduce CDKL3 gene in tumor cell
Anti-tumor medicine or preparation with Human epidermal growth factor receptor gene expression dose.
Described people's CDKL3 gene and Human epidermal growth factor receptor gene are applied as medicine or preparation for the action target of tumor cell
Specifically refer in screening anti-tumor medicine: by people's CDKL3 gene and Human epidermal growth factor receptor gene simultaneously as effective object, medicine is entered
Row filter, to find the medicine that can affect (suppress or promote) people's CDKL3 gene expression respectively and impact (suppress or promote)
The medicine of Human epidermal growth factor receptor gene expression, then as oncotherapy alternative compositions medicine；Or find and can affect (suppression simultaneously
Or promote) medicine of people's CDKL3 gene and Human epidermal growth factor receptor gene expression is as oncotherapy drug candidate.As described in the present invention
CDKL3 gene small molecules interference RNA (siRNA), gene RNA construct, slow virus, and the little molecule of EGFR gene are dry
Disturb RNA(siRNA), gene RNA construct, slow virus, be all respectively act on CDKL3 gene and EGFR gene right
As screening obtains；When they are used in conjunction with, there is synergistic effect, than single a kind of material using effect more
Good；Can be used as the medicine with suppression tumor cell proliferation effect.In addition, such as antibody drug, small-molecule drug etc. is also
Can be using people's CDKL3 gene and Human epidermal growth factor receptor gene and albumen thereof as effective object.
Described it is used for preparing diagnosing tumor medicine by people's CDKL3 gene and Human epidermal growth factor receptor gene, refers to CDKL3 gene expression
Product and Human epidermal growth factor receptor gene expression product are applied to the preparation of tumour diagnostic reagent as diagnosing tumor index.
The described anti-tumor medicine of the present invention is can specificity suppression people's CDKL3 gene and/or Human epidermal growth factor receptor gene
Transcribe or translate, or people's CDKL3 gene and/or the expression of Human epidermal growth factor receptor gene or the molecule of activity can be suppressed by specificity, thus
Reduce tumor cell people's CDKL3 gene and/or the expression of Human epidermal growth factor receptor gene, reach to suppress the propagation of tumor cell, growth,
Differentiation, the purpose of survival.
The present invention preparation or screening anti-tumor medicine include but not limited to: nucleic acid molecules, carbohydrate, lipid,
Small-molecule chemical medicine (such as inhibitor), antibody medicine, polypeptide, albumen or interference slow virus.
Described nucleic acid molecules includes but not limited to: in antisense oligonucleotide, double-stranded RNA (dsRNA), ribozyme, ribonucleic acid
Cut siRNA (esiRNA) or short hairpin RNA (shRNA) prepared by enzyme III.
The amount of application of described anti-tumor medicine is enough to reduce transcribing or turning over of people's CDKL3 gene and Human epidermal growth factor receptor gene
Translate, or enough reduce people's CDKL3 albumen and the expression of Human epidermal growth factor receptor albumen or the dosage of activity.So that people's CDKL3 gene and people
The expression of EGFR gene is at least lowered 50%, 80%, 90%, 95% or 99%.
In the present invention, when people's CDKL3 gene and Human epidermal growth factor receptor gene carry out oncotherapy and medicine as collaborative dispenser target
During screening, it is the method disturbed by RNA, the target gene disturbed as RAN using people's CDKL3 gene and EGFR gene, reduces this
The expression of two genes.
Described tumor can be that the propagation of its tumor cell is relevant to the expression of people's CDKL3 gene and Human epidermal growth factor receptor gene
Any one tumor；Further, for a kind of malignant tumor, it is selected from: pulmonary carcinoma.
The method using forgoing neoplasms medicine treatment tumor is the expression by individually reducing people's CDKL3 gene
The propagation of suppression tumor cell reaches the purpose for the treatment of, or by reducing people's CDKL3 gene and Human epidermal growth factor receptor gene simultaneously
The propagation of expression suppression tumor cell reaches the purpose for the treatment of.Concrete, during treatment, can effectively reduce people CDKL3
The material of gene expression dose；Or, can will effectively reduce people's CDKL3 gene and the administering substances of Human epidermal growth factor receptor gene expression dose
In patient.
Second aspect present invention discloses a kind of nucleic acid molecules medicine treating tumor, and its effective ingredient contains reduction tumor
The nucleic acid molecules of the separation of CDKL3 gene expression in cell, and reduce the core of the separation that EGFR gene is expressed in tumor cell
Acid molecule；In described reduction tumor cell, the nucleic acid molecules of the separation of CDKL3 gene expression comprises:
A) CDKL3 gene double-stranded RNA, in described CDKL3 gene double-stranded RNA containing can under stringent condition with CDKL3
The nucleotide sequence of gene recombination；Or
B) CDKL3 gene shRNA, in described CDKL3 gene shRNA containing can under stringent condition with CDKL3 gene
The nucleotide sequence of hybridization；
In described reduction tumor cell, the nucleic acid molecules of the separation that EGFR gene is expressed comprises:
A.EGFR gene double-stranded RNA, in described EGFR gene double-stranded RNA containing can under stringent condition with EGFR gene
The nucleotide sequence of hybridization；Or
B.EGFR gene shRNA, containing hybridizing with EGFR gene under stringent condition in described EGFR gene shRNA
Nucleotide sequence.
Further, described tumor is pulmonary carcinoma.
Preferably, described CDKL3 gene double-stranded RNA comprises the first chain and the second chain, described first chain and described second chain
Complementation is collectively forming RNA dimer, and the sequence of described first chain is essentially identical with the target sequence of CDKL3 gene.
Preferably, it is mutual that described EGFR gene double-stranded RNA comprises the first chain and the second chain, described first chain and described second chain
Benefit is collectively forming RNA dimer, and the sequence of described first chain is essentially identical with the target sequence of EGFR gene.
Preferably, described CDKL3 gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects described justice
Chain fragment and the loop-stem structure of antisense strand fragment, described positive-sense strand fragment and the complementary of described antisense strand fragment, and institute
The sequence stating positive-sense strand fragment is essentially identical with the target sequence of CDKL3 gene.
Preferably, described EGFR gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects described positive-sense strand
Fragment and the loop-stem structure of antisense strand fragment, described positive-sense strand fragment and the complementary of described antisense strand fragment, and described
The sequence of positive-sense strand fragment is essentially identical with the target sequence of EGFR gene.
More excellent, the sequence of the loop-stem structure of described shRNA is selected from following arbitrary: UUCAAGAGA, AUG, CCC,
UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
More excellent, the target sequence of described CDKL3 gene, for sequence shown in SEQ ID NO:1；The target sequence of described EGFR gene
Row, for sequence shown in SEQ ID NO:2.
The target sequence of described CDKL3 gene is siRNA when specificity silence CDKL3 gene expression, with described
Fragment in the CDKL3 gene corresponding to mRNA fragment that siRNA complementation combines.In like manner, the target sequence of described EGFR gene is i.e.
For siRNA when specificity silence EGFR gene is expressed, the EGFR corresponding to mRNA fragment being combined with described siRNA complementation
Fragment in gene.
The length of described double-stranded RNA the first chain and the second chain is 15-27 nucleotide；It is also preferred that the left length is 19-23
Individual nucleotide；Optimal, length is 19,20 or 21 nucleotide.
Further, described double-stranded RNA is siRNA (siRNA).
Optimum, the sequence of CDKL3 gene siRNA the first chain as shown in SEQ ID NO:9, specially 5 '-
GGAGAUAUCUCAGAACCAA-3’.First chain of the CDKL3 gene siRNA shown in SEQ ID NO:9 is with SEQ ID NO:1
Shown sequence is a chain in the siRNA for people's CDKL3 gene of RNA interference target sequence design, this first chain
The effect of endogenous CDKL3 gene expression in specificity silence tumor cell can be played with the siRNA of the second chain composition.
Optimum, the sequence of EGFR gene siRNA the first chain as shown in SEQ ID NO:10, specially 5 '-
GGCUGGUUAUGUCCUCAUU-3’.First chain of EGFR gene siRNA shown in SEQ ID NO:10 is with SEQ ID NO:2
Shown sequence be RNA interference target sequence design the siRNA for Human epidermal growth factor receptor gene in a chain, this first chain with
The siRNA of the second chain composition can play the effect that in specificity silence tumor cell, endogenous EGFR gene is expressed.
Optimum, the sequence of described CDKL3 gene shRNA as shown in SEQ ID NO:11, particularly as follows: 5 '-
gaGGAGAUAUCUCAGAACCAA CUCGAG UUGGUUCUGAGAUAUCUCCUC-3’。
Optimum, the sequence of described EGFR gene shRNA as shown in SEQ ID NO:12, particularly as follows: 5 '-
GUGGCUGGUUAUGUCCUCAUUCUCGAG AAUGAGGACAUAACCAGCCAC-3’。
When being used as the medicine for the treatment of tumor, it is that double-stranded RNA or the shRNA of safe and effective amount are applied to mammal.
Concrete dosage is it is also contemplated that the factor such as route of administration, patient health situation, within the scope of these are all skilled practitioners technical ability.
Third aspect present invention, discloses a kind of slow virus carrier medicine treating tumor, and its effective ingredient contains CDKL3
Gene interference slow virus carrier and EGFR gene interference slow virus carrier, described CDKL3 gene interference slow virus carrier contains volume
The genetic fragment of the aforementioned CDKL3 gene shRNA of code, described EGFR gene interference slow virus carrier contains the aforementioned EGFR gene of coding
The genetic fragment of shRNA.
Further, described tumor is pulmonary carcinoma.
Described CDKL3 gene interference slow virus carrier is to be cloned into by the DNA fragmentation encoding aforementioned CDKL3 gene shRNA
Known carrier obtains, and described known carrier mostly is slow virus carrier, and described CDKL3 gene interference slow virus carrier is through virus bag
After dressing up as infectious virion, infected tumor's cell, and then transcribe out described shRNA, walked by enzyme action processing etc.
Suddenly, the described CDKL3 gene siRNA of final acquisition, for the expression of specificity silence CDKL3 gene.EGFR gene is disturbed
Slow virus carrier is with CDKL3 gene.
Encode the DNA sequence of described CDKL3 gene shRNA genetic fragment and contain sequence shown in SEQ ID NO:1 and mutually
Complementary series.The DNA sequence encoding described EGFR gene shRNA genetic fragment contains sequence and complementation thereof shown in SEQ ID NO:2
Sequence.
Further, gene of the present invention interference slow virus carrier is thin possibly together with promoter sequence and/or codes for tumor
The nucleotide sequence of the label can being detected in born of the same parents；Preferably, the described label being detected such as green fluorescent protein
(GFP).
Further, described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-
puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-
TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-
TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-
1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT-
DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、
Arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
Fourth aspect present invention, discloses a kind of slow virus medicine treating tumor, and its effective ingredient contains CDKL3 gene
Interference slow virus and EGFR gene interference slow virus, described CDKL3 gene interference slow virus is slow sick by the interference of aforementioned CDKL3 gene
Poisonous carrier slow virus packaging plasmid, cell line auxiliary under, through virus packaging form；Described EGFR gene interference slow virus
By aforementioned EGFR gene interference slow virus carrier slow virus packaging plasmid, cell line auxiliary under, through virus packaging form.
Further, described tumor is pulmonary carcinoma.
The slow virus of the present invention can infected tumor's cell produce and be respectively directed to the little molecule of CDKL3 gene or EGFR gene
RNA interfering, thus suppress the propagation of tumor cell.This CDKL3 gene interference slow virus and EGFR gene interference slow virus can be used
In preparation prevention or the medicine for the treatment of tumor.
Fifth aspect present invention, discloses a kind of pharmaceutical composition for treating pulmonary carcinoma, and its composition is containing aforementioned reduction
The nucleic acid molecules of the separation of CDKL3 gene expression, CDKL3 gene interference slow virus carrier, the interference of CDKL3 gene in tumor cell
At least one in slow virus；And, the nucleic acid molecules of separation of EGFR gene expression, EGFR base in aforementioned reduction tumor cell
Because of at least one in interference slow virus carrier, EGFR gene interference slow virus.
Preferably, mentioned component is the active ingredient of the pharmaceutical composition treating pulmonary carcinoma.
When being used as the medicine for the treatment of tumor, it is to be applied to the double-stranded RNA of safe and effective amount, shRNA or slow virus feed
Breast animal.Concrete dosage it is also contemplated that the factor such as route of administration, patient health situation, these be all skilled practitioners technical ability scope it
In.
In the pharmaceutical composition of the present invention, specificity silence CDKL3 gene expression, and specificity silence EGFR gene table
The effective ingredient reached has played the effect of Synergistic treatment；The embodiment of the present invention is recorded, and the dual-gene growth of cancer cells struck after subtracting presses down
Rate processed significantly greater than single-gene strike subtract group add and, show that the material of specificity silence CDKL3 gene expression is reticent with specificity
The material that EGFR gene is expressed works in coordination with the propagation of suppression tumor cell.
Further, medicine of the present invention or pharmaceutical composition contain siRNA, shRNA, base described in 1～99wt%
Because RNA construct and/or gene disturb slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
When preparing medicine, generally effective ingredient is mixed with excipient, or dilutes with excipient, or wrap in can with capsule or
In the carrier that sachet exists.When excipient plays diluent effect, it can be solid, semisolid or fluent material conduct
The medium of excipient, carrier or active component.Therefore, compositions can be tablet, pill, powder, solution, syrup, go out
Bacterium injection solution etc..The suitably example of excipient includes: lactose, glucose, sucrose, sorbitol, mannitol, starch, crystallite
Cellulose, polyvinylpyrrolidone, cellulose, water etc..Preparation may also include that wetting agent, emulsifying agent, preservative are (such as hydroxy benzenes
Methyl formate and propyl ester), sweeting agent etc..
The invention have the benefit that the siRNA that the present invention provides or the nucleic acid construct comprising this sequences of small interfering RNAs
Body, slow virus can the expression of specificity suppression people's CDKL3 gene, especially slow virus, can be individually or slow with EGFR targeting
The growth of virus collaborative suppression tumor cell, promotes apoptosis of tumor cells, significant in oncotherapy.In the present invention
CDKL3 gene may act as single oncotherapy target, it is also possible to as EGFR gene Synergistic treatment target, in tumor
In treatment significant.
Accompanying drawing explanation
Fig. 1: GV115 Plasmid diagram
Fig. 2: GV113 Plasmid diagram
Fig. 3: CDKL3shRNA plasmid identification figure
1#: negative control (ddH2O)；2#: negative control (unloaded from connecting matched group)
3#:Marker is followed successively by 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp from top to bottom
4#～8#:CDKL3shRNA1-5 transformant is identified
Fig. 4: EGFR shRNA plasmid identification figure
1#: negative control (ddH2O)
2#: negative control (unloaded from connecting matched group)
3#:Marker is followed successively by 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp from top to bottom
4#～8#:EGFR shRNA1-5 transformant is identified
Fig. 5: represent that CDKL3shRNA slow virus and EGFR shRNA slow virus contaminate people's pulmonary carcinoma H1299 cell 5 days simultaneously
After, significantly inhibit cell proliferation
Detailed description of the invention
The present invention is expanded on further below in conjunction with embodiment.Should be understood that embodiment is merely to illustrate the present invention, and unrestricted
The scope of the present invention.In embodiment, the experimental technique of unreceipted actual conditions and the reagent of undeclared formula are according to conventional strip
Part, as ［ beautiful ］ Sambrook.J etc. writes；Huang Peitang etc. translate.Molecular cloning texts guide, the third edition.Beijing: Science Press
The condition of the condition described in 2002 or manufacturer's suggestion carries out or configures.
Embodiment 1 is for people's CDKL3 gene and the preparation of EGFR gene RNAi slow virus
1. build for people's CDKL3 gene and the slow virus carrier of EGFR gene
CDKL3(NM_016508 is transferred from Genbank) and EGFR gene (NM_201282) information；Utilize Shanghai Ji Kaiji
Because the design software Genechem of chemical technology company limited designs for CDKL3 gene and the effective siRNA of EGFR gene
Target spot.Preliminary screening obtain having substantially suppression CDKL3 gene expression function siRNA target sequence (SEQ ID NO.1) and
Substantially suppress the siRNA target sequence (SEQ ID NO.2) of EGFR gene expressive function.Carried out by Genbank data base
BLAST analyzes, and determines that it does not produces interference effect to other gene any.
Table 1siRNA target sequence
| SEQ ID NO. | TargetSeq | Initiation site | Target gene |
| 1 | GGAGATATCTCAGAACCAA | 1220 | CDKL3 |
| 2 | GGCTGGTTATGTCCTCATT | 499 | EGFR |
For siRNA target spot (SEQ ID NO:1) synthesis two ends containing Age I and the double-strand of EcoR I restriction enzyme site cohesive end
DNA Oligo sequence (table 2)；GV115 carrier (belt carrier green fluorescence is acted on Age I and EcoR I restricted enzyme
Labelling, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 1) so that it is linearisation.
For siRNA target spot (SEQ ID NO:2) synthesis two ends containing Age I and the double-strand of EcoR I restriction enzyme site cohesive end
DNA Oligo sequence (table 3).GV113 carrier (belt carrier red fluorescence is acted on Age I and EcoR I restricted enzyme
Labelling, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 2) so that it is linearisation.
Table 2 two ends contain Age I and the double-stranded DNA Oligo of EcoR I restriction enzyme site cohesive end
Table 3 two ends contain Age I and the double-stranded DNA Oligo of EcoR I restriction enzyme site cohesive end
By T4DNA ligase by the carrier DNA of double digestion linearisation (enzyme action system is as shown in table 4,37 DEG C, reacts 1h)
The double-stranded DNA Oligo good with purification connects, and connects in 16 DEG C in suitable buffer system (linked system is as shown in table 5)
At night, reclaim and connect product.Fresh competent escherichia coli cell (conversion operation ginseng prepared by calcium chloride is converted by connecting product
Examine: Molecular Cloning: A Laboratory guide second edition 55-56 page).
Growing bacterium clone surface at connection converted product and be stained with, be dissolved in 10 μ l LB culture medium, mixing takes 1 μ l as mould
Plate；The upstream and downstream of RNAi sequence in slow virus carrier, designs general PCR primer forward primer sequence: 5 '-
CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:7)；Downstream primer sequence: 5 '-
GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:8), (PCR reaction system such as table 6 reacts bar to carry out PCR identification experiment
Part such as table 7).PCR being identified, positive clone checks order and comparison analysis, and PCR qualification result is shown in Fig. 3 and Fig. 4 respectively.Comparison
Correct clone be successfully construct containing SEQ ID NO:1 or the RNAi carrier of SEQ ID NO:2, be respectively designated as
CDKL3-shRNA-plasmid and EGFR-shRNA-plasmid.
2. build GV115 negative control plasmids
Negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO:13).Build feminine gender
During control plasmid, for Scr siRNA target spot synthesis two ends containing Age I and the double-stranded DNA Oligo of EcoR I restriction enzyme site cohesive end
Sequence (table 8), remaining construction method, authentication method and condition are all with CDKL3-shRNA-plasmid and EGFR-shRNA-
plasmid。
Table 4 vector plasmid endonuclease reaction system
| Reagent | Volume (μ l) |
| Vector plasmid (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
Table 5 carrier DNA and double-stranded DNA Oligo coupled reaction system
| Reagent | Positive control (μ l) | From even comparison (μ l) | Connection group (μ l) |
| Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 × T4 phage DNA ligase buffer | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligase | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6PCR reaction system
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Forward primer | 0.4 |
| Downstream primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH2O | 15.2 |
| Total | 20.0 |
Table 7PCR reaction system program setting
Table 8 two ends contain Age I and the double-stranded DNA Oligo of EcoR I restriction enzyme site cohesive end
| 5’ | Neck | Ring | Neck | 3’ | SEQ ID | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | CTCGAG | ACGTGACACGTTCGGAGAA | TTTTTG | 14 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | CTCGAG | ACGTGACACGTTCGGAGAA | 15 |
2. packaging obtains CDKL3 gene interference slow virus and EGFR gene interference slow virus
1) CDKL3 gene interference slow virus
Extract RNAi plasmid CDKL3-shRNA-plasmid with the plasmid extraction test kit of Qiagen company to be configured to
100ng/ μ l stores liquid.24h before transfection, with the HEKC 293T cell of trypsinization exponential phase, with containing 10%
It is 1.5 × 10 that the DMEM complete medium of hyclone adjusts cell density5Cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO2Training
Cultivate in supporting case.Can be used for transfecting when cell density reaches 70%-80%.2h before transfection, the original culture medium of sucking-off, add
The complete medium that 1.5ml is fresh.
According to the explanation of the MISSION Lentiviral Packaging Mix test kit of Sigma-aldrich company,
Packing Mix(PVM is added in a sterile centrifugation tube) 20 μ l, PEI12 μ l, plasma-free DMEM medium 400 μ l, take 20 μ l
The plasmid DNA of above-mentioned extracting, adds to above-mentioned PVM/PEI/DMEM mixed liquor.Above-mentioned transfection mixture is at room temperature hatched
15min, is transferred in the culture medium of HEKC 293T cell, 37 DEG C, 5%CO216h is cultivated in incubator.Discard containing turning
The culture medium of dye mixture, PBS solution is washed, and adds complete medium 2ml, continues to cultivate 48h.
Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration unit (Millipore) purification and concentration slow sick
Poison, step is as follows: (1) 4 DEG C, and 4000g is centrifuged 10min, removes cell debris；(2) 0.45 μm filter filtering supernatant are in 40ml
In ultracentrifugation pipe；(3) 4000g is centrifuged, 10-15min, to the viral concentration volume needed；(4), after centrifugal end, will filter
Filter cup separately, is tipped upside down on sample collection cup by cup and following filtered solution collection cups, and centrifugal 2min centrifugal force is less than
1000g；(5) Centrifuge Cup being removed from sample collection cup, the CDKL3 gene interference slow virus that is in sample collection cup concentrates
Liquid.By after viral concentration liquid subpackage in-80 degrees Celsius of preservations.
2) packaging process of EGFR gene interference slow virus disturbs slow virus with CDKL3 gene.
3) negative control slow virus packaging process disturbs slow virus with CDKL3 gene.
Embodiment 2CDKL3 gene interference slow virus and the oncotherapy synergism of EGFR gene interference slow virus
1. experimental technique
The people's pulmonary carcinoma H1299 cell being in exponential phase carries out trypsinization, and (cell number is about 5 to make cell suspension
×104/ ml) it is inoculated in 6 orifice plates, cultivation to cell degrees of fusion reaches about 30%.According to infection multiplicity (H1299MOI is 5), with
Time experimental group and matched group are set, experimental group with 0.025uL titre for 6 × 108TU/mL CDKL3 gene interference slow virus and
0.03uLuL titre is 5 × 108TU/mL EGFR gene interference slow virus join in cancerous cell culture fluid, matched group with
0.03uL titre is 5 × 108The comparison virus of TU/mL joins in cancerous cell culture fluid.
Change culture medium after cultivating 24h, after time of infection reaches 5 days, collect each experimental group being in exponential phase
And cellular control unit.Complete medium resuspended one-tenth cell suspension (2 × 104/ ml), it is about 2000/hole with cell density, inoculation
96 orifice plates.The often multiple hole of group 5, every hole 100 μ l.After completing plate, put 37 DEG C, 5%CO2Incubator is cultivated.Within second day after bed board, open
Beginning, every day reads plate once with Cellomics ArrayScan VTI High content screening analyser (Thermo Fisher) detection,
Continuous detecting reads plate 5 days.By adjust Cellomics arrayscan input parameter, calculate exactly each experimental group and
While scanning in orifice plate in matched group, the quantity of the cell of band green fluorescence and red fluorescence (infects CDKL3 base simultaneously every time
Because of interference slow virus and the cell of EGFR gene interference slow virus), the quantity of independent band green cells (only infects CDKL3
The cell of gene interference slow virus), the quantity of the cell of fluorescence (only infects the thin of EGFR gene interference slow virus the most redly
Born of the same parents), data are carried out statistics and draws, draw cell proliferation curve.
The result of cell proliferation curve is shown in that Fig. 5, result show: infect simultaneously CDKL3shRNA slow virus and
After people's pulmonary carcinoma H1299 cell of EGFRshRNA slow virus cultivates 5 days in vitro, vigor cell proliferation times increases with vigor cell
Grow multiple and have dropped 71.57% compared with matched group；The H1299 cell individually infecing EGFR shRNA slow virus is trained in vitro
After supporting 5 days, vigor cell proliferation times have dropped 18.86% compared with matched group；Individually infect CDKL3shRNA slow virus
H1299 cell cultivate 5 days in vitro after, vigor cell proliferation times have dropped 31.39% compared with matched group.
This test result indicate that, the dual-gene inhibitory rate of cell growth struck after subtracting significantly greater than single-gene strikes and subtracts adding of group
With, show that CDKL3 gene shRNA slow virus can work in coordination with the propagation suppressing tumor cell with EGFR gene shRNA slow virus.
Claims (10)
1. people's CDKL3 gene of separating and Human epidermal growth factor receptor gene disturb for the RNA of tumor cell collectively as medicine or preparation to be made
By target purposes in screening anti-tumor medicine；Described purposes specifically refers to same to people's CDKL3 gene and Human epidermal growth factor receptor gene
Shi Zuowei effective object, screens medicine, to find the medicine that can suppress people's CDKL3 gene expression respectively and suppression people
The medicine that EGFR gene is expressed, then as oncotherapy alternative compositions medicine；Or find and can suppress people CDKL3 simultaneously
The medicine of gene and Human epidermal growth factor receptor gene expression is as oncotherapy drug candidate；Described tumor is pulmonary carcinoma.
2. treating a nucleic acid molecules medicine for pulmonary carcinoma, its effective ingredient contains CDKL3 gene expression in reduction lung carcinoma cell
The nucleic acid molecules separated, and reduce the nucleic acid molecules of the separation that EGFR gene is expressed in lung carcinoma cell；
In described reduction lung carcinoma cell, the nucleic acid molecules of the separation of CDKL3 gene expression comprises:
A) CDKL3 gene double-stranded RNA, in described CDKL3 gene double-stranded RNA containing can under stringent condition with CDKL3 gene
The nucleotide sequence of hybridization；Or
B) CDKL3 gene shRNA, in described CDKL3 gene shRNA containing can under stringent condition with CDKL3 gene recombination
Nucleotide sequence；
In described reduction lung carcinoma cell, the nucleic acid molecules of the separation that EGFR gene is expressed comprises:
A.EGFR gene double-stranded RNA, containing hybridizing with EGFR gene under stringent condition in described EGFR gene double-stranded RNA
Nucleotide sequence；Or
B.EGFR gene shRNA, containing the core that can hybridize with EGFR gene under stringent condition in described EGFR gene shRNA
Nucleotide sequence.
3. nucleic acid molecules medicine as claimed in claim 2, it is characterised in that described CDKL3 gene double-stranded RNA comprises the first chain
Be collectively forming RNA dimer with the second chain, described first chain and described second chain complementation, and the sequence of described first chain with
The target sequence of CDKL3 gene is identical；Described CDKL3 gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects institute
State positive-sense strand fragment and the loop-stem structure of antisense strand fragment, described positive-sense strand fragment and the complementary of described antisense strand fragment,
And the sequence of described positive-sense strand fragment is identical with the target sequence of CDKL3 gene.
4. nucleic acid molecules medicine as claimed in claim 2, it is characterised in that described EGFR gene double-stranded RNA comprises the first chain
Be collectively forming RNA dimer with the second chain, described first chain and described second chain complementation, and the sequence of described first chain with
The target sequence of EGFR gene is identical；Described EGFR gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects described
Positive-sense strand fragment and the loop-stem structure of antisense strand fragment, described positive-sense strand fragment and the complementary of described antisense strand fragment, and
And the sequence of described positive-sense strand fragment is identical with the target sequence of EGFR gene.
5. nucleic acid molecules medicine as claimed in claim 3, it is characterised in that the target sequence of described CDKL3 gene, for SEQ
Sequence shown in IDNO:1.
6. nucleic acid molecules medicine as claimed in claim 4, it is characterised in that the target sequence of described EGFR gene, for SEQ ID
Sequence shown in NO:2.
7. the nucleic acid molecules medicine as described in claim 2-6 any claim, it is characterised in that described double-stranded RNA is little
RNA interfering, and the sequence of CDKL3 gene siRNA the first chain is as shown in SEQ ID NO:9；EGFR gene siRNA
The sequence of the first chain is as shown in SEQ ID NO:10；The sequence of described CDKL3 gene shRNA is as shown in SEQ ID NO:11；Institute
State the sequence of EGFR gene shRNA as shown in SEQ ID NO:12.
8. treat a slow virus carrier medicine for pulmonary carcinoma, its effective ingredient contain CDKL3 gene interference slow virus carrier and
EGFR gene interference slow virus carrier, described CDKL3 gene interference slow virus carrier contains the coding arbitrary right of claim 2-7
Require the genetic fragment of CDKL3 gene shRNA in described nucleic acid molecules medicine；Described EGFR gene interference slow virus carrier contains
There is the genetic fragment of EGFR gene shRNA encoded in nucleic acid molecules medicine described in claim 2-7 any claim.
9. treating a slow virus medicine for pulmonary carcinoma, its effective ingredient contains CDKL3 gene interference slow virus and EGFR gene is done
Disturbing slow virus, interference slow virus is done described CDKL3 gene by the CDKL3 gene in slow virus carrier medicine described in claim 8
Disturb slow virus carrier slow virus packaging plasmid, cell line auxiliary under, through virus packaging form；Described EGFR gene is disturbed
Slow virus is disturbed slow virus carrier to pack matter slow virus by the EGFR gene in slow virus carrier medicine described in claim 8
Grain, cell line auxiliary under, through virus packaging form.
10. treating a pharmaceutical composition for pulmonary carcinoma, its composition is containing nucleic acid molecules described in claim 2-7 any claim
Slow virus carrier medicine described in the nucleic acid molecules of separation of CDKL3 gene expression, claim 8 in reduction lung carcinoma cell in medicine
CDKL3 gene interference slow virus in slow virus medicine described in CDKL3 gene interference slow virus carrier, claim 9 in thing
In at least one；And in the reduction lung carcinoma cell in nucleic acid molecules medicine described in claim 2-7 any claim
EGFR gene interference in slow virus carrier medicine described in the nucleic acid molecules of separation of EGFR gene expression, claim 8 is slow sick
At least one in EGFR gene interference slow virus in slow virus medicine described in poisonous carrier, claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310231941.1A CN104232743B (en) | 2013-06-09 | 2013-06-09 | People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310231941.1A CN104232743B (en) | 2013-06-09 | 2013-06-09 | People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104232743A CN104232743A (en) | 2014-12-24 |
| CN104232743B true CN104232743B (en) | 2016-12-28 |
Family
ID=52221636
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310231941.1A Active CN104232743B (en) | 2013-06-09 | 2013-06-09 | People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232743B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921830A (en) * | 2010-03-29 | 2010-12-22 | 苏州工业园区为真生物医药科技有限公司 | Rapid detection of EGFR (Epidermal Growth Factor Receptor) gene mutation |
| CN103468786A (en) * | 2012-06-06 | 2013-12-25 | 上海吉凯基因化学技术有限公司 | Uses and relevant drugs of human CDKL3 (cyclin-dependent kinase-like 3) gene |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10132811B2 (en) * | 2009-06-25 | 2018-11-20 | The Regents Of The University Of California | Salivary transcriptomic and microbial biomarkers for pancreatic cancer |
-
2013
- 2013-06-09 CN CN201310231941.1A patent/CN104232743B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921830A (en) * | 2010-03-29 | 2010-12-22 | 苏州工业园区为真生物医药科技有限公司 | Rapid detection of EGFR (Epidermal Growth Factor Receptor) gene mutation |
| CN103468786A (en) * | 2012-06-06 | 2013-12-25 | 上海吉凯基因化学技术有限公司 | Uses and relevant drugs of human CDKL3 (cyclin-dependent kinase-like 3) gene |
Non-Patent Citations (1)
| Title |
|---|
| c-erbB-2癌基因蛋白、EGFR在胰腺癌组织中的表达和意义;张俐 等;《实用肿瘤杂志》;19990610;第14卷(第3期);第157页摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104232743A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN104225619B (en) | The purposes and its related drugs of people's ILK gene therapy tumours | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN104232743B (en) | People's CDKL3 gene and EGFR gene treat purposes and the related drugs thereof of tumor | |
| CN104225618B (en) | Application of human NLK gene and EGFR gene in curing tumors and related drugs | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN104232744B (en) | Application of human CIT gene and EGFR gene in curing tumors and related drugs | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN104368001B (en) | Suppress CALM1 and cooperate with the application in suppressing tumour with EGFR | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN103421887B (en) | The purposes and its related drugs of CIT gene | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20161026 Address after: 200233 room 619-21, Guiping Road, Shanghai, Xuhui District, 680 Applicant after: Shanghai Genechem Co., Ltd. Address before: 201203 Edison road Shanghai, Pudong New Area Zhangjiang hi tech Park No. 328 room 201-A Applicant before: SHANGHAI JINJIAN BIOLOGICAL SCIENCE & TECHNOLOGY CO., LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |