CN104232744B

CN104232744B - Application of human CIT gene and EGFR gene in curing tumors and related drugs

Info

Publication number: CN104232744B
Application number: CN201310232000.XA
Authority: CN
Inventors: 朱向莹; 高博; 杨敏; 曹跃琼
Original assignee: SHANGHAI GENECHEM CO Ltd
Current assignee: Shanghai Jikai gene Medical Technology Co.,Ltd.
Priority date: 2013-06-09
Filing date: 2013-06-09
Publication date: 2017-05-17
Anticipated expiration: 2033-06-09
Also published as: CN104232744A

Abstract

The invention relates to the field of biotechnology and specifically discloses a separate human CIT gene and an application of the human CIT gene and a human EGFR gene used as synergistic drug targets in the preparation or screening of drugs for curing tumors. The invention also further constructs a CIT gene small interfering RNA, a CIT gene interfering lentiviral vector and a CIT gene interfering lentivirus and discloses an application of the CIT gene small interfering RNA, the CIT gene interfering lentiviral vector and the CIT gene interfering lentivirus in cooperation with the EGFR gene in curing tumors. The siRNA or the lentiviral vector containing siRNA sequence or the lentivirus containing siRNA sequence provided by the invention can inhibit expression of the human CIT gene and/or the human EGFR gene specifically, especially the lentivirus. The CIT gene interfering lentivirus can inhibit tumor cell growth and promote tumor cell apoptosis separately or in cooperation with the EGFR gene interfering lentivirus, and is of great significance in curing tumors.

Description

The purposes and its related drugs of people CIT genes and EGFR gene treatment tumour

Technical field

The present invention relates to biological technical field, more particularly to single people CIT genes；And people CIT genes and people The purposes and its related drugs of EGFR gene Synergistic treatment tumour.

Background technology

The gene therapy of current tumour has been achieved for flourishing quickly development, but so far, however it remains it is a lot The problem for needing to solve.Currently used for therapy of tumor gene very little, the gene that can suppress tumour growth is few in number, anxious More available genes need to be provided.Further, since the process such as the generation of tumour, development, transfer is a polygenes and participating in, relating to And the complex networks system of many signal paths, therefore individual gene treatment or single therapy method often offer limited effectiveness.Therefore, The emphasis of following gene therapy development will be to excavate and identify the gene for clinically having important value, explore multiple with not With the gene association treatment of Antitumor Mechanism and by polygenes targeted drug therapeutic alliance etc..

CIT citron (Rho-interacting, serine/threonine kinase 21, with Rho interactions Serine/threonine kinase 21) contain an egg similar with ROCK (Rho-associated kinase, Rho connections kinases) White kinase domain, this isomers is referred to as Citron-K, is first known Rho-GTP downstream targets, with dependent cells The characteristics of periodic table reaches.Citron-K is gathered in Interphase cells, and the mitosis prometaphase is dispersed in endochylema, and the later stage is distributed in carefully Born of the same parents' cortex, latter stage accumulates in cleavage groove (Madaule P, Eda M, Watanabe N, et al.Role of citron kinase as a target of the small GTPase rho in cytokinesis.Nature.1998；394 (6692):491-494.Paramasivam M,Chang YJ,Lotrco JJ.ASPM and citron kinase co- localize to midboby ring during cytokinesis.Cell Cycle.2007；6(13)105-1612). Citron kinases adjusted during cytokinesis myosin shrink it is near and adjust the motion of cell magma (Yamashiro S, Totsukawa G,Yamakita Y et al.Citron kinase,a rho-dependent kinase,induces di- phosphorylation of regulatory light chain of myosin II.Mol Biol Cell.2003；14 (5):1745-1756.).The variant of overexpression citron genes causes to produce apocyte, loses the variant of kinase activity There is abnormal contraction in cytoplasm moving process.

Studies have reported that, citron genes play feature in the part physiology course that neuron is formed with Sperm specific enzyme Effect (Di Cunto F, Imarisio S, Hirsch E, et al.Defective Neurogenesis in Citron Kinase Knockout Mice by Altered Cytokinesis and Massive Apoptosis.Neuron 2000；28(1):115-127.Di Cunto F,Imarisio S,Camera P,et al.Essential role of citron kinase in cytokinesis of spermatogenic precursors.J Cell Sci.2002；115 (Pt 24):4819-4826.), knock out in the mouse birth several weeks after citron genes and deformity just occurs or because motion is lost Adjust or epilepsy and death (Di Cunto F, Imarisio S, Hirsch E, et al.Defective Neurogenesis in Citron Kinase Knockout Mice by Altered Cytokinesis and Massive Apoptosis.Neuron 2000；28(1):115–127.).Meanwhile, Citron-K is for undifferentiated male gamete cell precursors Physiology expansion is required, and ensures that spermatogonium is changed into sperm mother cell, and Citron gene knockouts male mice is presented double testis Pellet is damaged, and morphological change (Di Cunto F, Imarisio S, Camera P, et does not occur in the ovary of female mice al.Essential role of citron kinase in cytokinesis of spermatogenic precursors.J Cell Sci.2002；115(Pt24):4819-4826.).But also studies have reported that, Citron genes Also participate in reproduction process (Atreya CD, Kulkarni S, the Mohan KV.Rubella virus of virus P90associates with the cytokinesis regulatory protein citron-K kinase and the viral infection and constitutive expression of P90protein both induce cell cycle arrest following S phase in cell culture.Arch Virol.2004；149(4):779- 789.Atreya CD,Mohan KV,Kulkarni S.Rubella virus and birth defects:molecular insights into the viral teratogenesis at the cellular level.Birth Defects Res A Clin Mol Teratol.2004；70(7):431-437.Loomis RJ,Holmes DA,Elms A et al.Citron kinase,a rho A effector,enhances HIV-1virion production by modulating exocytosis.Traffic.2006；7(12):1643-1653.).Therefore, citron genes are in a series of important physiology mistakes Played an important role in journey, Citron gene dependent cells periodic tables are reached, and important physiology is played in cell mitogen Function, and cancerous tissue to be cell constantly rise in value to form immortalization, therefore, Citron genes may have certain with the generation of tumour Relation, be expected to turn into therapy of tumor a novel targets.

EGF-R ELISA (epidermalgrowth factor receptor, EGFR) EGFR is a kind of cross-film Protein, belongs to ErbB receptor family member, and its part (EGF, TGF- α etc.) is combined with EGFR extracellular fragments is allowed to dimerization, by This causes the cascade reaction of intracellular section tyrosine kinase activation and a series of signal transduction, promotes cell to breed, angiogenesis, Shift and suppress Apoptosis (Liang Houjie, Zou Lan .EGFR targeted drugs treatment advanced colorectal cancer latest developments China prescription Medicine 2009；84:58-61.), so as to lead oncogenic generation.Numerous studies find that EGFR gene crosses table in kinds of tumors tissue Up to or abnormal activation so that tumor cell proliferation, invasion and attack and transfer ability enhancing.It is various that EGFR has turned into according to clinical verification Therapy target (Ciardiello F, the Tortora G.EGFR antagonists in cancer of tumor types treatment.N Engl J Med 2008；358:1160-1174.).

RNAi is the PTGS phenomenon using the sequence-specific of double chain RNA mediate, it has also become research gene A kind of emerging effective means of function, and it is expected to turn into instrument (the Izquierdo M.Short of the disease genes such as tumour treatment interfering RNAs as a tool for cancer gene therapy.Cancer Gene Ther.2005；12 (3):217-27.).Slow virus (lentivirus) carrier is efficient gene transfer instrument, is mainly used in infection to conventional side The relatively low cell of method transfection efficiency, such as primary cell.Lentiviral particle can infection development and non-proliferative simultaneously cell, and sense Dye is more stable, lasting.With slow virus carrier, the expression high of specific gene is capable of achieving, it is also possible to express hairpin RNA (short hairpin RNA, shRNA) lowers the table of certain gene in RNA interference (RNA interference, RNAi) mode Reach.The present invention intends cooperateing with suppression tumour cell to increase with EGFR gene using the RNAi technology research CIT genes of lentivirus mediated Function in growing, for the No operation clinical treatment of malignant tumour provides theoretical foundation.

The content of the invention

It is an object of the invention to disclose target of the CIT genes as treatment of cancer, the purposes and its phase of tumour are treated Close medicine；And by CIT genes and EGFR gene collectively as treatment of cancer target, by silence CIT genes simultaneously and The expression of EGFR gene, realizes the purposes of Synergistic treatment tumour, and its anti-tumor medicine.

The present invention have studied effect of the single CIT genes in tumour occurrence and development with RNA interference as means, with And, CIT genes and synergy of the EGFR gene in tumour occurrence and development disclose and a kind of suppress or reduce tumour cell The method of growth, propagation, differentiation and/or survival, the method includes：Applying one kind to tumour cell being capable of specificity suppression CIT The transcription of gene and/or EGFR gene, translation, or can specificity suppress the active of CIT albumen and/or EGFR protein expressions Material, growth, propagation, differentiation or the survival of tumour cell are suppressed with this.

First aspect present invention, discloses the people CIT genes of separation in preparation or screens anti-tumor medicine, or in system Purposes in standby diagnosing tumor medicine.

Described tumour can be the propagation of its tumour cell any one tumour related to the expression of people's CIT genes； Further, it is a kind of malignant tumour, is selected from：Colon cancer.

In the present invention, the people CIT genes are applied to prepare or screen tumour as the action target for tumour cell Medicine, or prepare diagnosing tumor medicine.Further, the action target for tumour cell is that RNA disturbs work Use target.

The people CIT genes by separation include both sides content for preparing or screening anti-tumor medicine：First, It is applied to prepare anti-tumor medicine for the action target of tumour cell using people CIT genes as medicine or preparation；Second, will People CIT genes are applied to screen anti-tumor medicine as medicine or preparation for the action target of tumour cell.

It is described to be applied to prepare cancer therapeutics for the action target of tumour cell using CIT genes as medicine or preparation Thing is specifically referred to：CIT genes are developed into medicine or preparation for tumour cell as the target of RNA interference effects, so that Improve or reduce the expression of CIT genes in tumour cell.

It is described to be applied to screen cancer therapeutics for the action target of tumour cell using CIT genes as medicine or preparation Thing is specifically referred to：Using CIT genes as effective object, medicine or preparation are screened, can suppress or promote people to find The medicine of CIT gene expressions is used as oncotherapy drug candidate.CIT gene small molecules interference RNAs described in the present invention (siRNA) it is to be obtained by effective object screening of people CIT genes, can be used as that there is the medicine for suppressing tumor cell proliferation effect Thing.In addition, such as antibody drug, small-molecule drug etc. also can be using CIT genes and its albumen as effective object.

It is described to be used to CIT genes prepare diagnosing tumor medicine, refer to be examined CIT gene expression products as a tumour Severed finger mark is applied to the preparation of diagnosing tumor medicine.

The anti-tumor medicine is the transcription or translation for being capable of specificity suppression CIT genes, or being capable of specificity suppression The expression of CIT albumen or the molecule of activity, so as to reduce the expression of CIT genes in tumour cell, reach suppression tumour thin The purpose of the propagation of born of the same parents, growth, differentiation and/or survival.

First aspect present invention, the people CIT genes and Human epidermal growth factor receptor gene for also disclosing separation is controlled in preparation or screening tumour Treat medicine, or the purposes in diagnosing tumor medicine is prepared.

In the present invention, the people CIT genes and Human epidermal growth factor receptor gene are applied to system as the action target for tumour cell Standby or screening anti-tumor medicine, or prepare diagnosing tumor medicine.Further, the action target for tumour cell It is RNA interference effect targets.

The people CIT genes and Human epidermal growth factor receptor gene by separation includes two aspects for preparing or screening anti-tumor medicine Content：First, people CIT genes and Human epidermal growth factor receptor gene are applied to as medicine or preparation for the action target of tumour cell Prepare anti-tumor medicine；Second, people CIT genes and Human epidermal growth factor receptor gene to be directed to the effect of tumour cell as medicine or preparation Target is applied to screen anti-tumor medicine.

It is described to be applied to people CIT genes and Human epidermal growth factor receptor gene for the action target of tumour cell as medicine or preparation Anti-tumor medicine is prepared to specifically refer to：By CIT genes and Human epidermal growth factor receptor gene collectively as the target of RNA interference effects, develop Can simultaneously for two kinds of anti-tumor medicines or preparation of gene, so as to improve or reduce CIT genes and people in tumour cell The expression of EGFR gene；Or, developed using CIT genes and Human epidermal growth factor receptor gene as the target of RNA interference effects Respectively for two kinds of anti-tumor medicines of gene, so as to obtain can improve or reduce CIT genes and Human epidermal growth factor receptor in tumour cell The anti-tumor medicine or preparation of gene expression dose.

It is described to be applied to people CIT genes and Human epidermal growth factor receptor gene for the action target of tumour cell as medicine or preparation Screening anti-tumor medicine is specifically referred to：Using people CIT genes and Human epidermal growth factor receptor gene simultaneously as effective object, medicine is sieved Choosing, the medicine and influence (suppress or promote) Human epidermal growth factor receptor of people's CIT gene expressions can be respectively influenceed (suppress or promote) to find The medicine of gene expression, then as oncotherapy alternative compositions medicine；Or find and (can suppress or promote while influence Entering) medicine of people CIT genes and Human epidermal growth factor receptor gene expression is used as oncotherapy drug candidate.CIT genes as described in the present invention Small molecules interference RNA (siRNA), gene RNA construct, slow virus, and EGFR gene small molecules interference RNA (siRNA), gene RNA construct, slow virus, are obtained with the respectively effective object screening of CIT genes and EGFR gene ；When they are used in conjunction with, there is the effect of synergy, it is more preferable than a kind of single using effect of material；Can be used as With the medicine for suppressing tumor cell proliferation effect.In addition, such as antibody drug, small-molecule drug etc. also can be by people CIT Gene and Human epidermal growth factor receptor gene and its albumen are used as effective object.

It is described to be used to prepare diagnosing tumor medicine by people CIT genes and Human epidermal growth factor receptor gene, refer to by CIT gene expression products With the preparation that Human epidermal growth factor receptor gene expression product is applied to tumour diagnostic reagent as diagnosing tumor index.

The anti-tumor medicine of the invention be can specificity suppress turning for people CIT genes and/or Human epidermal growth factor receptor gene Record is translated, or can specificity suppress expression or the molecule of activity of people CIT genes and/or Human epidermal growth factor receptor gene, so as to reduce The expression of tumour cell people CIT genes and/or Human epidermal growth factor receptor gene, reach suppress the propagation of tumour cell, growth, differentiation, The purpose of survival.

Prepared by the present invention or the anti-tumor medicine of screening is included but is not limited to：Nucleic acid molecules, carbohydrate, lipid, Small-molecule chemical medicine (such as inhibitor), antibody medicine, polypeptide, albumen or interference slow virus.

The nucleic acid molecules are included but is not limited to：In ASON, double-stranded RNA (dsRNA), ribozyme, ribonucleic acid SiRNA (esiRNA) or short hairpin RNA (shRNA) prepared by enzyme cutting III.

The amount of application of the anti-tumor medicine is the transcription or translation for reducing people CIT genes and Human epidermal growth factor receptor gene enough, Or expression or the dosage of activity of people CIT albumen and Human epidermal growth factor receptor albumen are reduced enough.To make one CIT genes and Human epidermal growth factor receptor gene Expression be at least lowered 50%, 80%, 90%, 95% or 99%.

In the present invention, when people CIT genes and Human epidermal growth factor receptor gene carry out oncotherapy and drug sieve as collaboration dispenser target It is the method disturbed by RNA when selecting, using the target gene that people CIT genes and EGFR gene are disturbed as RAN, reduces the two The expression of gene.

Described tumour can appoint for the propagation of its tumour cell is related to the expression of people CIT genes and Human epidermal growth factor receptor gene A kind of tumour；Further, it is a kind of malignant tumour, is selected from：Colon cancer.

Using the method for forgoing neoplasms medicine treatment tumour pressed down by individually reducing the expression of people's CIT genes The propagation of tumour cell processed reaches the purpose for the treatment of, or by reducing the expression of people CIT genes and Human epidermal growth factor receptor gene simultaneously Level suppresses the propagation of tumour cell to reach the purpose for the treatment of.Specifically, during treatment, can effectively reduce people's CIT gene tables Up to horizontal material；Or, the administering substances of people CIT genes and Human epidermal growth factor receptor gene expression dose can will be effectively reduced in patient.

Second aspect present invention discloses a kind of nucleic acid molecules medicine for treating tumour, and its active ingredient contains reduction tumour The nucleic acid molecules of the separation of CIT gene expressions in cell, and reduce the nucleic acid of the separation of EGFR gene expression in tumour cell Molecule；The nucleic acid molecules of the separation of CIT gene expressions are included in the reduction tumour cell：

A) CIT genes double-stranded RNA, containing in the CIT genes double-stranded RNA can be miscellaneous with CIT genes under stringent condition The nucleotide sequence of friendship；Or

B) CIT genes shRNA, in the CIT genes shRNA containing can under stringent condition with CIT gene recombinations Nucleotide sequence；

The nucleic acid molecules of the separation of EGFR gene expression are included in the reduction tumour cell：

A.EGFR gene double-stranded RNAs, in the EGFR gene double-stranded RNA containing can under stringent condition with EGFR gene The nucleotide sequence of hybridization；Or

B.EGFR genes shRNA, containing in the EGFR gene shRNA can hybridize under stringent condition with EGFR gene Nucleotide sequence.

Further, the tumour is colon cancer.

Preferably, the CIT genes double-stranded RNA includes the first chain and the second chain, and first chain and second chain are mutual Benefit is collectively forming RNA dimers, and the sequence of first chain is essentially identical with the target sequence of CIT genes.

Preferably, the EGFR gene double-stranded RNA includes the first chain and the second chain, and first chain and second chain are mutual Benefit is collectively forming RNA dimers, and the sequence of first chain is essentially identical with the target sequence of EGFR gene.

Preferably, the CIT genes shRNA includes positive-sense strand fragment and antisense strand fragment, and connects the positive-sense strand The sequence of the loop-stem structure of fragment and antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and described The sequence of positive-sense strand fragment is essentially identical with the target sequence of CIT genes.

Preferably, the EGFR gene shRNA includes positive-sense strand fragment and antisense strand fragment, and connects the positive-sense strand The sequence of the loop-stem structure of fragment and antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary, and described The sequence of positive-sense strand fragment is essentially identical with the target sequence of EGFR gene.

More excellent, the sequence of the loop-stem structure of the shRNA may be selected from following any：UUCAAGAGA、AUG、CCC、 UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.

More excellent, the target sequence of the CIT genes is SEQ ID NO:Sequence shown in 1；The target sequence of the EGFR gene Row, are SEQ ID NO:Sequence shown in 2.

It is mutual with the siRNA when target sequence of the CIT genes is siRNA for specific silence CIT gene expressions Mend the fragment in the CIT genes corresponding to the mRNA fragments for combining.Similarly, the target sequence of the EGFR gene is siRNA use When specific silence EGFR gene is expressed, in the EGFR gene corresponding to the complementary mRNA fragments for combining of the siRNA Fragment.

The length of the chain of the double-stranded RNA first and the second chain is 15-27 nucleotides；Preferably, length is 19-23 Individual nucleotides；Optimal, length is 19,20 or 21 nucleotides.

Further, the double-stranded RNA is siRNA (siRNA).

Optimal, the sequence such as SEQ ID NO of CIT genes the first chain of siRNA：Shown in 9, specially 5 '- GUCCUCAUACCAGGAUAAA-3’.SEQ ID NO：First chain of the CIT gene siRNAs shown in 9 is with SEQ ID NO:1 institute The sequence shown is a chain in the siRNA for people's CIT genes of RNA interference target sequence designs, first chain and the The siRNA of two chains composition can play a part of endogenous CIT gene expressions in specific silence tumour cell.

Optimal, the sequence such as SEQ ID NO of the chain of EGFR gene siRNA first：Shown in 10, specially 5 '- GGCUGGUUAUGUCCUCAUU-3’.SEQ ID NO：First chain of the EGFR gene siRNA shown in 10 is with SEQ ID NO:2 Shown sequence be RNA interference target sequence design the siRNA for Human epidermal growth factor receptor gene in a chain, first chain with The siRNA of the second chain composition can play a part of endogenous EGFR gene expression in specific silence tumour cell.

Optimal, the sequence such as SEQ ID NO of the CIT genes shRNA:Shown in 11, specially：5’- GCGUCCUCAUACCAGGAUAAA CUCGAG UUUAUCCUGGUAUGAGGACGC-3’。

Optimal, the sequence such as SEQ ID NO of the EGFR gene shRNA:Shown in 12, specially：5’- GUGGCUGGUUAUGUCCUCAUUCUCGAG AAUGAGGACAUAACCAGCCAC-3’。

It is that the double-stranded RNA or shRNA of safe and effective amount are applied to mammal when the medicine as treatment tumour. Specific dosage is also contemplated that the factors such as method of administration, patient health situation, within the scope of these are all skilled practitioners technical ability.

Third aspect present invention, discloses a kind of slow virus carrier medicine for treating tumour, and its active ingredient contains CIT bases Because of interference slow virus carrier and EGFR gene interference slow virus carrier, before the CIT genes interference slow virus carrier contains coding The genetic fragment of CIT genes shRNA is stated, the EGFR gene interference slow virus carrier contains the foregoing EGFR gene shRNA of coding Genetic fragment.

Further, the tumour is colon cancer.

CIT genes interference slow virus carrier be the DNA fragmentation for encoding foregoing CIT genes shRNA is cloned into it is known Carrier is obtained, and the known carrier is generally slow virus carrier, and the CIT genes interference slow virus carrier turns into by virus packaging After infectious virion, infected tumor's cell, and then transcribe out the shRNA step such as processes, finally by digestion The CIT genes siRNA is obtained, for the expression of specific silence CIT genes.EGFR gene interference slow virus carrier is same CIT genes.

The DNA sequence dna for encoding the CIT genes shRNA genetic fragments contains SEQ ID NO:Sequence shown in 1 and its complementation Sequence.The DNA sequence dna for encoding the EGFR gene shRNA genetic fragments contains SEQ ID NO:Sequence shown in 2 and its complementary sequence Row.

Further, gene interference slow virus carrier of the present invention is also thin containing promoter sequence and/or codes for tumor The nucleotide sequence of the label that can be detected in born of the same parents；Preferably, the label the being detected such as green fluorescent protein (GFP)。

Further, the slow virus carrier can be selected from：pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1- puro-CMV-tGFP、pLKO.1-CMV-Neo、pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV- TagCFP、pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV- TagFP635、pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG- 1xLacO、pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、pLenti6/BLOCK-iT- DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、pLenti6.2/N-Lumio/V5-DEST、 Any in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.

Fourth aspect present invention, discloses a kind of slow virus medicine for treating tumour, and its active ingredient contains CIT genes and does Slow virus and EGFR gene interference slow virus are disturbed, the CIT genes interference slow virus disturbs slow virus carrier by foregoing CIT genes Under slow virus packaging plasmid, the auxiliary of cell line, formed by virus packaging；The EGFR gene disturbs slow virus by foregoing EGFR gene disturbs slow virus carrier under slow virus packaging plasmid, the auxiliary of cell line, is formed by virus packaging.

Further, the tumour is colon cancer.

Slow virus of the invention infected tumor's cell and can produce the small molecule respectively for CIT genes or EGFR gene to do RNA is disturbed, so as to suppress the propagation of tumour cell.The CIT genes disturb slow virus and EGFR gene interference slow virus to can be used to make The standby medicine for preventing or treating tumour.

Fifth aspect present invention, discloses a kind of pharmaceutical composition for treating colon cancer, and its composition contains foregoing drop The nucleic acid molecules of the separation of CIT gene expressions, CIT genes interference slow virus carrier, the slow disease of CIT genes interference in low tumour cell At least one in poison；And, the nucleic acid molecules of the foregoing separation for reducing EGFR gene expression in tumour cell, EGFR gene are done Disturb at least one in slow virus carrier, EGFR gene interference slow virus.

Preferably, mentioned component is the effective component of the pharmaceutical composition for treating colon cancer.

It is that the double-stranded RNA of safe and effective amount, shRNA or slow virus are applied to the food in one's mouth when the medicine as treatment tumour Newborn animal.Specific dosage is also contemplated that the factors such as method of administration, patient health situation, these be all skilled practitioners technical ability scope it Interior.

In pharmaceutical composition of the invention, specific silence CIT gene expressions, and specific silence EGFR gene expression Active ingredient played the effect of Synergistic treatment；The embodiment of the present invention is recorded, and the dual-gene growth of cancer cells struck after subtracting suppresses Rate be significantly greater than single-gene strike subtract group plus and, show the material of specific silence CIT gene expressions with specific silence EGFR The material collaboration of gene expression suppresses the propagation of tumour cell.

Further, medicine of the present invention or pharmaceutical composition contain siRNA described in 1~99wt%, shRNA, Gene RNA construct and/or gene interference slow virus, and pharmaceutically acceptable carrier, diluent or excipient.

When preparing medicine, generally active ingredient is mixed with excipient, or use figuration dilution agent, or Bao Ke with capsule or In the carrier that sachet is present.When excipient plays diluent, it can be solid, semi-solid or fluent material conduct The medium of excipient, carrier or active component.Therefore, composition can be tablet, pill, pulvis, solution, syrup, go out Bacterium injection solution etc..The example of suitable excipient includes:Lactose, glucose, sucrose, sorbierite, mannitol, starch, crystallite Cellulose, polyvinylpyrrolidone, cellulose, water etc..Preparation may also include：Wetting agent, emulsifying agent, preservative (such as hydroxy benzenes Methyl formate and propyl ester), sweetener etc..

Beneficial effects of the present invention are：SiRNA or the nucleic acid construct comprising the sequences of small interfering RNAs that the present invention is provided Body, slow virus are capable of the expression of specificity suppression people's CIT genes, especially slow virus, individually, or can be targetted with EGFR slow sick Poison collaboration suppresses the growth of tumour cell, promotes apoptosis of tumor cells, significant in oncotherapy.In the present invention CIT genes may act as single oncotherapy target, it is also possible to as EGFR gene Synergistic treatment target, in oncotherapy In it is significant.

Brief description of the drawings

Fig. 1：GV115 Plasmid diagrams

Fig. 2：GV113 Plasmid diagrams

Fig. 3：CIT shRNA plasmid identification figures

1#：Negative control (ddH2O)；2#：Negative control (unloaded to connect control group certainly)

3#：Marker is followed successively by 5kb, 3kb, 2kb, 1.5kb, 1Kb, 750bp, 500bp, 250bp, 100bp from top to bottom

4#~8#：CIT shRNA 1-5 transformants are identified

Fig. 4：EGFR shRNA plasmid identification figures

1#：Negative control (ddH2O)

2#：Negative control (unloaded to connect control group certainly)

4#~8#：EGFR shRNA 1-5 transformants are identified

Fig. 5：CIT shRNA slow virus and EGFR shRNA slow virus contaminated human colon carcinoma RKO cells after 5 days simultaneously, showed Write and suppress cell propagation

Specific embodiment

The present invention is expanded on further with reference to embodiment.It should be understood that embodiment is merely to illustrate the present invention, and it is unrestricted The scope of the present invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared formula is according to conventional strip in embodiment Part, such as [U.S.] Sambrook.J write；Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing：Science Press The condition of condition or the manufacturer suggestion described in 2002 is carried out or configured.

Preparation of the embodiment 1 for people CIT genes and EGFR gene RNAi slow virus

1. slow virus carrier builds

1) slow virus carrier for people CIT genes and EGFR gene is built

CIT (NM_007174) and EGFR gene (NM_201282) information are transferred from Genbank；Using the lucky triumphant gene in Shanghai The design software Genechem designs of chemical technology Co., Ltd are for CIT genes and the effective siRNA target spots of EGFR gene. Preliminary screening is obtained having the substantially siRNA target sequences (SEQ IDNO.1) of suppression CIT gene expression functions and substantially suppressed The siRNA target sequences (SEQ ID NO.2) of EGFR gene expressive function.BLAST analyses are carried out by Genbank databases, Determine that it does not produce interference effect to any other gene.

Table 1siRNA target sequences

SEQ ID NO.	TargetSeq	Initiation site	Target gene
				1	GTCCTCATACCAGGATAAA	5709	CIT
2	GGCTGGTTATGTCCTCATT	499	EGFR

For siRNA target spots (SEQ ID NO：1) double-strand of two ends I containing Age and EcoR I restriction enzyme site cohesive ends is synthesized DNA Oligo sequences (table 2)；GV115 carriers (belt carrier green fluorescence is acted on Age I and EcoR I restriction enzymes Mark, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 1), linearize it.

For siRNA target spots (SEQ ID NO：2) double-strand of two ends I containing Age and EcoR I restriction enzyme site cohesive ends is synthesized DNA Oligo sequences (table 3).GV113 carriers (belt carrier red fluorescence is acted on Age I and EcoR I restriction enzymes Mark, Shanghai JiKai Gene Chemical Technology Co., Ltd provides, Fig. 2), linearize it.

The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 2

The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 3

Double digestion is linearized the carrier DNA of (digestion system as shown in table 4,37 DEG C, reacts 1h) by T4DNA ligases Double-stranded DNA Oligo connections with having purified, connected in appropriate buffer system (linked system is as shown in table 5) in 16 DEG C At night, reclaim connection product.Fresh competent escherichia coli cell prepared by connection product conversion calcium chloride (is joined by conversion operation Examine：55-56 pages of the Molecular Cloning:A Laboratory guide second edition).

Bacterium clone surface being grown in connection converted product to be stained with, being dissolved in 10 μ l LB culture mediums, mixing takes 1 μ l as mould Plate；The upstream and downstream of RNAi sequences in slow virus carrier, designs general PCR primer upstream primer sequence：5’- CCTATTTCCCATGATTCCTTCATA-3’(SEQ ID NO：7)；Downstream primer sequence：5’- GTAATACGGTTATCCACGCG-3’(SEQ ID NO：8) (PCR reaction systems such as table 6 reacts bar, to enter performing PCR identification experiment Part such as table 7).The clone positive to PCR identifications is sequenced and is compared analysis, and PCR qualification results are shown in Fig. 3 and Fig. 4.Compare correct Clone be successfully construct contain SEQ ID NO:1 or SEQ ID NO:2 RNAi carrier, is respectively designated as CIT- ShRNA-plasmid and EGFR-shRNA-plasmid.

2) GV115 negative control plasmids are built

Negative control siRNA target sequences are 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO：13).Build negative During control plasmid, the double-stranded DNA of two ends I containing Age and EcoR I restriction enzyme site cohesive ends is synthesized for Scr siRNA target spots Oligo sequences (table 8), remaining construction method, authentication method and condition are with CIT-shRNA-plasmid and EGFR-shRNA- plasmid。

The vector plasmid endonuclease reaction system of table 4

The carrier DNA of table 5 and double-stranded DNA Oligo coupled reaction systems

Reagent	Positive control (μ l)	From even control (μ l)	Connection group (μ l)
				The carrier DNA (100ng/ μ l) of linearisation	1.0	1.0	1.0
The double-stranded DNA Oligo (100ng/ μ l) of annealing	1.0	-	1.0
				10 × T4 phage DNA ligase buffer solutions	1.0	1.0	1.0
T4 phage DNA ligases	1.0	1.0	1.0
				dd H₂O	16.0	17.0	16.0
Total	20.0	20.0	20.0

Table 6PCR reaction systems

Reagent	Volume (μ l)
		10×buffer	2.0
dNTPs(2.5mM)	0.8
		Sense primer	0.4
Anti-sense primer	0.4
		Taq polymerase	0.2
Template	1.0
		ddH₂O	15.2
Total	20.0

Table 7PCR reaction system program settings

The double-stranded DNA Oligo of two ends I containing Age and EcoR the I restriction enzyme site cohesive ends of table 8

SEQ ID

5’

Neck

Ring

Neck

3’

14

Positive-sense strand

CCGG

TTCTCCGAACGTGTCACGT

CTCGAG

ACGTGACACGTTCGGAGAA

TTTTTG

15

Antisense strand

AATTCAAAAA

TTCTCCGAACGTGTCACGT

CTCGAG

ACGTGACACGTTCGGAGAA

2. packaging obtains CIT genes interference slow virus and EGFR gene interference slow virus

1) CIT genes interference slow virus

RNAi plasmids CIT-shRNA-plasmid is extracted with the plasmid extraction kit of Qiagen companies and is configured to 100ng/ μ l storing liquids.24h before transfection, with HEKC's 293T cells of Trypsin Induced exponential phase, with containing 10% tire ox The DMEM complete mediums adjustment cell density of serum is 1.5 × 10⁵Cell/ml, is inoculated in 6 orifice plates, 37 DEG C, 5%CO₂Culture Culture in case.Can be used to transfect when cell density reaches 70%-80%.2h before transfection, suctions out original culture medium, adds 1.5ml fresh complete medium.

According to the explanation of the MISSION Lentiviral Packaging Mix kits of Sigma-aldrich companies, To Packing Mix (PVM) 20 μ l, PEI 12 μ l, the μ l of plasma-free DMEM medium 400 is added in a sterile centrifugation tube, 20 μ are taken The DNA of the above-mentioned extractings of l, adds to above-mentioned PVM/PEI/DMEM mixed liquors.Above-mentioned transfection mixture is incubated at room temperature 15min, is transferred in the culture medium of HEKC's 293T cells, 37 DEG C, 5%CO₂Culture 16h in incubator.Discard containing The culture medium of mixture is transfected, PBS solution washing adds complete medium 2ml, continues to cultivate 48h.

Collect cell supernatant, Centricon Plus-20 centrifugal ultrafiltration units (Millipore) purifying and the slow disease of concentration Poison, step is as follows：(1) 4 DEG C, 4000g centrifugation 10min remove cell fragment；(2) 0.45 μm of filter filtering supernatants are in 40ml In ultracentrifugation pipe；(3) 4000g centrifugations, 10-15min, to the viral concentration volume for needing；(4) after centrifugation terminates, will filter Cup and following filtered solution collection cups are separated, and filter cup is tipped upside down on sample collection cup, and centrifugation 2min centrifugal force is no more than 1000g；(5) Centrifuge Cup is removed from sample collection cup, the interference slow virus concentration of CIT genes is in sample collection cup Liquid.By the packing of viral concentration liquid after -80 degrees Celsius of preservations.

2) packaging process of EGFR gene interference slow virus disturbs slow virus with CIT genes.

3) negative control slow virus packaging process disturbs slow virus with CIT genes.

Embodiment 2CIT genes disturb the oncotherapy synergy of slow virus and EGFR gene interference slow virus

1. experimental technique

Human colon carcinoma RKO cells in exponential phase carry out pancreatin digestion, and (cell number is about 5 to be made cell suspension ×10⁴/ ml) it is inoculated in 6 orifice plates, culture to cell fusion degree reaches about 30%.According to infection multiplicity (MOI of RKO is 5), Simultaneously set experimental group and control group, experimental group with the titre of 0.03uL be 5 × 10⁸TU/mL CIT genes interference slow virus and The titre of 0.03uL is 5 × 10⁸TU/mL EGFR gene interference slow virus be added in cancer cell nutrient solution, control group with The titre of 0.03uL is 5 × 10⁸The comparison virus of TU/mL are added in cancer cell nutrient solution.

Culture medium is changed after culture 24h, after time of infection reaches 5 days, each experimental group in exponential phase is collected And cellular control unit.Complete medium is resuspended into cell suspension (2 × 10⁴/ ml), 2000/hole is about with cell density, it is inoculated with 96 orifice plates.Every group of 5 multiple holes, per the μ l of hole 100.After completing plate, 37 DEG C, 5%CO are put₂Incubator culture.From after bed board second day Start, detect read plate one with Cellomics ArrayScan VTI High content screenings analyzer (Thermo Fisher) daily It is secondary, continuous detection read plate 4 days.By adjusting the |input paramete of Cellomics arrayscan, each experimental group is calculated exactly The quantity of the cell with green fluorescence and red fluorescence is (while infect CIT bases while with each scanning orifice plate in control group The cell of slow virus is disturbed because of interference slow virus and EGFR gene), quantity individually with green cells (only infects CIT bases Because disturbing the cell of slow virus), individually redly the quantity of the cell of fluorescence (only infects the thin of EGFR gene interference slow virus Born of the same parents), statistics drawing is carried out to data, draw cell growth curve.

The result of cell growth curve is shown in Fig. 5, as a result shows：Infect CIT shRNA slow virus and EGFR simultaneously After the human colon carcinoma RKO cells of shRNA slow virus cultivate 4 days in vitro, vigor cell proliferation times decline compared with control group 68.23%, individually infect EGFR shRNA slow virus RKO cells cultivate 4 days in vitro after, vigor cell proliferation times 11.28% is have dropped compared with control group, the RKO cells for individually infecing CIT shRNA slow virus are cultivated 4 days in vitro Afterwards, vigor cell proliferation times have dropped 45.94% compared with control group., should test result indicate that, it is dual-gene strike subtract after Inhibitory rate of cell growth be significantly greater than single-gene strike subtract group plus and, show CIT genes shRNA slow virus energy and EGFR gene The collaboration of shRNA slow virus suppresses the propagation of tumour cell.

Claims

1. the people CIT genes and Human epidermal growth factor receptor gene that separate are directed to the RNA interference effects of tumour cell collectively as medicine or preparation Purposes of the target in preparing or screening anti-tumor medicine；The purposes is specifically referred to people CIT genes and Human epidermal growth factor receptor gene Simultaneously as effective object, medicine is screened, the medicine of people's CIT gene expressions can be respectively suppressed to find and suppresses people The medicine of EGFR gene expression, then as oncotherapy alternative compositions medicine；The tumour is colon cancer；The CIT bases The target sequence of cause, is SEQ ID NO:Sequence shown in 1；The target sequence of the EGFR gene, is SEQ ID NO:Sequence shown in 2.

2. a kind of nucleic acid molecules medicine for treating colon cancer, its active ingredient contains reduces CIT gene expressions in tumour cell The nucleic acid molecules of separation, and reduce the nucleic acid molecules of the separation of EGFR gene expression in tumour cell；

The nucleic acid molecules of the separation of CIT gene expressions are included in the reduction tumour cell：

A) CIT genes double-stranded RNA, in the CIT genes double-stranded RNA containing can under stringent condition with CIT gene recombinations Nucleotide sequence；Or

B) CIT genes shRNA, in the CIT genes shRNA containing can under stringent condition with the nucleosides of CIT gene recombinations Acid sequence；

A.EGFR gene double-stranded RNAs, containing in the EGFR gene double-stranded RNA can hybridize under stringent condition with EGFR gene Nucleotide sequence；Or

B.EGFR genes shRNA, contains the core that can hybridize with EGFR gene under stringent condition in the EGFR gene shRNA Nucleotide sequence；

The CIT genes double-stranded RNA includes the first chain and the second chain, and first chain and the second chain complementation are collectively forming RNA dimers；The CIT genes shRNA includes positive-sense strand fragment and antisense strand fragment, and connect the positive-sense strand fragment and The sequence of the loop-stem structure of antisense strand fragment, the positive-sense strand fragment and the antisense strand fragment is complementary；The EGFR gene is double Chain RNA includes the first chain and the second chain, and first chain and the second chain complementation are collectively forming RNA dimers；The EGFR Gene shRNA includes positive-sense strand fragment and antisense strand fragment, and the stem ring for connecting the positive-sense strand fragment and antisense strand fragment The sequence of structure, the positive-sense strand fragment and the antisense strand fragment is complementary；The target sequence of the CIT genes, is SEQ ID NO:Sequence shown in 1；The target sequence of the EGFR gene, is SEQ ID NO:Sequence shown in 2.

3. nucleic acid molecules medicine as claimed in claim 2, it is characterised in that the double-stranded RNA is siRNA, and CIT The sequence of the chain of gene siRNA first such as SEQ ID NO：Shown in 9；The sequence such as SEQ of the chain of EGFR gene siRNA first ID NO：Shown in 10；The sequence such as SEQ ID NO of the CIT genes shRNA:Shown in 11；The sequence of the EGFR gene shRNA Such as SEQ ID NO:Shown in 12.

4. a kind of slow virus carrier medicine for treating tumour, its active ingredient contains the interference of CIT genes slow virus carrier and EGFR Gene disturbs slow virus carrier, the CIT genes interference slow virus carrier to contain coding claim 2-3 any claims institute State the genetic fragment of the CIT genes shRNA in nucleic acid molecules medicine；The EGFR gene interference slow virus carrier contains coding power Profit requires the genetic fragment of the EGFR gene shRNA in nucleic acid molecules medicine described in 2-3 any claims.

5. a kind of slow virus medicine for treating tumour, its active ingredient contains CIT genes interference slow virus and EGFR gene interference Slow virus, the CIT genes interference slow virus is as the slow disease of CIT genes interference in slow virus carrier medicine described in claim 4 Poisonous carrier is formed under slow virus packaging plasmid, the auxiliary of cell line by virus packaging；The EGFR gene disturbs slow virus Slow virus carrier is disturbed in slow virus packaging plasmid, cell as the EGFR gene in slow virus carrier medicine described in claim 4 Under the auxiliary of system, formed by virus packaging.

6. a kind of pharmaceutical composition for treating colon cancer, its composition divides containing nucleic acid described in claim 2-3 any claims Nucleic acid molecules, the slow virus carrier medicine described in claim 4 of the separation for reducing CIT gene expressions in tumour cell in sub- medicine In the CIT genes interference slow virus in CIT genes interference slow virus carrier, slow virus medicine described in claim 5 in thing It is at least one；And EGFR bases in the reduction tumour cell in nucleic acid molecules medicine described in claim 2-3 any claims Because express separation nucleic acid molecules, slow virus carrier medicine described in claim 4 in EGFR gene interference slow virus carrier, At least one in EGFR gene interference slow virus in slow virus medicine described in claim 5.