CN102559895A - Application of human Nin one binding (NOB1) gene and related medicine - Google Patents
Application of human Nin one binding (NOB1) gene and related medicine Download PDFInfo
- Publication number
- CN102559895A CN102559895A CN2012100051288A CN201210005128A CN102559895A CN 102559895 A CN102559895 A CN 102559895A CN 2012100051288 A CN2012100051288 A CN 2012100051288A CN 201210005128 A CN201210005128 A CN 201210005128A CN 102559895 A CN102559895 A CN 102559895A
- Authority
- CN
- China
- Prior art keywords
- nob1
- gene
- people
- rna
- plko
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses application of a human Nin one binding (NOB1) gene and related medicines. The invention discloses application of the NOB1 gene to tumor treatment, tumor diagnosis and medicine preparation. The invention further relates to human NOB1 gene small interfering RNA, human NOB1 gene interference nucleic acid establisher and human NOB1 gene interference lentivirus and discloses application thereof. The siRNA may comprise a nucleic acid establisher of the siRNA sequence; the lentivirus can specifically inhibit expression of human NOB1 gene; particularly, the lentivirus can efficiently infect target cells and efficiently inhibit expression of the NOB1 genes in the target cells so as to inhibit growth of tumor cells, promote apoptosis of the tumor cells and achieve important significance in tumor treatment.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to the purposes and the related drugs thereof of people NOB1 gene.
Background technology
RNA disturbs that (RNAinterference RNAi) is sequence-specific PTGS phenomenon by double chain RNA mediate.The RNAi technology has very high post-transcriptional silencing efficient and specificity, and the RNAi technology is applied to focus (the Izquierdo M.Short interfering RNAs as a tool for cancer gene therapy.Cancer Gene Ther.2005 that therapy of tumor is present stage research; 12 (3): 217-27.).General using plasmid or virus vector are handled hairpin structure RNA (the short hairpin RNA of one section 45-50nt; ShRNA) expression in mammalian cell; ShRNA can be formed to siRNA (small interfering RNA automatically in cell; SiRNA), thus cause gene silencing or expression inhibiting.Have that the gene fragment of carrying capacity is big, transfection efficiency is high, nontoxicity, be difficult for bringing out host immune response, can infect somatoblast and terminally differentiated cells and Unseparated Cell, can stablize advantages such as suppressing target gene expression; Field (Angaji SA such as gene therapy, production of vaccine and scientific research have been widely used in; Hedayati SS; Poor RH; Madani S, Poor SS, Panahi S.Application of RNA interference in treating human diseases.J Genet.2010; 89 (4): 527-37.Ketting RF.The many faces of RNAi.Dev Cell.2011; 20 (2): 148-61.).
Zinc finger protein is a protein family maximum in the human body, is the modal structural element of identification nucleic acid.Discover that 1% of Human genome belongs to zinc finger protein gene family.Zinc finger protein can fix on gene promoter region and the expression of regulatory gene all plays an important role through target in histiocytic growth, propagation and differentiation, its unconventionality expression possibly cause numerous disease to comprise generation (the Yajima I of malignant tumour; Kumasaka M, Thang ND, Yanagishita T; Ohgami N; Kallenberg D, Naito Y, Yoshikawa T; Sakashita N, Kato M.Zinc finger protein 28 as a novel melanoma-related molecule.J Dermatol Sci.2009; 55:68-70.Oyanagi H; Takenaka K, Ishikawa S, Kawano Y; Adachi Y; Ueda K, Wada H, Tanaka F.Expression of LUN gene that encodes a novel RING finger protein is correlated with development and progression of non-small cell lung cancer.Lung Cancer.2004; 46:21-28.Witkiewicz-Kucharczyk A, Bal W.Damage of zinc fingers in DNA repair proteins, a novel molecular mechanism in carcinogenesis.Toxicol Lett.2006; 162:29-42.Vendrell JA; Ghayad S; Ben-Larbi S, Dumontet C, Mechti N; Cohen PA.A20/TNFAIP3, a new estrogen-regulated gene that confers tamoxifen resistance in breast cancer cells.Oncogene.2007; 26:4656-4667.).
Zinc ribbon protein (zinc ribbon protein) is that zinc refers to a kind of of proteinoid, is the important component part of general transcription factor in the rna plymerase ii as the structural domain of transcription factor bind nucleic acid, in cell growth, breeding, plays a role; And with the multidrug resistance of white blood disease, mammary cancer, gastrointestinal cancer and relevant (the Hong L of canceration progress; Piao Y, Han Y, Wang J; Zhang X; Du Y, Cao S, Qiao T; Chen Z, Fan D.Zinc ribbon domain-containing 1 (ZNRD1) mediates multidrug resistance of leukemia cells through regulation of P-glycoprotein and Bcl-2.Mol Cancer Ther.2005; 4 (12): 1936-42.Shi Y; Zhang Y, Zhao Y, Hong L; Liu N; Jin X, Pan Y, FanD.Overexpression of ZNRD1 promotes multidrug-resistant phenotype of gastric cancer cells through upregulation of P-glycoprotein.Cancer Biol Ther.2004; 3 (4): 377-81.Wang LH, Yang XY, Zhang X; Mihalic K, Fan YX, Xiao W; Howard OM; Appella E, Maynard AT, Farrar WL.Suppression of breast cancer by chemical modulation of vulnerable zinc fingers in estrogen receptor.Nat Med.2004; 10 (1): 40-7.Hong L, Chen Z, Zhang X; Xia L, Han Z, Lu Y; Jin H, Song J, Qiao T; Fan D.Zinc ribbon domain containing 1 protein:modulator of multidrug resistance, tumorigenesis and cell cycle.Exp Oncol.2006; 28 (4): 258-62.).
NOB1p (Nin one binding protein) is as a kind of zinc ribbon protein, be the earliest utilize the 19S of 26S proteasome to regulate subunit p31 (26S proteasome regulatory subunit p31 Rpn12) finds in yeast through the yeast two-hybrid method; (Tone Y plays a significant role in the forming process of lysosome assembling, maturation and ribosome-RNA(rRNA); TanahashiN, Tanaka K, Fujimuro M; Yokosawa H; Toh-e A.Nob1p, a new essential protein, associates with the 26S proteasome of growing saccharomyces cerevisiae cells.Gene.2000; 243 (1-2): 37-45.).Homologous gene NOB1 and the coded product thereof of Nob1p in the mankind cloned from the cDNA library of people's kidney in 2005.This assignment of genes gene mapping comprises nine exons and eight introns, cDNA total length 174bp in human chromosome 16q22.1.412 aminoacid sequences of NOB1 coding, molecular weight is the rna binding protein of 46675Da, this proteic aminoterminal contains an active PIN of RNase (PilT amino terminus) structural domain, carboxyl terminal contains conservative zinc ribbon protein structural domain; Be used for combining (Zhang Y, Ni J, Zhou G with RNA; Yuan J, Ren W, Shan Y; Tang W; Yu L, Zhao S.Cloning, expression and characterization of the human NOB1 gene.Mol Biol Rep.2005; 32 (3): 185-9.).Through detecting the expression level of NOB1 mRNA in grownup's healthy tissues, find that NOB1 mainly is distributed in tissues such as liver, lung, spleen; The detected result of mammalian cell strain shows that NOB1 albumen is positioned nucleus.The yeast homologous protein of NOB1 is participated in the synthetic of small subunit ribosome and 26S proteasome; Vital role (Fatica A in the proteolyze process that ubiquitin relies on; Oeffinger M;
M, Tollervey D.Nob1p is required for cleavage of the 3 ' end of 18S rRNA.Mol Cell Biol.2003; 23:1798-807.Tone Y., Toh-e A.Nob1p is required for biogenesis of the 26S proteasome and degraded upon its maturation in Saccharomyces cerevisiae.Genes Dev.2002; 16:3142-57.).The degraded of having found at present proto-protein in the nuclears such as c-myc, c-fos, p53 and E1A relies on Ubiquitin-Proteasome Pathway (Ciechanover A; Finley D, Varshavsky A.Ubiquitin dependence of selective protein degradation demonstrated in the mammalian cell cycle mutant ts85.Cell.1984; 37:57-66.Ciechanover A; DiGiuseppe JA; Bercovich B, Orian A, Richter JD; Schwartz AL, Brodeur GM.Degradation of nuclear oncoproteins by the ubiquitin system in vitro.Proc Natl Acad Sci U S is A.1991; 88:139-43.).Therefore infer that NOB1 possibly participate in the degraded of some proto-protein.And the variation of small subunit ribosome and 26S proteasome is relevant with generation, development, transfer and the tumor suppression of tumour.Therefore, NOB1 and tumour have certain relation, be expected to become a novel targets of therapy of tumor.At present existingly discover that the expression of NOB1p in ovarian cancer tissue obviously raise; NOB1siRNA can effectively suppress growth activity, the multiplication capacity of ovarian cancer cell SKOV3 and HEY and block cell fission; The one-tenth knurl ability that significantly suppresses nude mice simultaneously; Prompting NOB1 takes place with ovarian cancer and development relevant (Lin Y, Peng S, Yu H; Teng H, Cui M.RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells.Med Oncol.2011.PMID:21287298.).Yet, do not have NOB1 to regulate the correlative study of other tumor cell proliferations beyond the ovarian cancer at present as yet.
Summary of the invention
The treat-ment and the medicine that the objective of the invention is to open and people NOB1 (Nin one binding protein) gene-correlation.In order to further investigate the regulatory function of NOB1 in tumour takes place; It is model that the present invention chooses people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 cell, is that means research NOB1 is in the survival of above-mentioned tumour cell and the effect in the apoptosis destiny with RNAi.
First aspect present invention, disclose with people NOB1 gene be used for the preparation or the screening anti-tumor medicine, perhaps people NOB1 gene is used to prepare the diagnosing tumor medicine.
People NOB1 gene is used to prepare or screen the content that anti-tumor medicine comprises two aspects: one of which is applied to prepare anti-tumor medicine or preparation as medicine or preparation to the action target of tumour cell with people NOB1 gene; Its two, people NOB1 gene is applied to screen anti-tumor medicine or preparation as medicine or preparation to the action target of tumour cell.
Said people NOB1 gene specifically is meant as medicine or the preparation action target to tumour cell: people NOB1 gene is produced the target of RNA interference effect as medicine or preparation to tumour cell, thereby can reduce tumour cell people NOB1 expression of gene level.
Said people NOB1 gene is applied to screen anti-tumor medicine as medicine or preparation to the action target of tumour cell or preparation specifically is meant: people NOB1 gene is screened medicine or preparation as effective object, to find the medicine that can suppress or promote people NOB1 genetic expression as the oncotherapy drug candidate.As after described people NOB1 gene small molecules interference RNA be that effective object screening obtains promptly with people NOB1 gene, can be used as and have the medicine that suppresses the tumor cell proliferation effect.Such as antibody drug, small-molecule drug etc. also can be with the NOB1 gene as effective object.
Said people NOB1 gene is used to prepare the diagnosing tumor medicine, is meant the preparation that people NOB1 gene expression product is applied to the diagnosing tumor medicine as a diagnosing tumor index.
Any tumour that described tumour is can be for the propagation of its tumour cell relevant with people NOB1 expression of gene, further, be a kind of malignant tumour, for example be selected from: cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and carcinoma of the pancreas.
Said anti-tumor medicine can be small molecules chemistry medicine, and the antibody medicine also can be nucleic acid drug.
Further, thus said anti-tumor medicine can reduce the propagation that people NOB1 expression of gene level suppresses tumour cell.
Adopting the method for aforementioned anti-tumor medicine treatment tumour, mainly is to reach therapeutic purpose through the propagation that reduces people NOB1 expression of gene level inhibition tumour cell.
Concrete, during treatment, the material that can effectively reduce people NOB1 gene expression dose delivers medicine to the patient.
Further, the described material that can effectively reduce people NOB1 gene expression dose, comprise can specificity the small molecules interference RNA (siRNA) of reticent people NOB1 genetic expression.This small molecules interference RNA (siRNA) can play the effect of endogenous NO B1 expression of gene in the reticent tumour cell of specificity.
Further, said small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-20 target sequence as the reticent people NOB1 of specificity genetic expression.
Said small molecules interference RNA is meant with arbitrary sequence of being selected from SEQ ID NO:1-20 target sequence as the reticent people NOB1 of specificity genetic expression: this small molecules interference RNA can combine with the coded mRNA fragments specific of any sequence among the SEQ ID NO:1-20, and specificity silence people NOB1 expression of gene.
Further, said can specificity the small molecules interference RNA (siRNA) of reticent people NOB1 genetic expression express via lentiviral vectors.Particularly; This process comprises: the dna fragmentation of the said people NOB1 gene small molecules interference RNA of will encoding is cloned into lentiviral vectors and obtains people NOB1 gene interference lentiviral vectors; And then utilize this people NOB1 gene to disturb lentiviral vectors to dress up to behind the infectious virion through virus packets, infected tumor's cell and the said siRNA of final expression.
People NOB1 gene disturbs lentiviral vectors for the dna fragmentation of the said people NOB1 gene small molecules interference RNA of will encoding obtains after being cloned into lentiviral vectors, can produce people NOB1 gene small molecules interference RNA.
Further; Described lentiviral vectors can be selected from: it is carrier that any lentiviral vectors among pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ, the embodiment of the invention have specifically been enumerated with pGCSIL-GFP.
Lentiviral vectors can be following assisting of slow virus packaging plasmid, clone, dresses up through virus packets to be infectious virion.
Second aspect present invention discloses a kind of isolating people NOB1 gene small molecules interference RNA (siRNA) target fragment, and its sequence is any sequence among the SEQ ID NO:1-20.
Said isolating people NOB1 gene small molecules interference RNA (siRNA) target fragment can be applicable to the screening and the preparation of people NOB1 gene small molecules interference RNA.
Third aspect present invention discloses a kind of people NOB1 gene small molecules interference RNA (siRNA), can the reticent people NOB1 of specificity expression of gene.
Said people NOB1 gene small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-20 target sequence as the reticent people NOB1 of specificity genetic expression.
Further, said people NOB1 gene small molecules interference RNA comprises just RNA fragment and sense-rna fragment, said just RNA fragment and said sense-rna fragment complementation, and said just RNA fragment contains the RNA of the arbitrary sequence encoding among the SEQ ID NO:1-20.
Said just RNA fragment is present on two different RNA chains with the sense-rna fragment or is present on same the RNA chain.
Said just RNA fragment and the segmental length of sense-rna are 15-27 Nucleotide; Preferable, length is 19-23 Nucleotide; Best, length is 19,20 or 21 Nucleotide.
Further, said people NOB1 gene small molecules interference RNA is the hair clip type single stranded RNA, comprises just RNA fragment, stem ring plate section and sense-rna fragment, is separated by stem ring plate section in the middle of just RNA fragment and the sense-rna fragment; Wherein, just RNA fragment and sense-rna fragment complementation, just RNA fragments sequence is selected from the arbitrary of SEQ ID NO:1-20.
Said stem ring plate segment structure comprises 6 or 9 bases.Further said stem ring fragments sequence is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.It is the stem ring that the present invention has specifically enumerated with UUCAAGAGA.
Enumerate like embodiment, the sequence of said people NOB1 gene small molecules interference RNA is SEQ ID NO:21:CCUGGAGCCAAUCUUCAAGAAUUCAAGAGAUUCUUGAAGAUUGGCUCCAG G.
Fourth aspect present invention discloses a kind of people NOB1 gene RNA construct, comprises the gene fragment of the aforementioned people NOB1 gene small molecules interference RNA of encoding, and can express aforementioned people NOB1 gene small molecules interference RNA.
Described people NOB1 gene RNA construct can be the gene fragment clone of the aforementioned people NOB1 gene small molecules interference RNA of coding to be gone into known carrier obtain.
Further; Said people NOB1 gene RNA construct behaviour NOB1 gene disturbs lentiviral vectors; For the gene fragment clone of the said people NOB1 gene small molecules interference RNA of will encoding obtains after going into lentiviral vectors, can produce people NOB1 gene small molecules interference RNA.
Said lentiviral vectors can be selected from: pLKO.1-puro; PLKO.1-CMV-tGFP; PLKO.1-puro-CMV-tGFP; PLKO.1-CMV-Neo; PLKO.1-Neo; PLKO.1-Neo-CMV-tGFP; PLKO.1-puro-CMV-TagCFP; PLKO.1-puro-CMV-TagYFP; PLKO.1-puro-CMV-TagRFP; PLKO.1-puro-CMV-TagFP635; PLKO.1-puro-UbC-TurboGFP; PLKO.1-puro-UbC-TagFP635; PLKO-puro-IPTG-1xLacO; PLKO-puro-IPTG-3xLacO; PLP1; PLP2; PLP/VSV-G; PENTR/U6; PLenti6/BLOCK-iT-DEST; PLenti6-GW/U6-laminshrna; PcDNA1.2/V5-GW/lacZ; PLenti6.2/N-Lumio/V5-DEST; Arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people NOB1 gene RNA construct of vector construction with pGCSIL-GFP that the embodiment of the invention has specifically been enumerated, called after pGCSIL-GFP-siNOB1.
Further, the encode sequence of gene fragment of said people NOB1 gene small molecules interference RNA contains arbitrary sequence and complementary sequence thereof among the SEQ ID NO:1-20.
People NOB1 gene small molecules interference RNA of the present invention can be used for suppressing the propagation of tumour cell, further can be as the medicine or the preparation of treatment or diagnosing tumour.People NOB1 gene RNA construct then can be used for preparing said people NOB1 gene small molecules interference RNA.
When as medicine or the preparation of treatment tumour, be that the people NOB1 gene small molecules interference RNA with safe and effective amount is applied to Mammals.Certainly, concrete dosage is factor such as considered route of administration, patient health situation also, and these all are within the skilled practitioners skill.
Fifth aspect present invention discloses a kind of people NOB1 gene and has disturbed slow virus, disturbs lentiviral vectors down auxiliary in slow virus packaging plasmid, clone by aforementioned people NOB1 gene, forms through the virus packing.But this slow virus infected tumor cell also produces people NOB1 gene small molecules interference RNA, thereby suppresses the propagation of cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and pancreatic tumour cell.
Sixth aspect present invention also discloses a kind of pharmaceutical composition, contains the people NOB1 gene small molecules interference RNA or the people NOB1 gene of treating significant quantity and disturbs slow virus.
Further, said pharmaceutical composition contains the foregoing people NOB1 of 1～99wt% gene small molecules interference RNA or people NOB1 gene disturbs slow virus, and pharmaceutically acceptable carrier, thinner or vehicle.
In preparation during these compsns, usually with activeconstituents and mixed with excipients, or with the vehicle dilution, wrap in can capsule or the carrier that exists of anther sac form in.Do the time spent when vehicle plays thinner, it can be solid, semisolid or the fluent material medium as vehicle, carrier or activeconstituents.Therefore, compsn can be tablet, pill, pulvis, solution, syrup, sterilizing injecting solution etc.The example of suitable vehicle comprises: lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, Microcrystalline Cellulose, Vinylpyrrolidone polymer, Mierocrystalline cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, sanitas (like methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In sum; The present invention has designed 20 RNAi target sequences to people NOB1 gene; Make up corresponding N OB1RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-siNOB1 of encoding sequence SEQ ID NO:20 can significantly reduce the expression of NOB1 gene at mRNA level and protein level.Use slow virus (lentivirus; Be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-siNOB1 as the genetic manipulation instrument and can will efficiently import people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell, colorectal carcinoma RKO cell, lung carcinoma cell H1299 and carcinoma of the pancreas Panc-1 cell to the RNAi sequence of NOB1 gene in target ground; Reduce NOB1 expression of gene level, significantly suppress the multiplication capacity of above-mentioned tumour cell.Therefore the NOB1 gene silencing of slow virus mediation is the clinical non-operative treatment mode of malignant tumour potential.
Nucleic acid construct, slow virus that siRNA provided by the invention perhaps comprises this siRNA sequence can specificity suppress people NOB1 expression of gene; Especially slow virus; Can efficiently infect target cell; Suppress NOB1 expression of gene in the target cell expeditiously; And then the growth of inhibition cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and pancreatic tumour cell, promote cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and pancreatic tumour apoptosis, significant in cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and pancreatic tumour treatment.
Description of drawings
Fig. 1 representes pGCSIL-GFP DNA collection of illustrative plates
Fig. 2 representes that the siNOB1-Lentivirus slow virus infects people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 cell after 5 days, and the expression level of NOB1 mRNA significantly reduces.
Fig. 3 representes that the siNOB1-Lentivirus slow virus infects people's cancer of the stomach SGC-7901 cell after 5 days, significantly suppresses cell proliferation.
Fig. 4 representes that the siNOB1-Lentivirus slow virus infects people's liver cancer SMMC-7721 cell after 5 days, significantly suppresses cell proliferation.
Fig. 5 representes that the siNOB1-Lentivirus slow virus infects human colon carcinoma RKO cell after 5 days, significantly suppresses cell proliferation.
Fig. 6 representes that the siNOB1-Lentivirus slow virus infects people's lung cancer H1299 cell after 5 days, significantly suppresses cell proliferation.
Fig. 7 representes that the siNOB1-Lentivirus slow virus infects human pancreas cancer Panc-1 cell after 5 days, significantly suppresses cell proliferation.
Fig. 8 uses the immunohistochemical methods detected result of nob1 antibody on different tumor tissues tissue samples
A, b are carcinoma of the pancreas, and c is a lung cancer, and d is a colorectal carcinoma, and e, f are cancer of the stomach
Embodiment
The present invention is based on zinc ribbon protein maybe with the relevant researchs such as propagation, resistance and transfer of tumour cell, think that NOB1 possibly participate in the generation and the development of other malignant tumours except that ovarian cancer as a kind of zinc ribbon protein.
The present invention relates to one group of small molecules interference RNA (siRNA) sequence, rna interference vector and RNA and disturbed slow virus to people NOB1 gene.Choose the target site of people NOB1 mRNA coding region sequence, according to the individual base sequence design of successive 10-30 in the target site (preferred 15-27, more preferably 19-23) siRNA target sequence as siRNA.Through gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the reticent human tumor cells of specificity in endogenous NO B1 expression of gene.
The contriver finds, adopts the propagation that can suppress tumour cell under the RNAi method after the mediator NOB1 expression of gene effectively, and this achievement in research shows that the NOB1 gene is a proto-oncogene, can be used as the target spot of oncotherapy.The contriver is further synthetic and tested multiple siRNA to the NOB1 gene; Filter out the expression that can effectively suppress NOB1 and then suppressed the siRNA of people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell and colorectal carcinoma RKO cell proliferation and growth, accomplished the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of interference people NOB1 genes, but made up the slow virus of the reticent NOB1 genetic expression of specificity.The present invention discovers, to the siRNA and the RNAi slow virus of people NOB1 gene design, stablizes also and reduces the NOB1 expression of gene specifically, and suppress the propagation of human tumor cells effectively.The present invention shows that the NOB1 gene can promote growth of tumour cell, is expected to become the target spot of early diagnosis of tumor and treatment.And, through the reticent NOB1 expression of gene of RNAi mode, can be used as the effective means that suppresses tumor development.
Mentality of designing of the present invention is:
The present invention screens through following method and obtains a kind of people NOB1 gene RNAi slow virus: from Genbank, transfer people NOB1 gene order; Prediction siRNA site; Synthetic effective siRNA sequence to the NOB1 gene, two ends contain the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected the RNAi plasmid of construction expression NOB1 gene siRNA sequence behind the lentiviral vectors double digestion with double-stranded DNA Oligo; With assistant carrier (Packing Mix, Sigma-aldrich company) the cotransfection HEKC 293T of RNAi plasmid and slow virus packing needs, the recombinant RNA i slow virus particle of packaging expression NOB1 gene.Slow virus particle in the collecting cell culture supernatant, purifying concentrates, and promptly makes slow virus (siNOB1-Lentivirus) pure, stably express NOB1 siRNA.
Based on aforesaid method, the invention provides 20 effective target spots (specifically shown in SEQ ID NO 1-20) that disturb the NOB1 gene, made up the slow virus of special interference people NOB1 gene.
The present invention simultaneously also discloses a kind of people NOB1 gene RNAi slow virus (NOB1-RNAi) and preparation thereof and uses.
Originally discover, utilize the RNAi method of slow virus mediation, after reducing the expression of NOB1 gene in tumour cell, can effectively suppress the propagation of tumour cell.This research shows; The NOB1 gene is a proto-oncogene, can promote tumor cell proliferation, in tumour takes place and develops, has important biological function; The NOB1 gene can be the target of oncotherapy, and the NOB1 gene specific silence of slow virus mediation can be used as a kind of new tool of oncotherapy.
Further set forth the present invention below in conjunction with embodiment.Should be understood that embodiment only is used to explain the present invention, and unrestricted scope of the present invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared prescription is according to normal condition among the embodiment, like works such as [U.S.A] Sambrook.J; Huang Peitang etc. translate.The molecular cloning test guide, the third edition.Beijing: the condition of the condition described in the Science Press 2002 or manufacturers's suggestion is carried out or is disposed.
Embodiment 1: to the preparation of people NOB1 gene RNAi slow virus
1. screening is to the effective siRNA target spot of people NOB1 gene
From Genbank, choose the coding region sequence of people NOB1 (NM_014062) gene, every sequence at a distance from 20 bases of an initial acquisition of base; Utilizing the design software of Shanghai JiKai Gene Chemical Technology Co., Ltd, is template with people NOB1 mRNA sequence, confirms 20 effective siRNA target sequences (SEQ ID NO:1-20), as shown in table 1:
Table 1 target is in the siRNA target sequence of people NOB1 gene
The double-stranded DNA Oligo sequence (table 2) that contains Age I and EcoR I restriction enzyme site cohesive end to the synthetic two ends of siRNA target spot (is example with SEQ ID NO:20); (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, and Fig. 1), makes its linearizing (reaction system is as shown in table 4,37 ℃, reacts 1h), and agarose gel electrophoresis is identified endonuclease bamhi to act on the pGCSIL-GFP carrier with Age I and EcoR I restriction enzyme.
Table 2 two ends contain the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
(it is as shown in table 4 that enzyme is cut system with the double digestion linearizing through the T4DNA ligase enzyme; 37 ℃; Reaction 1h) carrier DNA is connected with the good double-stranded DNA Oligo of purifying, in suitable buffer system (linked system is as shown in table 5), spends the night in 16 ℃ of connections, reclaims to connect product.With connecting fresh competent escherichia coli cell (the conversion operation reference: molecular cloning experiment guide second edition 55-56 page or leaf) that product transforms the calcium chloride preparation.Grow bacterium clone surface at the connection converted product and be stained with, be dissolved in 10 μ l LB substratum, mixing is got 1 μ l as template; The upstream and downstream of RNAi sequence in lentiviral vectors, design universal PC R primer upstream primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:22); Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:23) carries out PCR identification experiment (the PCR reaction system is like table 6-1, and reaction conditions is like table 6-2).PCR is identified that the male clone checks order and compare of analysis, be the RNAi carrier that contains SEQ ID NO:20 that makes up successfully, called after pGCSIL-GFP-siNOB1 than the clone of correct.
Make up pGCSIL-GFP-control negative control plasmid, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO:24).When making up pGCSIL-GFP-control negative control plasmid; Synthesize the double-stranded DNA Oligo sequence (table 3) that two ends contain Age I and EcoR I restriction enzyme site cohesive end, all same pGCSIL-GFP-siNOB1 of all the other construction processs, authentication method and condition to Scr (scramble) siRNA target spot.
Table 3 two ends contain the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
Through the carrier of T4 dna ligase with double digestion linearizing (it is as shown in table 4 that enzyme is cut system, 37 ℃, reacts 1h)
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmid (1 μ g/ μ l) | ?2.0 |
| 10×buffer | ?5.0 |
| 100×BSA | ?0.5 |
| Age?I(10U/μl) | ?1.0 |
| EcoR?I(10U/μl) | ?1.0 |
| ddH 2O | ?40.5 |
| Total | ?50.0 |
Table 5 carrier DNA and double-stranded double-stranded DNA Oligo ligation system
| Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connection group (μ l) |
| Linearizing carrier DNA (100ng/ μ l) | ?1.0 | ?1.0 | ?1.0 |
| Annealed double-stranded DNA Oligo (100ng/ μ l) | ?1.0 | ?- | ?1.0 |
| 10 * T4 phage DNA ligase enzyme damping fluid | ?1.0 | ?1.0 | ?1.0 |
| T4 phage DNA ligase enzyme | ?1.0 | ?1.0 | ?1.0 |
| ddH 2O | ?16.0 | ?17.0 | ?16.0 |
| Total | ?20.0 | ?20.0 | ?20.0 |
Table 6-1PCR reaction system
| Reagent | Volume (μ l) |
| 10×buffer | ?2.0 |
| dNTPs(2.5mM) | ?0.8 |
| Upstream primer | ?0.4 |
| Downstream primer | ?0.4 |
| The Taq polysaccharase | ?0.2 |
| Template | 1.0 |
| ddH 2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program setting
2. pack the siNOB1-Lentivirus slow virus
Extract the DNA of RNAi plasmid pGCSIL-GFP-siNOB1 with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.24h before the transfection with the HEKC 293T cell of tryptic digestion logarithmic phase, is 1.5 * 10 with the DMEM perfect medium adjustment cell density that contains 10% foetal calf serum
5Cell/ml is inoculated in 6 orifice plates, and 37 ℃, 5%CO
2Cultivate in the incubator.Treat to can be used for when cell density reaches 70%-80% transfection.2h before the transfection, the original substratum of sucking-off adds the fresh perfect medium of 1.5ml.Explanation according to the MISSION Lentiviral PackagingMix test kit of Sigma-aldrich company; In a sterilization centrifuge tube, add Packing Mix (PVM) 20 μ l; PEI 12 μ l; Serum-free DMEM substratum 400 μ l get the above-mentioned extractive DNA of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed solution.Above-mentioned transfection miscellany is at room temperature hatched 15min, be transferred in the substratum of HEKC 293T cell, 37 ℃, 5%CO
2Cultivate 16h in the incubator.Discard the developing medium that contains the transfection miscellany, the PBS solution washing adds perfect medium 2ml, continues to cultivate 48h.The collecting cell supernatant, Centricon Plus-20 centrifugal ultrafiltration device (Millipore) purifying and concentrated slow virus, step is following: (1) 4 ℃, the centrifugal 10min of 4000g removes cell debris; (2) 0.45 μ m filter filtering supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, and 10-15min is to the concentrated volume of the virus that needs; (4) after the centrifugal end, filtering cup and following filtered solution collection cups are separated, filtering cup is tipped upside down on the sample collection cup, centrifugal 2min cf-is no more than 1000g; (5) remove Centrifuge Cup from the sample collection cup, be viral liquid concentrator in the sample collection cup.With after the viral liquid concentrator packing in-80 degrees centigrade of preservations.The siRNA sequence that contains in the virus liquid concentrator is SEQ ID NO:21.The wrapping process of contrast slow virus control only replaces the pGCSIL-GFP-siNOB1 carrier with the pGCSIL-GFP-control carrier with the siNOB1-Lentivirus slow virus.
Embodiment 2: the real-time fluorescence quantitative RT-PCR method detects the reticent efficient of NOB1 gene
The people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell and colorectal carcinoma RKO cell, lung cancer H1299 cell and the carcinoma of the pancreas Panc-1 that are in logarithmic phase carry out trysinization, and (cell count is about 5 * 10 to process cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach about 30%.(the MOI value of SGC-7901 and SMMC-7721 is 20 according to infection multiplicity; The MOI value of H1299 cell, Panc-1 and RKO cell is 10) value, the virus of embodiment 1 preparation of adding sufficient quantity is changed substratum behind the cultivation 24h; After treating that time of infection reaches 5 days, collecting cell.According to the Trizol process specifications of Invitrogen company, extracted total RNA.According to the M-MLV process specifications of Promega company, the RNA rt is obtained cDNA (the reverse transcription reaction system is seen table 7, and 42 ℃ are reacted 1h, and water-bath 10min makes the reversed transcriptive enzyme inactivation in 70 ℃ of water-baths then).
Adopting TP800 type Real time PCR appearance (TAKARA) to carry out real-time quantitative detects.The primer of NOB1 gene is following: upstream primer 5 '-ATCTGCCCTACAAGCCTAAAC-3 ' (SEQ ID NO:25) and downstream primer 5 '-TCCTCCTCCTCCTCCTCAC-3 ' (SEQ ID NO:26).With house-keeping gene GAPDH is confidential reference items, and primer sequence is following: upstream primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:27) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:28).Press the proportional arrangement reaction system in the table 8.
Table 7 reverse transcription reaction system
| Reagent | Volume (μ l) |
| 5×RT?buffer | ?4.0 |
| 10mM?dNTPs | ?2.0 |
| RNasin | ?0.5 |
| M-MLV-RTase | ?1.0 |
| DEPC?H 2O | ?3.5 |
| Total | ?11.0 |
Table 8Real-time PCR reaction system
| Reagent | Volume (μ l) |
| SYBR?premix?ex?taq： | ?10.0 |
| Upstream primer (2.5 μ M): | ?0.5 |
| Downstream primer (2.5 μ M): | ?0.5 |
| cDNA | ?1.0 |
| ddH 2O | ?8.0 |
| Total | ?20.0 |
Setting program is two-step approach Real-time PCR: sex change is 95 ℃ in advance, 15s; 95 ℃ of each step sex change afterwards, 5s; Annealing is extended 60 ℃, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR finished, 95 ℃ of sex change 1min were cooled to 55 ℃ then, and the dna double chain is fully combined.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2-
Δ Δ CtAnalytical method is calculated the expression abundance that has infected NOB1 mRNA.Compare with the cell that infects contrast virus (control); The result is as shown in Figure 2, the NOB 1mRNA expression level of people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell, colorectal carcinoma RKO cell, lung cancer H1299 cell and carcinoma of the pancreas Panc-1 91.2%, 67.6%, 60.0%, 92.5% and 96.6% (as shown in Figure 2) that descended respectively in the experimental group.
Embodiment 3: the multiplication capacity that detects the tumour cell that infects the siNOB1-Lentivirus slow virus
The people's cancer of the stomach SGC-7901 cell, liver cancer SMMC-7721 cell, colorectal carcinoma RKO cell lung cancer H1299 cell and the carcinoma of the pancreas Panc-1 that are in logarithmic phase carry out trysinization, and (cell count is about 5 * 10 to process cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach about 30%.(the MOI value of SGC-7901 and SMMC-7721 is 20 according to infection multiplicity; The MOI value of H1299 cell, Panc-1 and RKO cell is 10); The siNOB1-Lentivirus virus that adds sufficient quantity; Change substratum after cultivating 24h, treat that time of infection reaches 5 days after, collect each the experimental group cell that is in logarithmic phase.The resuspended one-tenth cell suspension (2 * 10 of perfect medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Every group 5 multiple holes, every hole 100 μ l.After completing plate, put 37 ℃, 5%CO
2Incubator is cultivated.Beginning in second day behind the bed board, read plate once with Cellomics instrument (Thermo Fisher) detection every day, and continuous detecting was read plate 5 days.Through the input parameter of adjustment Cellomics arrayscan, calculate the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, data are carried out Statistic Plotting, draw cell proliferation curve (result such as Fig. 3-shown in Figure 7).The result shows; The siNOB1-Lentivirus slow virus is infected each tumour of group after cells in vitro is cultivated 5 days; Rate of propagation significantly slows down; Far below the rate of propagation of control group tumour cell, the vigor cell number has descended 75.5%, 80.5%, 98.3%, 81.3% and 60.4% respectively, shows that the NOB1 gene silencing causes the tumor cell proliferation ability to be suppressed.
The test of NOB1 gene overexpression in embodiment 4 tumour cells
Tissue samples: human pancreas cancer, lung cancer, colorectal carcinoma and stomach organization sample
NOB1 antibody: available from Sigma company
TP:
Take out organization chip, organization chip was toasted 30 minutes in 60 ℃ of thermostat containers.To the organization chip dewaxing, dewaxing process is then: YLENE 15 minutes, and YLENE: ethanol=mix in liquid at 1: 1, in the absolute ethyl alcohol, in 95% ethanol, in 85% ethanol, in 75% ethanol, soaked in the zero(ppm) water 10 minutes successively; Then with zero(ppm) water or the fresh 3%H of PBS configuration
2O
2, room temperature sealing 10 minutes; Antigen retrieval is put into organization chip to boiling in high fire heating 0.01M sodium citrate buffer (pH6.0) in the microwave oven, and low fire was kept 20 minutes; After naturally cooling to room temperature, insert in the zero(ppm) water and soaked 10 minutes; 10% serum (TBS preparation) sealing 30 minutes; Serum is abandoned in suction, does not wash to add NOB1 antibody (dilution in 1: 100) incubated overnight; TBS washes 2 times, each 5 minutes; The goat-anti rabbit two that adds the HRP mark is anti-, incubated at room 60 minutes; TBS washes 4 times, each 5 minutes; Add DAB dyeing, up to show light yellow till, put into the zero(ppm) water termination reaction; Soaked 30 seconds clear water rinsing 7-8 time with bush; The dehydration mounting, in 75% ethanol, 85% ethanol, 95% ethanol, absolute ethyl alcohol, YLENE: ethanol=mix liquid at 1: 1, in the YLENE, soak successively and put 5 minutes; After the taking-up, drip the 30ul neutral gum, use the deckglass mounting, dry, observations is taken pictures, and the result is as shown in Figure 8.
The result shows:
Use NOB1 antibody that carcinoma of the pancreas, lung cancer, colorectal carcinoma and stomach organization are carried out the immunohistochemical methods detection of expression, the result finds, in the different tissues sample, all can find the high expression level of NOB1 gene coded protein.The representative of figure Oxford gray is expressed positive.Based on this experimental result, think and to come the auxiliary diagnosis cancer through detecting histocyte NOB1 expression of gene.
Claims (14)
1. people NOB1 gene is in the anti-tumor medicine of preparation or screening cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and carcinoma of the pancreas, the perhaps purposes in arbitrary diagnosing tumor medicine of preparation cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and carcinoma of the pancreas.
2. isolating people NOB1 gene small molecules interference RNA target fragment, its sequence is any sequence among the SEQ ID NO:1-20.
3. people NOB1 gene small molecules interference RNA; Can specificity reticent people NOB1 expression of gene, said people NOB1 gene small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-20 target sequence as the reticent people NOB1 of specificity genetic expression.
4. like the said people NOB1 of claim 3 gene small molecules interference RNA; It is characterized in that; Said people NOB1 gene small molecules interference RNA comprises just RNA fragment and sense-rna fragment; Said just RNA fragment and said sense-rna fragment complementation, said just RNA fragment contains the RNA of the arbitrary sequence encoding among the SEQ ID NO:1-20.
5. like the said people NOB1 of claim 4 gene small molecules interference RNA, it is characterized in that said just RNA fragment and the segmental length of sense-rna are 15-27 Nucleotide.
6. like the said people NOB1 of claim 5 gene small molecules interference RNA, it is characterized in that said people NOB1 gene small molecules interference RNA is the hair clip type single stranded RNA, separate by stem ring plate section in the middle of said just RNA fragment and the said sense-rna fragment.
7. like the said people NOB1 of claim 6 gene small molecules interference RNA, it is characterized in that said stem ring fragments sequence is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.
8. like the said people NOB1 of claim 3 gene small molecules interference RNA, it is characterized in that the sequence of said people NOB1 gene small molecules interference RNA is SEQ ID NO:21.
9. people NOB1 gene RNA construct comprises the gene fragment of the said people NOB1 of the coding arbitrary claim of claim 3-8 gene small molecules interference RNA, can expressing human NOB1 gene small molecules interference RNA.
10. like the said people NOB1 of claim 9 gene RNA construct, it is characterized in that said people NOB1 gene RNA construct behaviour NOB1 gene disturbs lentiviral vectors.
11. like the said people NOB1 of claim 10 gene RNA construct; It is characterized in that said lentiviral vectors is selected from: arbitrary among pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
12. a people NOB1 gene disturbs slow virus, disturbs lentiviral vectors down auxiliary in slow virus packaging plasmid, clone by the said people NOB1 of the arbitrary claim of claim 9-11 gene, forms through the virus packing.
13. pharmaceutical composition; Contain the arbitrary claim of the claim 3-8 that treats significant quantity said people NOB1 gene small molecules interference RNA or the said people NOB1 of claim 12 gene and disturb slow virus, and pharmaceutically acceptable carrier, thinner or vehicle.
14., it is characterized in that said pharmaceutical composition is used to treat arbitrary tumour of cancer of the stomach, liver cancer, colorectal carcinoma, lung cancer and carcinoma of the pancreas like the said pharmaceutical composition of claim 13.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210005128.8A CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110425830.5 | 2011-12-19 | ||
| CN201110425830 | 2011-12-19 | ||
| CN201210005128.8A CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102559895A true CN102559895A (en) | 2012-07-11 |
| CN102559895B CN102559895B (en) | 2016-01-06 |
Family
ID=46406495
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210005128.8A Active CN102559895B (en) | 2011-12-19 | 2012-01-10 | The purposes of people NOB1 gene and related drugs thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559895B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803053A (en) * | 2014-12-31 | 2016-07-27 | 上海吉凯基因科技有限公司 | Uses and related drugs of human RBM17 gene |
| CN107988230A (en) * | 2018-01-17 | 2018-05-04 | 南通大学附属医院 | Suppress the siRNA molecule of NOB1 genes |
| CN108192895A (en) * | 2018-01-17 | 2018-06-22 | 南通大学附属医院 | Target siRNA molecule and its application of NOB1 genes |
-
2012
- 2012-01-10 CN CN201210005128.8A patent/CN102559895B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 林杨: ""应用RNA干扰沉默NOB1基因对卵巢癌HEY细胞增殖和周期的影响"", 《中国妇幼保健》 * |
| 董波: ""NOB1基因与肿瘤"", 《第二军医大学学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803053A (en) * | 2014-12-31 | 2016-07-27 | 上海吉凯基因科技有限公司 | Uses and related drugs of human RBM17 gene |
| CN105803053B (en) * | 2014-12-31 | 2021-03-16 | 上海吉凯基因科技有限公司 | Application of human RBM17 gene and related medicine thereof |
| CN107988230A (en) * | 2018-01-17 | 2018-05-04 | 南通大学附属医院 | Suppress the siRNA molecule of NOB1 genes |
| CN108192895A (en) * | 2018-01-17 | 2018-06-22 | 南通大学附属医院 | Target siRNA molecule and its application of NOB1 genes |
| CN108192895B (en) * | 2018-01-17 | 2024-02-06 | 南通大学附属医院 | siRNA molecule targeting NOB1 gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102559895B (en) | 2016-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN103421886A (en) | Applications of CIZI gene and relevant medicines | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN104894223A (en) | Use and related drugs of human COPB2 gene | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN110917357B (en) | Application of human GSDMB gene and related product | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
| CN103421887B (en) | The purposes and its related drugs of CIT gene | |
| CN103301474A (en) | Usage and related drugs of human RNF40 gene | |
| CN103157114A (en) | Purposes and related medicines of human ZNF786 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |