CN103656674B - Application of human eIF5B gene and related medicine thereof - Google Patents
Application of human eIF5B gene and related medicine thereof Download PDFInfo
- Publication number
- CN103656674B CN103656674B CN201210314148.3A CN201210314148A CN103656674B CN 103656674 B CN103656674 B CN 103656674B CN 201210314148 A CN201210314148 A CN 201210314148A CN 103656674 B CN103656674 B CN 103656674B
- Authority
- CN
- China
- Prior art keywords
- gene
- eif5b
- plko
- tumor
- human
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of a human eIF5B gene and a related medicine thereof. The invention discloses an application of a human eIF5B gene in tumor treatment, tumor diagnosis and medicine preparation. The invention further constructs a small interfering RNA of the human eIF5B gene, an interfering nucleic acid construct of the human eIF5B gene, an interfering lentivirus of the human eIF5B gene and discloses the application of the small interfering RNA and the interfering nucleic acid construct. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the expression of the human eIF5B gene, particularly the lentivirus can efficiently infect target cells, efficiently inhibit the expression of the eIF5B gene in the target cells, further inhibit the growth of tumor cells and promote the apoptosis of the tumor cells, and have important significance in tumor treatment.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of a human eIF5B gene and a related medicine thereof.
Background
RNA interference (RNAi) is the post-transcriptional gene silencing by short double-stranded RNA (dsrna) composed of nucleotides. It can block the expression of specific gene in body efficiently and specially to result in its degradation, so that it can cause the silencing of specific gene in the body and make the cell show the deletion of some gene phenotype. Studies have shown that double-stranded RNA of 21-23nt in length is capable of specifically causing RNAi at the transcriptional and post-transcriptional levels (Tuschl T, Zamore PD, Sharp PA, Bartel DP. RNAi: double-stranded RNA direct the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. cell 2000; 101: 25-33.). The five-year survival rate of tumor patients is very low although chemotherapy, radiotherapy and comprehensive treatment are carried out on the tumor patients, and if genes related to the tumor morbidity and progression can be intervened, a new way for treating tumors can be developed. In recent years, RNAi has become an effective strategy for gene therapy of tumors. RNAi technology can be used to inhibit the expression of proto-oncogenes, mutated anti-oncogenes, cell cycle-related genes, anti-apoptosis-related genes, etc., to inhibit tumor progression (Uplichard, Susan L. the therapeutic potential of RNA interference. FEBS Letters 2005; 579: 5996-.
Eukaryotic translation initiation factors (eIFs) are a class of proteins necessary for protein translation in eukaryotic cells to ensure the formation of correct mRNA-ribosome complexes, and there are 20 more proteins constituting eIFs currently found, most of which act as complexes by constituting different eFs in the form of multiple subunits, among which eIF-2, eIF-3, eIF-4 and eIF-5 are more studied, and they act differently during translation initiation (Damoc E, Fraser CS, Zhou M, et a1.structural initiation factor 3protein complex by mass spectrometry. mol protein 2007; 10 (7): 1135.). 1146). In recent years, more and more researches show that the eIFs have other functions besides the important function in the translation initiation stage of eukaryotic cells, and a plurality of eIFs are closely related to the occurrence and the development of tumors.
The first eIFs found to be highly expressed in tumors was eIF-4E. eIF-4E is highly expressed in some solid malignant tumors compared to normal or benign tumors, and its expression level is also correlated with the staging progression of the tumor (LEE JW, Choi JJ, Lee KM, Choi CH, et al eIF-4E expressed with histopathological grades in central neoplastic. hum Pathol.2005; 36(11):1197-203.Hershey J.W.B.Regulation of protein synthesis and the role of eIF3 in cancer.Z.J.Med.biol.Res.2010; 43(10): 920-. expression of eIF-2a is also frequently increased in many tumors, and the expression of eIF-2a in 88 Hodgkin lymphomas is detected by researchers using immunohistochemistry, and the expression of eIF-2a in aggressive lymphomas and high and low aggressive lymphomas is found to be strongly positive, suggesting that eIF-2a plays an important role in the development and invasion of lymphomas (Wang S, Rosenwald IB, Hutzler MJ, Pihan GA, Savas L, Chen.JJ, et al.expression of eutropic infection factor 4E and 2a in non-Hodgkin' S lymphoma. am J Pathol.1999; 155: 247-55.). Recently, it has been found that the expression of P170, the largest subunit of eIF-3, is significantly increased in human breast, cervical, esophageal and lung cancers (Zong ZZ, Liu Z, Cui P, et a1.role of eIF3a in regulating Cell cycle progression. Exp Cell Res.2009; 315 (11): 1889-. Yet another subunit p40 of eIF-3 also exhibits high expression in some prostate and primary breast cancers (Tomlinson IP, Webb E, Carvajal-carmona L, el at. A genome-with association study identities. Colorfic cancer sub-availability loci on chromosomes 10p14 and8q23.3.nat Genet.2008; 40 (5): 623-630. Capupuzzo F, Varella-carcia M.Rossi E.el. MYC and can eIF3H co-amplification expression improvement and provision of non-small cell lung tissues (NSCLC) P-and III; 478. C.J.2009. III.4. Onck.472). In order to solve the problem of high expression of eIFs in tumors, the correlation between eIF and tumors was further studied, and many eIFs were also involved in the regulation of cell degeneration, and in the regulation of tumor development, invasion and metastasis (Zhang LL. Pan XY, Hershey JWB. Industral expression of Five Subunutions of Human transformation Initiation Factor F3 proteins transformation of moveable fibrous cells. Biol. chem. 2007; 282 (8): 5790-5800.Zhang L, Sm-Mcbrid Z, Pan X, et aL. Anoeogenie roll for the phosphorylated Human transformation of chemistry of 24047) (24035. J. Efford. 2008. Effonia). These studies focused on several factors eIF-2, eIF-3 and eIF-4.
eIF-5B is a subunit of eIF-5 factor, a GTPase that specifically activates the GTPase activity of eIF-2 (Lee JH, Pestova TV, Shin BS, et al. initiation factor eIF5B cassettes second GTP-dependent step in acute transformation initiation. PNAS.2002; 99(26): 16689) -16694.). There are few reports of eIF-5B in tumor-related fields. In order to research the correlation between the eIF-5B and tumors, cell models of lung cancer, gastric cancer, colon cancer and glioma are selected, and the effect of eIF5B in the occurrence and development of the lung cancer, the gastric cancer, the colon cancer and the glioma is researched by taking RNAi as a means.
Disclosure of Invention
The invention aims to disclose a treatment method and a medicament related to a human eIF5B (apoptosis initiation factor 5B) gene, and research the effect of the eIF5B gene in the survival and apoptosis process of tumor cells by taking RNA interference (RNAi) as a means.
In a first aspect of the invention, the role of the eIF5B gene in tumorigenesis and development is studied by means of RNA interference, and a method for inhibiting or reducing tumor cell growth, proliferation, differentiation and/or survival is disclosed, which comprises: administering to the tumor cell a molecule capable of specifically inhibiting the transcription or translation of the eIF5B gene, or capable of specifically inhibiting the expression or activity of eIF5B protein, thereby inhibiting growth, proliferation, differentiation, and/or survival of the tumor cell.
The tumor cell is selected from the group consisting of tumor cells whose growth is associated with expression or activity of eIF5B protein. Preferably, the tumor cell is selected from any one of gastric cancer, lung cancer, colon cancer and glioma.
In the method of inhibiting or reducing tumor cell growth, proliferation, differentiation and/or survival, the molecule is administered in an amount sufficient to reduce transcription or translation of the eIF5B gene, or to reduce expression or activity of eIF5B protein. Further, expression of the eIF5B gene is reduced by at least 50%, 80%, 90%, 95%, or 99%.
The molecule may be selected from, but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.
Such nucleic acids include, but are not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA (esiRNA) produced by endoribonuclease III, or short hairpin RNA (shRNA).
The double-stranded RNA, ribozyme, esiRNA or shRNA contains a promoter sequence of an eIF5B gene or an information sequence of an eIF5B gene.
Further, the double-stranded RNA is small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand that are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a sequence of 15-27 contiguous nucleotides in the eIF5B gene. The small interfering RNA can specifically bind to an mRNA fragment encoded by a target sequence and specifically silence the expression of the human eIF5B gene.
Further, the first strand sequence of the small interfering RNA is substantially identical to the target sequence in the eIF5B gene. Preferably, the target sequence in the eIF5B gene comprises any one of SEQ ID NO 1-74.
The target sequence in the eIF5B gene is a fragment in the eIF5B gene corresponding to an mRNA fragment complementarily combined with the small interfering RNA when the small interfering RNA specifically silences the expression of the eIF5B gene.
Preferably, the eIF5B gene is of human origin.
The invention also discloses the application of the separated human eIF5B gene in preparing or screening tumor treatment medicines or preparing tumor diagnosis medicines.
Further, the tumor is any one selected from gastric cancer, lung cancer, colon cancer and glioma.
The application of the isolated eIF5B gene in preparing or screening tumor treatment medicines comprises two aspects: firstly, the eIF5B gene is used as a drug or preparation to be applied to preparing a tumor treatment drug or preparation aiming at the action target of tumor cells; secondly, the eIF5B gene is used as a drug or preparation to be applied to screening tumor treatment drugs or preparations aiming at the action target of tumor cells.
The application of the eIF5B gene as a drug or preparation aiming at the action target of tumor cells in preparing tumor treatment drugs or preparations specifically comprises the following steps: the eIF5B gene is used as a target of RNA interference effect to develop a medicament or a preparation aiming at the tumor cells, so that the expression level of the eIF5B gene in the tumor cells can be reduced.
The application of the eIF5B gene as a drug or preparation for screening tumor treatment drugs or preparations aiming at the action target of tumor cells specifically comprises the following steps: the eIF5B gene is used as an action object, and a drug or a preparation is screened to find a drug which can inhibit or promote the expression of the human eIF5B gene and is used as a candidate drug for tumor treatment. The eIF5B gene small interfering RNA (siRNA) is obtained by screening human eIF5B gene as an action object and can be used as a medicine for inhibiting tumor cell proliferation. In addition, for example, antibody drugs, small molecule drugs and the like can also use the eIF5B gene and its protein as the target of action.
The application of the eIF5B gene in preparing a tumor diagnosis medicament refers to the application of an eIF5B gene expression product as a tumor diagnosis index in preparing a tumor diagnosis medicament.
The tumor treatment drug is a molecule which can specifically inhibit the transcription or translation of an eIF5B gene or specifically inhibit the expression or activity of an eIF5B protein, so that the expression level of the eIF5B gene in a tumor cell is reduced, and the purposes of inhibiting the proliferation, growth, differentiation and/or survival of the tumor cell are achieved.
The tumor treatment drug or tumor diagnosis drug prepared or screened by the isolated eIF5B gene includes but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.
Such nucleic acids include, but are not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA (esiRNA) produced by endoribonuclease III, or short hairpin RNA (shRNA).
The amount of the tumor treatment drug administered is a dose sufficient to reduce transcription or translation of the human eIF5B gene, or to reduce expression or activity of the human eIF5B protein. Such that expression of the human eIF5B gene is reduced by at least 50%, 80%, 90%, 95%, or 99%.
The method for treating the tumor by adopting the tumor treatment medicine mainly achieves the aim of treating by reducing the expression level of the human eIF5B gene and inhibiting the proliferation of tumor cells. In particular, a substance effective to reduce the expression level of human eIF5B gene is administered to a patient during treatment.
In a second aspect, the invention discloses an isolated nucleic acid molecule for reducing expression of eIF5B gene in a tumor cell, said nucleic acid molecule comprising:
a) a double-stranded RNA comprising a nucleotide sequence capable of hybridizing to the eIF5B gene under stringent conditions; or
b) An shRNA comprising a nucleotide sequence capable of hybridizing to an eIF5B gene under stringent conditions.
Further, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a sequence of 15-27 contiguous nucleotides in the eIF5B gene. Preferably, the sequence of the first strand is substantially identical to a 19-23 contiguous nucleotide sequence in the eIF5B gene; more preferably, the sequence of the first strand is substantially identical to a sequence of 19, 20, or 21 contiguous nucleotides of the eIF5B gene.
Further, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the eIF5B gene.
Further, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is substantially identical to 15-27 consecutive nucleotide sequences in the eIF5B gene. The shRNA can become small interfering RNA (siRNA) after being processed, and further plays a role in specifically silencing expression of endogenous eIF5B gene in tumor cells.
Further, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is substantially identical to a target sequence in the eIF5B gene.
The first strand of the double-stranded RNA or the sense strand fragment of the shRNA is basically the same as a target sequence in an eIF5B gene, and the target sequence of the eIF5B gene is a fragment in an eIF5B gene corresponding to an mRNA fragment which is recognized and silenced by siRNA when the siRNA is used for specifically silencing eIF5B gene expression.
Preferably, the target sequence in the eIF5B gene comprises any one of SEQ ID NO 1-74.
Further, the eIF5B gene is derived from human.
The length of the first strand and the second strand of the double-stranded RNA are both 15-27 nucleotides; preferably, the length is 19-23 nucleotides; most preferably, the length is 19, 20 or 21 nucleotides.
Further, the double-stranded RNA is small interfering RNA (siRNA). Further, the sequence of the first strand of the small interfering RNA is shown in SEQ ID NO: shown at 86 and specifically 5'-CGGCGACUUGAACAUAGUAAA-3'.
SEQ ID NO: the siRNA shown by 86 is one strand of small interfering RNA which is designed by taking the sequence shown by SEQ ID NO. 2 as an RNA interference target sequence and aims at the human eIF5B gene, the sequence of the other strand, namely the second strand, is complementary with the sequence of the first strand, and the siRNA can play a role in specifically silencing the expression of the endogenous eIF5B gene in tumor cells.
Further, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, and CCACACC.
Furthermore, the sequence of the shRNA is shown as SEQ ID NO:87, and specifically comprises the following components: 5'-CGGCGACUUGAACAUAGUAAA UUCAAGAGAUUUACUAUGUUCAAGUCGCCG-3' are provided.
The shRNA can become siRNA after enzyme digestion processing, and further plays a role in specifically silencing the expression of endogenous human eIF5B gene in tumor cells.
The interfering slow virus vector of the gene segment for encoding shRNA contains any sequence in SEQ ID NO 1-74 and a complementary sequence thereof.
In a third aspect of the invention, an eIF5B gene interference nucleic acid construct is disclosed, which comprises a gene segment for encoding shRNA in the separated nucleic acid molecule of the invention and can express the shRNA
The human eIF5B gene interference nucleic acid construct can be obtained by cloning a gene segment for coding the human eIF5B gene shRNA into a known vector. Further, the eIF5B gene interference nucleic acid construct is an eIF5B gene interference lentiviral vector.
The eIF5B gene interference lentiviral vector is obtained by cloning a DNA fragment for coding the eIF5B gene shRNA into a known vector, wherein the known vector is mostly a lentiviral vector, the eIF5B gene interference lentiviral vector is packaged into infectious viral particles by viruses, then infects tumor cells, further transcribes the shRNA, and the siRNA is finally obtained through steps of enzyme digestion and the like and is used for specifically silencing the expression of the eIF5B gene.
Further, the eIF5B gene interference lentiviral vector also contains a promoter sequence and/or a nucleotide sequence encoding a marker which can be detected in tumor cells; preferably, the detectable label is Green Fluorescent Protein (GFP).
Further, the lentiviral vector may be selected from the group consisting of: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti 6-GW/U6-laminsham, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti 6.2/N-Lumio/V5-GW/lacZ.
The embodiment of the invention specifically discloses a human eIF5B gene interference lentiviral vector constructed by taking pGCSIL-GFP as a vector, which is named as pGCSIL-GFP-eIF 5B-siRNA.
The isolated nucleic acid molecule can be used for preparing a medicament for preventing or treating tumors, wherein the tumors are gastric cancer, lung cancer, colon cancer or glioma.
The eIF5B gene siRNA can be used for inhibiting the proliferation of tumor cells, and further can be used as a medicine or a preparation for treating tumors. The eIF5B gene interference lentiviral vector can be used for preparing the eIF5B gene siRNA. When used as a medicament or formulation for treating tumors, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The particular dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.
The fourth aspect of the invention discloses an eIF5B gene interference lentivirus, which is formed by virus packaging of the eIF5B gene interference lentivirus vector under the assistance of lentivirus packaging plasmids and cell lines. The lentivirus can infect tumor cells and generate small interfering RNA aiming at eIF5B gene, thereby inhibiting the proliferation of gastric cancer, lung cancer, colon cancer or glioma tumor cells. The eIF5B gene interference lentivirus can be used for preparing a medicament for preventing or treating tumors.
In the fifth aspect of the invention, a pharmaceutical composition for preventing or treating tumors is disclosed, and the effective substances of the pharmaceutical composition comprise the isolated nucleic acid molecule, the eIF5B gene interference nucleic acid construct and/or the eIF5B gene interference lentivirus.
Further, the pharmaceutical composition contains 1-99 wt% of the double-stranded RNA, shRNA, eIF5B gene interference nucleic acid construct or eIF5B gene interference lentivirus, and a pharmaceutically acceptable carrier, diluent or excipient.
In preparing these compositions, the active ingredient is typically mixed with, or diluted with, excipients or enclosed within a carrier which may be in the form of a capsule or sachet. When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material that acts as a vehicle, carrier, or medium for the active ingredient. Thus, the composition may be in the form of tablets, pills, powders, solutions, syrups, sterile injectable solutions and the like. Examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starch, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, and the like. The preparation may further comprise a humectant, an emulsifier, a preservative (such as methyl and propyl hydroxybenzoate), a sweetener, etc.
The invention also discloses application of the pharmaceutical composition in preparing a tumor treatment medicament for treating any one of gastric cancer, lung cancer, colon cancer or glioma.
The application of the pharmaceutical composition provides a method for treating tumors, in particular to a method for preventing or treating tumors in a subject, which comprises the step of administering an effective dose of the pharmaceutical composition to the subject. Further, the tumor is any one selected from gastric cancer, lung cancer, colon cancer and glioma.
When the pharmaceutical composition is used for preventing or treating tumors in a subject, an effective dose of the pharmaceutical composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of the tumor is inhibited. Further, at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% fraction of the growth, proliferation, recurrence and/or metastasis of the tumor is inhibited.
In a sixth aspect of the invention, a kit for reducing eIF5B gene expression in a tumor cell is disclosed, the kit comprising: the isolated nucleic acid molecule, the eIF5B gene interfering nucleic acid construct, and/or the eIF5B gene interfering lentivirus present in the container.
In conclusion, the invention designs 74 RNAi target sequences of human eIF5B gene, and constructs corresponding eIF5B RNAi vector, wherein the coding sequence is SEQ ID NO:2, the RNAi vector pGCSIL-GFP-eIF5B-siRNA can remarkably reduce the expression of eIF5B gene at mRNA level and protein level. The slow virus (lentivirus, abbreviated as Lv) is used as a gene operation tool to carry an RNAi vector pGCSIL-GFP-eIF5B-siRNA, so that the RNAi sequence aiming at the eIF5B gene can be efficiently introduced into human lung cancer H1299 cells, gastric cancer SGC7901 cells, colon cancer RKO cells and glioma U87 cells in a targeted manner, the expression level of the EIF5B gene is reduced, and the proliferation capacity of the tumor cells is remarkably inhibited. Lentivirus-mediated eIF5B gene silencing is therefore a potential clinical non-surgical treatment for malignancies.
The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the expression of the human eIF5B gene, particularly the lentivirus can efficiently infect target cells, efficiently inhibit the expression of the eIF5B gene in the target cells, further inhibit the growth of tumor cells and promote the apoptosis of the tumor cells, and have important significance in tumor treatment.
Drawings
FIG. 1: pGCSIL-GFP plasmid DNA map
FIG. 2: eIF 5B-after 5 days of infection of human lung cancer H1299 cells, gastric cancer SGC7901, colon cancer H1299 cells and glioma U87 cells by RNAi lentivirus, the expression level of eIF5B mRNA is remarkably reduced
FIG. 3: eIF 5B-infection of human lung cancer H1299 cell by RNAi lentivirus 5 days later, resulting in cell proliferation inhibition
FIG. 4: eIF 5B-inhibition of cell proliferation caused by 5 days after SGC7901 cells of human gastric cancer infected by RNAi lentivirus
FIG. 5: eIF 5B-inhibition of cell proliferation caused by infection of human colon cancer RKO cells with RNAi lentivirus 5 days later
FIG. 6: eIF 5B-infection of human glioma U87 cell by RNAi lentivirus 5 days later, resulting in cell proliferation inhibition
Detailed Description
The invention is based on the fact that various eukaryotic translation initiation factors are closely related to the occurrence and development of tumors, and the eIF5B is used as a eukaryotic translation initiation factor and is presumed to possibly participate in the occurrence and development of malignant tumors.
The invention relates to a group of small interfering RNA (siRNA) sequences, RNA interference vectors and RNA interference lentiviruses aiming at a human eIF5B gene. The coding region sequence of the eIF5B mRNA is selected as the target site of siRNA, and the siRNA target site sequence is designed according to the continuous 10-30 (preferably 15-27, more preferably 19-23) base sequences in the target site. Constructing a nucleic acid construct expressing the siRNA through gene cloning, and packaging the lentivirus expressing the siRNA. Cell experiments prove that the siRNA sequence can specifically silence the expression of the endogenous eIF5B gene in human tumor cells.
The inventor finds that the expression of the human eIF5B gene can be effectively inhibited after the expression is down-regulated by an RNAi method, and the research result shows that the eIF5B gene is a protooncogene and can be used as a target for tumor treatment. The inventor further synthesizes and tests a plurality of siRNAs aiming at the eIF5B gene, screens out the siRNA which can effectively inhibit the expression of eIF5B and further inhibit the proliferation and growth of human lung cancer H1299 cells, gastric cancer SGC7901 cells, colon cancer RKO cells and glioma U87 cells, and completes the invention on the basis.
The invention provides a series of small interfering RNA (siRNA) sequences interfering with human eIF5B gene, and constructs a lentivirus capable of specifically silencing eIF5B gene expression. The research of the invention finds that the expression of the eIF5B gene is stably and specifically down-regulated by the small interfering RNA and RNAi lentivirus designed aiming at the human eIF5B gene, and the proliferation of human tumor cells is effectively inhibited. The invention shows that the eIF5B gene can promote the growth of tumor cells and is expected to become a target for early diagnosis and treatment of tumors. Furthermore, silencing the expression of the eIF5B gene by RNAi can be an effective means for inhibiting tumor development.
The design idea of the invention is as follows:
the invention obtains a human eIF5B gene RNAi lentivirus by screening through the following method: calling a human eIF5B gene sequence from Genbank; predicting the siRNA site; synthesizing an effective siRNA sequence aiming at the eIF5B gene, wherein two ends of the effective siRNA sequence contain double-stranded DNA Oligo of the sticky ends of enzyme cutting sites; after double enzyme digestion, the lentiviral vector is connected with a double-stranded DNA Oligo to construct an RNAi plasmid for expressing eIF5B gene siRNA sequence; the RNAi plasmid and a helper vector (packaging Mix, Sigma-aldrich company) required by lentivirus packaging are cotransfected with a human embryonic kidney cell 293T to generate recombinant lentivirus particles, and the lentivirus of the eIF5B gene can be efficiently silenced.
Based on the method, the invention provides 74 effective targets (shown as SEQ ID NO 1-74) for interfering eIF5B gene, and constructs the lentivirus of the specific interference eIF5B gene.
Meanwhile, the invention also discloses an RNAi lentivirus (eIF5B-RNAi) of the human eIF5B gene and preparation and application thereof.
The research discovers that the expression of the eIF5B gene in the tumor cells can be effectively inhibited by using a lentivirus-mediated RNAi method. The research shows that the eIF5B gene is a protooncogene, can promote the proliferation of tumor cells, has important biological functions in the occurrence and development of tumors, the eIF5B gene can be a target for tumor treatment, and the lentivirus-mediated eIF5B gene specific silencing can be used as a new means for tumor treatment.
The invention is further illustrated by the following examples. It should be understood that the examples are for illustrative purposes only and are not intended to limit the scope of the present invention. In the examples, the experimental methods and reagents having no specific conditions described therein were performed under conventional conditions, such as those described in [ U.S. Sambrook.J.; huang Beitang, etc. Molecular cloning test guidelines, third edition. Beijing: the conditions described in scientific press 2002 or conditions suggested by the manufacturer.
Example 1 preparation of RNAi lentivirus against the human eIF5B gene
1. Screening effective siRNA target point aiming at human eIF5B gene
The EIF5B (NM-015904) gene information is retrieved from Genbank; effective siRNA targets aiming at EIF5B gene are designed by utilizing design software Genechem of Shanghai Jikai Genencochemistry technology Limited. In the coding sequence (CDS) region of EIF5B gene, a sequence of 21 bases was obtained starting every other base, and table 1 lists 74 of them as effective siRNA target sequences against EIF5B gene.
TABLE 1 siRNA target sequences targeting the human eIF5B gene
2. Preparation of Lentiviral vectors
Synthesizing double-stranded DNA Oligo sequences (Table 2) containing Age I and EcoR I enzyme cutting sites at two ends aiming at siRNA targets (taking SEQ ID NO:2 as an example); the restriction enzymes Age I and EcoR I were used to act on pGCSIL-GFP vector (supplied by Shanghai Jikai Gene chemistry, Ltd., FIG. 1), which was linearized, and the cleaved fragments were identified by agarose gel electrophoresis.
TABLE 2 double-stranded DNA Oligo with Age I and EcoR I cleavage sites at both ends
| 5’ | Neck | Ring (C) | Neck | 3’ | SEQ | |
| Sense strand | CCGG | CGGCGACTTGAACATAGTAAA | TTCAAGAGA | TTTACTATGTTCAAGTCGCCG | TTTTTG | 75 |
| Antisense strand | AATTCAAAAA | CGGCGACTTGAACATAGTAAA | TCTCTTGAA | TTTACTATGTTCAAGTCGCCG | 76 |
The vector DNA linearized by double digestion (digestion system shown in Table 4, 37 ℃ C., reaction time 1h) and the purified double-stranded DNA Oligo were ligated by T4 DNA ligase, and ligated overnight at 16 ℃ in an appropriate buffer system (ligation system shown in Table 5), and the ligation product was recovered. The ligation product was transformed into calcium chloride prepared fresh E.coli competent cells (transformation protocol reference: molecular cloning protocols second edition, pages 55-56). Dipping the surface of the clone of the strain growing out of the connected transformation product, dissolving the surface in 10 mul LB culture medium, uniformly mixing and taking 1 mul as a template; a universal PCR primer (an upstream primer sequence: 5'-CCTATTTCCCATGATTCCTTCATA-3' (SEQ ID NO: 79) and a downstream primer sequence: 5'-GTAATACGGTTATCCACGCG-3' (SEQ ID NO: 80) are designed at the upstream and downstream of an RNAi sequence in a lentiviral vector, a PCR identification experiment is carried out (a PCR reaction system is shown in a table 6-1, and reaction conditions are shown in a table 6-2), a clone with positive PCR identification is sequenced and compared and analyzed, and the clone with correct comparison is the vector for constructing successful RNAi expression aiming at the SEQ ID NO:2 and is named as pGCSIL-GFP-EIF 5B-siRNA.
pGCSIL-GFP-Scr-siRNA negative control plasmid was constructed with negative control siRNA target sequence 5'-TTCTCCGAACGTGTCACGT-3' (SEQ ID NO: 81). When pGCSIL-GFP-Scr-siRNA negative control plasmids are constructed, double-stranded DNA Oligo sequences (table 3) containing adhesive ends of Age I and EcoR I enzyme cutting sites at two ends are synthesized aiming at Scr siRNA targets, and the rest construction methods, identification methods and conditions are the same as pGCSIL-GFP-EIF 5B-siRNA.
TABLE 3 double-stranded DNA Oligo with Age I and EcoR I cleavage sites sticky ends at both ends
| 5’ | Neck | Ring (C) | Neck | 3’ | SEQ | |
| Sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 77 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 78 |
The vector was linearized by T4 DNA ligase (digestion system shown in Table 4, 37 ℃ C., reaction time 1h)
TABLE 4 pGCSIL-GFP plasmid digestion reaction System
| Reagent | Volume (μ l) |
| pGCSIL-GFP plasmid (1. mu.g/. mu.l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H2O | 40.5 |
| Total | 50.0 |
TABLE 5 ligation reaction System of vector DNA and double-stranded DNA Oligo
| Reagent | Positive control (μ l) | Self-contained control (μ l) | Connecting group (mu l) |
| Linearized vector DNA (100 ng/. mu.l) | 1.0 | 1.0 | 1.0 |
| Annealed double stranded DNA Oligo (100 ng/. mu.l) | 1.0 | - | 1.0 |
| 10 |
1.0 | 1.0 | 1.0 |
| T4 bacteriophageDNA ligase | 1.0 | 1.0 | 1.0 |
| dd H2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
TABLE 6-1 PCR reaction System
TABLE 6-2 PCR reaction System Programming
3. Packaging eIF5B-siRNA lentivirus
The DNA of RNAi plasmid pGCSIL-GFP-eIF5B-siRNA was extracted with a plasmid extraction kit from Qiagen corporation to prepare 100 ng/. mu.l stock solution.
24h before transfection, human embryonic kidney cell 293T cells in logarithmic growth phase were trypsinized and cell density was adjusted to 1.5X 10 in DMEM complete medium containing 10% fetal bovine serum5Cells/ml, seeded in 6-well plates at 37 ℃ with 5% CO2Culturing in an incubator. The cell density can reach 70-80% to be used for transfection. 2h before transfection, the original medium was aspirated and 1.5ml of fresh complete medium was added. Mu.l of Packing Mix (PVM), 12. mu.l of PEI, and 400. mu.l of serum-free DMEM medium were added to a sterilized centrifuge tube according to the instructions of the MISSION Lentiviral Packing Mix kit from Sigma-aldrich, and 20. mu.l of the above-mentioned extracted plasmid DNA was added to the above-mentioned PVM/PEI/DMEM mixture.
The transfection mixture was incubated at room temperature for 15min, transferred to medium of human embryonic kidney 293T cells at 37 ℃ with 5% CO2Culturing for 16h in an incubator. The medium containing the transfection mixture was discarded, washed with PBS solution, 2ml of complete medium was added and incubation continued for 48 h. The cell supernatant was collected, and the lentivirus was purified and concentrated by a Centricon Plus-20 centrifugal ultrafiltration device (Millipore) according to the following steps: (1) centrifuging at 4 deg.C and 4000g for 10min to remove cell debris; (2) filtering the supernatant with a 0.45 μm filter in a 40ml ultracentrifuge tube; (3) centrifuging at 4000g for 10-15min to obtain the required virus concentration volume; (4) after the centrifugation is finished, separating the filter cup from the lower filtrate collecting cup, reversely buckling the filter cup on the sample collecting cup, and centrifuging for 2min until the centrifugal force is not more than 1000 g; (5) the centrifuge cup is removed from the sample collection cup, and the virus concentrate is obtained. Subpackaging the virus concentrated solution and storing at-80 ℃. The sequence of the first strand of siRNA contained in the virus concentrate is shown in SEQ ID NO 86. The packaging procedure for the control lentivirus was identical to that of the eIF5B-siRNA lentivirus, except that the pGCSIL-GFP-Scr-siRNA vector was used in place of the pGCSIL-GFP-eIF5B-siRNA vector.
Example 2 detection of silencing efficiency of eIF5B Gene by real-time fluorescent quantitative RT-PCR
Human lung cancer H1299 cells, stomach cancer SGC7901 cells, colon cancer RKO cells and glioma U87 cells in logarithmic growth phase are trypsinized to prepare cell suspension (the number of cells is about 5 multiplied by 10)4/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the value of the multiplicity of infection (MOI, H1299:20, SGC 7901: 20, RKO: 20, U87:20), an appropriate amount of the virus prepared in example 1 was added, the medium was changed after 24 hours of culture, and after the infection time reached 5 days, the cells were collected. According to InvitTotal RNA was extracted according to the Trizol Instructions from the rogen company. The RNA was reverse-transcribed to obtain cDNA according to the M-MLV protocol of Promega (reverse transcription reaction system shown in Table 7, reaction at 42 ℃ for 1 hour, followed by inactivation of the reverse transcriptase by water bath in a 70 ℃ water bath for 10 min).
Real-time quantitative detection was carried out using a TP800 Real time PCR instrument (TAKARA). The primers for the EIF5B gene are as follows: an upstream primer 5'-ACGGAGGATTGAGAAACG-3' (SEQ ID NO: 82) and a downstream primer 5'-AAGAGGAACATTGGTGGC-3' (SEQ ID NO: 83). The housekeeping gene GAPDH is used as an internal reference, and the primer sequences are as follows: an upstream primer 5'-TGACTTCAACAGCGACACCCA-3' (SEQ ID NO: 84) and a downstream primer 5'-CACCCTGTTGCTGTAGCCAAA-3' (SEQ ID NO: 85). The reaction system was prepared in the proportions shown in Table 8.
TABLE 7 reverse transcription reaction System
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H2O | 3.5 |
| Total | 11.0 |
TABLE 8 Real-time PCR reaction System
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Upstream primer (2.5 μ M): | 0.5 |
| downstream primer (2.5 μ M): | 0.5 |
| cDNA | 1.0 |
| ddH2O | 8.0 |
| Total | 20.0 |
the program was a two-step Real-time PCR: pre-denaturation at 95 ℃ for 15 s; then, denaturation is carried out at 95 ℃ for 5s in each step; annealing and extending for 30s at 60 ℃; a total of 45 cycles were performed. Each time reading the absorbance value during the extension phase. After the PCR was completed, the DNA was denatured at 95 ℃ for 1min, and then cooled to 55 ℃ to allow the DNA double strands to be sufficiently bound. From 55 deg.CThe melting curve was prepared by increasing the temperature to 95 ℃ by 0.5 ℃ for each step and holding the temperature for 4 seconds while reading the absorbance. By adopting 2-ΔΔCtThe assay calculated the expression abundance of EIF5B infected mRNA. Cells infected with a control virus (Lv-Scr-siRNA) served as controls. The results of the experiment (fig. 2) showed that the expression levels of EIF5B mRNA in human lung cancer H1299 cells, gastric cancer SGC7901 cells, colon cancer RKO cells and glioma U87 cells were down-regulated by 95.0%, 91.5%, 74.5% and 91.5%.
Example 3 examination of the proliferative Capacity of tumor cells infected with eIF5B-siRNA lentivirus
Human H1299 cells, gastric carcinoma SGC7901 cells, colon carcinoma RKO cells and glioma U87 cells in logarithmic growth phase were trypsinized to prepare cell suspensions (cell number about 5X 104/ml) were inoculated in 6-well plates and cultured until the degree of cell confluence reached about 30%. According to the number of infection (MOI, H1299:20, SGC 7901: 20, RKO: 20, U87:20), an appropriate amount of virus was added, the culture medium was changed after 24 hours of culture, and after the infection time reached 5 days, cells of each experimental group in the logarithmic growth phase were collected. Complete medium resuspension into cell suspension (2X 10)4Per ml) at a cell density of about 2000 per well, 96-well plates were seeded. Each set of 5 duplicate wells, 100. mu.l per well. After the plate is laid, the plate is placed at 37 ℃ and 5% CO2Culturing in an incubator. The plate readings were performed once a day with Cellomics apparatus (Thermo Fisher) for 5 consecutive days starting the second day after plating. The number of green fluorescent cells in the well plate per scan was accurately calculated by adjusting the input parameters of the Cellomics arrayscan, and the data were statistically plotted to generate cell proliferation curves (results are shown in FIGS. 3-6). The results show that after each tumor of the lentivirus infection group is cultured in vitro for 5 days, the proliferation speed is obviously slowed down and is far lower than that of the tumor cells of the control group, the number of the viable cells is respectively reduced by 95.1%, 56.0%, 97.8% and 82.3%, and the EIF5B gene silencing causes the inhibition of the proliferation capacity of the tumor cells.
While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.
Claims (5)
1. Use of a pharmaceutical composition for preventing or treating glioma in the preparation of a tumor treatment medicament for treating glioma, wherein the effective substance of the pharmaceutical composition for preventing or treating glioma is an isolated nucleic acid molecule that reduces expression of eIF5B gene in glioma cells, an eIF5B gene interference nucleic acid construct, and/or an eIF5B gene interference lentivirus; the target sequence of the eIF5B gene aimed by the effective substance is shown as SEQ ID NO:2 is shown in the specification;
wherein the isolated nucleic acid molecule that reduces expression of the eIF5B gene in a glioma cell is selected from the group consisting of:
a) a double-stranded RNA comprising a nucleotide sequence capable of hybridizing to the eIF5B gene under stringent conditions; the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to a target sequence in the eIF5B gene; or
b) An shRNA containing a nucleotide sequence capable of hybridizing to an eIF5B gene under stringent conditions, the shRNA comprising a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment being complementary, and the sequence of the sense strand segment being substantially identical to a target sequence in the eIF5B gene;
the eIF5B gene interfering nucleic acid construct containing a gene segment encoding shRNA in the isolated nucleic acid molecule capable of expressing the shRNA;
the eIF5B gene interference lentivirus is formed by virus packaging of an interference lentivirus vector under the assistance of lentivirus packaging plasmids and cell lines; the interfering lentiviral vector contains a gene segment encoding the shRNA in the isolated nucleic acid molecule and is capable of expressing the shRNA.
2. The use of the pharmaceutical composition for preventing or treating glioma according to claim 1 in the preparation of a tumor therapeutic drug for treating glioma, wherein the double-stranded RNA is a small interfering RNA, and the sequence of the first strand of the small interfering RNA is as shown in SEQ ID NO:86, respectively.
3. The use of the pharmaceutical composition for preventing or treating glioma according to claim 1 in the preparation of a tumor therapeutic drug for treating glioma, wherein the sequence of the shRNA is as set forth in SEQ ID NO:87, respectively.
4. The use of the pharmaceutical composition for preventing or treating glioma of claim 1 wherein the eIF5B gene interfering nucleic acid construct is an interfering lentiviral vector in the preparation of a medicament for the treatment of a glioma tumor.
5. Use of the pharmaceutical composition for preventing or treating glioma according to claim 1 in the preparation of a tumor therapeutic drug for treating glioma, wherein the interfering lentiviral vector is obtained by cloning a gene segment encoding the shRNA into a lentiviral vector selected from the group consisting of: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti 6-GW/U6-laminsham, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti 6.2/N-Lumio/V5-GW/lacZ.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210314148.3A CN103656674B (en) | 2012-08-29 | 2012-08-29 | Application of human eIF5B gene and related medicine thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210314148.3A CN103656674B (en) | 2012-08-29 | 2012-08-29 | Application of human eIF5B gene and related medicine thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103656674A CN103656674A (en) | 2014-03-26 |
| CN103656674B true CN103656674B (en) | 2022-01-04 |
Family
ID=50296228
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210314148.3A Active CN103656674B (en) | 2012-08-29 | 2012-08-29 | Application of human eIF5B gene and related medicine thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103656674B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304327B (en) * | 2020-02-24 | 2024-04-19 | 宋程 | Application of human GRPEL gene and related products |
| CN112812187B (en) * | 2021-01-18 | 2021-12-17 | 南昌大学第一附属医院 | Phosphorylated EIF5B specific antibody and preparation method and application thereof |
| CN114191539B (en) * | 2021-11-19 | 2023-12-01 | 广东工业大学 | Exosome nano particle for compositely co-carrying small molecule nucleic acid and active protein, and preparation method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010141546A1 (en) * | 2009-06-02 | 2010-12-09 | University Of Miami | Diagnostic transcriptomic biomakers in inflammatory cardiomyopathies |
| CN102277434B (en) * | 2011-07-28 | 2015-11-18 | 上海吉凯基因化学技术有限公司 | The purposes of people ZFX gene and related drugs thereof |
-
2012
- 2012-08-29 CN CN201210314148.3A patent/CN103656674B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| "An IAP-IAP Complex Inhibits Apoptosis";Takehiko Dohi et al.;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20040624;第279卷(第33期);第34089页右栏第1段、第34090页左栏图4和右栏第2段 * |
| "IAP-targeted therapies for cancer";EC LaCasse et al.;《Oncogene》;20081231;第27卷;第6265页左栏第2-4段、右栏第2-3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103656674A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN107523569B (en) | Application of PDCD1 gene and related medicaments thereof | |
| CN105586391B (en) | Application of human GTPBP4 gene and related medicine thereof | |
| CN103656674B (en) | Application of human eIF5B gene and related medicine thereof | |
| Wang et al. | PPM1D silencing by lentiviral-mediated RNA interference inhibits proliferation and invasion of human glioma cells | |
| WO2013091293A1 (en) | Medicine which relates to human gene nlk and use thereof | |
| CN103468785B (en) | Application of human SEMA4C gene and related medicine thereof | |
| CN110917357A (en) | Application of human GSDMB gene and related product | |
| CN104894224B (en) | Application of human CKIP1 gene and related medicine thereof | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN105803056B (en) | Application of human IARS2 gene and related medicine thereof | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN105803053B (en) | Application of human RBM17 gene and related medicine thereof | |
| CN110643705A (en) | Application of human DGKZ gene and related medicine thereof | |
| CN106267208B (en) | Application of RPS15A gene and related medicine thereof | |
| CN110684846A (en) | Application of human PTP4A3 gene and related drugs thereof | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN113913423A (en) | Application of human CFAP65 gene and related product | |
| CN105582548B (en) | Application of human UBA2 gene and related medicine thereof | |
| CN105648041B (en) | Application of human KIAA0101 gene and related medicine thereof | |
| CN110882390B (en) | Application of human LSM5 gene and related product | |
| CN105648042B (en) | Application of human YEATS4 gene and related medicine thereof | |
| CN110863047B (en) | Application of human CCDC154 gene and related product | |
| CN105797170B (en) | Application of human RPL34 gene and related medicine thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Applicant after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Applicant before: SHANGHAI GENECHEM Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 201203 Room 101, No. 326 Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Applicant after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: Room 619-21, 680 Guiping Road, Xuhui District, Shanghai 200233 Applicant before: Shanghai Jikai gene Medical Technology Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |