CN103301474A - Usage and related drugs of human RNF40 gene - Google Patents
Usage and related drugs of human RNF40 gene Download PDFInfo
- Publication number
- CN103301474A CN103301474A CN2012100668983A CN201210066898A CN103301474A CN 103301474 A CN103301474 A CN 103301474A CN 2012100668983 A CN2012100668983 A CN 2012100668983A CN 201210066898 A CN201210066898 A CN 201210066898A CN 103301474 A CN103301474 A CN 103301474A
- Authority
- CN
- China
- Prior art keywords
- rnf40
- gene
- people
- sequence
- plko
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses usage and related drugs of human RNF40 gene and specifically discloses usage of human RNF40 gene in tumor treatment and drug preparation. The invention further provides an oligonucleotide molecule separated from the human RNF40 gene, a human RNF40 gene interference lentivirus carrier, human RNF40 gene interference lentivirus and usage thereof. The oligonucleotide molecule or the lentivirus carrier containing the oligonucleotide molecule sequence and lentivirus provided by the invention can specifically inhibit the expression of the human RNF40 gene, and particularly the lentivirus can efficiently infect target cells and effectively inhibit the expression of RNF40 gene in the target cells so as to inhibit the growth of tumor cells and promote the apoptosis of the tumor cells, thereby having important significance in tumor therapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people RNF40 gene.
Background technology
RNA disturbs that (RNAinterference RNAi) is sequence-specific PTGS phenomenon by double chain RNA mediate.The RNAi technology has very high post-transcriptional silencing efficient and specificity, and the RNAi technology is applied to focus (the Izquierdo M.Short interfering RNAs a tool for cancer gene therapy.Cancer Gene Ther.2005 that therapy of tumor is present stage research; 12 (3): 217-27.).General using plasmid or viral vector are handled hairpin structure RNA (the short hairpin RNA of one section 45-50nt; shRNA) expression in mammalian cell; shRNA can be formed to siRNA (small interfering RNA automatically in cell; siRNA), thus cause gene silencing or expression inhibiting.Have that the genetic fragment of carrying capacity is big, transfection efficiency is high, avirulence, be difficult for bringing out host immune response, can infect somatoblast and terminally differentiated cells and Unseparated Cell, can stablize advantages such as suppressing target gene expression, field (Angaji SA such as gene therapy, production of vaccine and scientific research have been widely used in, Hedayati SS, Poor RH, Madani S, Poor SS, Panahi S.Application of RNA interference in treating human diseases.J Genet.2010; 89 (4): 527-37.KettingRF.The many faces ofRNAi.Dev Cell.2011; 20 (2): 148-61.).
Ring finger protein is the zinc finger protein that a class contains the ring structure territory, the ring structure territory is an a kind of zinc fingers of being made up of 40-60 aminoacid, it can be in conjunction with two zinc atom (Saurin AJ, Borden KL, BoddyMN, et al.Does this have a familiar RNG.Trends Biochem Sci 1996,21:208-214.Freemont PS The RNG finger Anovel protein sequence motif related to the zinc finger.Ann N Y Acad Sci, 1993,684:174-192.Borden KL, Freemont PS.The RNG finger domain:a recent example of a sequence-structure family.Curr Opin Struct Biol, 1996,6:395-401).This domain may participate in the interaction between albumen and the albumen, and it usually participates in the albumen of intracellular false folding and has finished the degradation process of the albumen of its mission.This process is important quality control process in the cell, extremely important for keeping of cell homeostasis, its unconventionality expression may cause generation (the Hatakeyama S of numerous disease even malignant tumor, Nakayama KI.Ubiquitylation as a quality control system for intracellular proteins.J Biochem, 2003,134:1-8.Borden KL, Freemont PS.The RNG finger domain:a recent example of a sequence-structure family.Curr Opin Struct Biol, 1996,6:395-401.Joaquin ME.Histone H2B ubiquitination:the cancer connection.Prenzel T, Begus-Nasrman Y, Kramer F et al.Estrogen-Dependent Gene Transcription in Human Breast Cancer Cells Relies upon Proteasome-Dependent Monoubiquitination of Histone H2B.Cancer Res2011,71 (17): 5739-5753)
The important function of ring finger protein is the extensive effect that participates in albumen, it can be transferred to ubiquitin on the zymolyte, pass through the effect degraded substrate of protease then, it regulate specificity that ubiquitin is connected with substrate rise central role (Ulrich H D.Natural substrates of the proteasome and their recognition by the ubiquitin system[J] .Curr Top Microbiol Immunol, 2002,268 (1): 137-174).The ring finger protein family member participates in the regulation and control of various cells widely, growth, carcinogenic mechanism, apoptosis and virus replication etc. as tissue, up to now, have above hundreds of ring finger proteins and be found, be distributed in widely in the plant and animal body (Borden KL.Ring domains:master builders of molecular scaffolds J Mol Biol 2000,295:1103-1112).
RNF40 (ring finger protein 40) is as a kind of ring finger protein, formed by 838 amino acid residues, the molecular weight size is 94.8KD, RNF40 is positioned human chromosome 16p11.2 position (Wen H, Ao S.RBP95, a novel leucine zipper protein, binds to the retinoblastoma protein.Biochem Biophys Res Commun 2000,275 (1): 141-148.Ishikawak K, Negase T, Suyama M, Miyajima N, Kotani H, Nomura N, Ohara O.Prediction of the coding sequences of unidentified human genes.X.The complete sequences of100new cDNA clones from brain which can code for large proteins in vitro " .DNA Res 1998; 5 (3): 169-176..Chin LS; Vavalle JP; Li L. " Staring, a novel E3 ubiquitin-protein ligase that targets syntaxin 1 for degradation " .J Biol Chem 2002,277 (38): 35071-9).By detecting the expression of RNF40mRNA in people's normal structure, find that RNF40 extensively distributes in tissue.The testing result of mammalian cell strain shows that RNF40 albumen is positioned nucleus (Wen H, Ao S.RBP95, a novel leucine zipper protein, binds to the retinoblastoma protein.Biochem Biophys Res Commun 2000,275 (1): 141-148).In the rat gene group, RNF40 gene and yeast ubiquitin ligase BRE1 have homology (JenniferAD, SophiaB C, Jmartin B.The role of BRE1 homologs in mammalian histone modification and response to DNA damage.Proc Amer Cancer Res 2006,47:111-119).RNF40 and RNF20, drive histone H2B ubiquitinization and histone H 3 and methylate as a kind of E3 ubiquitin ligase with dimeric form.RNF40 (the Shiloh Y that in the Proteolytic enzyme process that ubiquitin relies on, plays an important role, Shema E, Moyal L, et al.RNF20-RNF40:Aubiquitin-driven link between gene expression and DNA damage response.FEBS Lett 2011).Studies show that in a large number, the generation of ubiquitin ligase and tumor, development, shift closely related (Bromberg KD, Kluger HM, Delaunay A.Increased expression of the E3 ubiquitin ligase RNF5 is associated with decreased survival in breast cancer.Cancer Res 2007,67 (17): 8172-8179.Chen C, Sun X, Guo P.Ubiquitin E3 ligase WWP1 as an oncogenic factor in human prostate cancer.Oncogene, 2007,26 (16): 2386-2394.Tsai YC, Mendoza A, Mariano JM.The ubiquitin ligase gp78 promotes sarcoma metastasis by targeting KAI1 for degradation.Nat Med 2007,13 (12): 1504-1509).Have at present and discover that RNF40 gene and human breast cancer have close contact.The genetic transcription that the RNF40 clpp gene decapacitation downward modulation Era (estrgen receptor-α) that mediated rnai is led induces, and Era is an index (the Prenzel T that determines the breast carcinoma phenotype, Begus-Nasrman Y, Kramer F et al.Estrogen-Dependent Gene Transcription in Human Breast Cancer Cells Relies upon Proteasome-Dependent Monoubiquitination of Histone H2B.Cancer Res 2011,71 (17): 5739-5753).
Yet whether people RNF40 gene does not still have bibliographical information with propagation, apoptosis and the effect in tumor development of tumor cell.Further research is also treated in the effect of old friend RNF40 gene in tumor.
Summary of the invention
The Therapeutic Method and the medicine that the objective of the invention is to open and people RNF40 (ring finger protein 40) gene-correlation.
In order to further investigate the regulatory function of people RNF40 gene in tumor takes place, the present invention chooses people's pulmonary carcinoma 95D cell, people's glioma U251 cell is model, is that means research RNF40 is in the survival of above-mentioned tumor cell and the effect in the apoptosis destiny with RNAi.
First aspect present invention, disclose the people RNF40 gene that will separate for the preparation of or the purposes of screening anti-tumor medicine.
The people RNF40 gene that separates for the preparation of or the screening anti-tumor medicine comprise the content of two aspects: one is applied to prepare anti-tumor medicine or preparation as medicine or preparation at the action target of tumor cell with people RNF40 gene; Its two, people RNF40 gene is applied to screen anti-tumor medicine or preparation as medicine or preparation at the action target of tumor cell.
Describedly people RNF40 gene is applied to prepare anti-tumor medicine as medicine or preparation at the action target of tumor cell or preparation specifically refers to: with the target of people RNF40 gene as the RNA interference effect, develop medicine or preparation at tumor cell, thereby can reduce RNF40 expression of gene level in the tumor cell.
Describedly people RNF40 gene is applied to screen anti-tumor medicine as medicine or preparation at the action target of tumor cell or preparation specifically refers to: with people RNF40 gene as effective object, medicine or preparation are screened, to find the medicine that can suppress or promote RNF40 gene expression as the oncotherapy drug candidate.People RNF40 gene small molecules interference RNA (siRNA) is that the effective object screening obtains with people RNF40 gene namely as described in the present invention, can be used as to have the medicine that suppresses the tumor cell proliferation effect.In addition, such as antibody drug, small-molecule drug etc. also can be with RNF40 gene and albumen thereof as effective object.
Any tumor that described tumor is can be for the propagation of its tumor cell relevant with people RNF40 expression of gene further, is a kind of malignant tumor, for example is selected from: pulmonary carcinoma, glioma.
Described anti-tumor medicine is to suppress people's RNF40 gene transcription or translation by specificity, or can suppress the expression of people RNF40 gene protein or the molecule of activity by specificity.Thereby described anti-tumor medicine can reduce propagation, growth, propagation, differentiation and/or the survival of people RNF40 expression of gene level inhibition tumor cell in the tumor cell.
The described anti-tumor medicine that obtains by the preparation of people RNF40 gene or the screening of separation comprises: nucleic acid, carbohydrate, lipid, micromolecule, polypeptide or albumen.
Described nucleic acid comprises: siRNA (esiRNA) or the short hairpin RNA (shRNA) of antisense oligonucleotide, double-stranded RNA (dsRNA), ribozyme, endoribonuclease III preparation.
Described double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence of people RNF40 gene or the information sequence of people RNF40 gene.
Further, described double-stranded RNA is siRNA (siRNA).Described siRNA comprises positive-sense strand and antisense strand, and described positive-sense strand and described antisense strand complementation form the RNA dimer jointly, and the transcription product complementation of target sequence in described antisense strand and the people RNF40 gene.Described siRNA energy specificity is in conjunction with the coded mRNA fragment of target sequence, and the reticent people RNF40 of specificity expression of gene.
Described shRNA can be through vector expression, expresses after being cloned into slow virus carrier as the dna fragmentation that can transcribe this shRNA.
The amount of application of described anti-tumor medicine is enough to reduce people's RNF40 gene transcription or translation, perhaps enough reduces expression or the active dosage of people RNF40 albumen.So that people RNF40 expression of gene is lowered 50%, 80%, 90%, 95% or 99% at least.
Adopting the method for aforementioned anti-tumor medicine treatment tumor, mainly is the purpose that reaches treatment by the propagation that reduces people RNF40 expression of gene level inhibition tumor cell.Concrete, during treatment, the material that can effectively reduce people RNF40 gene expression dose delivers medicine to the patient.
Second aspect present invention discloses a kind of oligonucleotide molecules that reduces the separation of people RNF40 gene expression in the tumor cell, and described oligonucleotide molecules comprises:
A) double-stranded RNA, containing in the described double-stranded RNA can be under stringent condition and the nucleotide sequence of people RNF40 gene recombination; Perhaps
B) shRNA, containing among the described shRNA can be under stringent condition and the nucleotide sequence of people RNF40 gene recombination.
Further, described double-stranded RNA comprises positive-sense strand and antisense strand, described positive-sense strand and described antisense strand complementation, and the transcription product complementation of target sequence in described antisense strand and the people RNF40 gene.
Further, the length of described positive-sense strand and antisense strand is 15-27 nucleotide; Preferable, length is 19-23 nucleotide; Best, length is 19,20 or 21 nucleotide.
Further, described double-stranded RNA is siRNA (siRNA).
Further, the sequence of described siRNA is shown in SEQ ID NO:21-22.SiRNA shown in the SEQ ID NO:21-22 can play the effect of endogenous RNF40 gene expression in the reticent tumor cell of specificity for being the siRNA at people RNF40 gene that RNA disturbs the target sequence design with the sequence shown in the SEQ ID NO:7.
Further, described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, described positive-sense strand fragment and the complementation of described antisense strand fragments sequence, and the transcription product sequence complementation of target sequence in described antisense strand fragments sequence and the people RNF40 gene.Described shRNA can become siRNA (siRNA) and then play the effect of endogenous people RNF40 gene expression in the reticent tumor cell of specificity behind enzyme action.
Further, the sequence of the loop-stem structure of described shRNA can be selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of described shRNA contains the sequence shown in the SEQ ID NO:9, is specially: AGGCUGUUAAUUGUGAUGAAUUUCAAGAGA AUUCAUCACAAUUAACAGCCU.
Target sequence in the described people RNF40 gene is described small molecules interference RNA when being used for the reticent people RNF40 of specificity gene expression, with the fragment in the corresponding people RNF40 of the mRNA fragment gene of the complementary combination of described small molecules interference RNA.
Further, described people RNF40 gene disturbs target sequence, is any sequence among the SEQ ID NO:1-8.
ShRNA can become siRNA after enzyme action processing, and then plays the effect of endogenous people RNF40 gene expression in the reticent tumor cell of specificity.
The oligonucleotide molecules of described separation can be used for preparing the medicine of prevention or treatment tumor, and described tumor is pulmonary carcinoma or glioma.
When as the treatment medicine of tumor or preparation, be that double-stranded RNA or the shRNA with safe and effective amount is applied to mammal.Concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Third aspect present invention discloses a kind of people RNF40 gene and has disturbed slow virus carrier, for containing the slow virus carrier of the aforementioned shRNA genetic fragment of encoding, and can express described shRNA.
It is that dna fragmentation with the aforementioned people RNF40 gene shRNA of coding is cloned into known carrier and obtains that this people RNF40 gene disturbs slow virus carrier, described carrier mostly is slow virus carrier, described people RNF40 gene disturbs slow virus carrier to dress up to behind the infectious virion through virus packets, infected tumor's cell, and then transcribe out described shRNA.
The DNA sequence of the described people RNF40 gene shRNA genetic fragment of encoding contains arbitrary sequence and the complementary series thereof among the SEQ ID NO:1-8.
Further, described people RNF40 gene disturbs slow virus carrier also to contain the nucleotide sequence of the label that can be detected in promoter sequence and/or the codes for tumor cell; More excellent, the described label that is detected such as green fluorescent protein (GFP).
Further, described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people RNF40 gene interference slow virus carrier of vector construction with pGCSIL-GFP that the embodiment of the invention has specifically been enumerated, called after pGCSIL-GFP-siRNF40.
People RNF40 gene siRNA of the present invention can be used for suppressing the propagation of tumor cell, further can be as medicine or the preparation for the treatment of tumor.People RNF40 gene disturbs slow virus carrier then to can be used for preparing described people RNF40 gene siRNA.When as the treatment medicine of tumor or preparation, be that the people RNF40 gene siRNA with safe and effective amount is applied to mammal.Concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Fourth aspect present invention discloses a kind of people RNF40 gene and has disturbed slow virus, disturbs slow virus carrier down auxiliary in slow virus packaging plasmid, cell line by aforementioned people RNF40 gene, forms through the virus packing.But this slow virus infected tumor cell also produces people RNF40 gene small molecules interference RNA, thereby suppresses the propagation of pulmonary carcinoma, glioma tumor cell.
This people RNF40 gene disturbs slow virus to can be used for preparing the medicine of prevention or treatment tumor.Further, described tumor is selected from pulmonary carcinoma or glioma.
Fifth aspect present invention also discloses a kind of pharmaceutical composition for prevention or treatment tumor, and the oligonucleotide molecules or the people RNF40 gene that contain aforesaid separation in the described pharmaceutical composition disturb slow virus.
Except containing the siRNA or slow virus that treats effective dose, also contain pharmaceutically acceptable carrier or excipient in the described pharmaceutical composition.
In preparation during these compositionss, usually with active component and mixed with excipients, or with the excipient dilution, wrap in can capsule or the carrier that exists of medicine bag form in.Do the time spent when excipient plays diluent, it can be that solid, semisolid or fluent material are as the medium of excipient, carrier or active component.Therefore, compositions can be tablet, pill, powder, solution, syrup, sterilizing injecting solution etc.The example of suitable excipient comprises: lactose, glucose, sucrose, sorbitol, mannitol, starch, microcrystalline Cellulose, polyvinylpyrrolidone, cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, antiseptic (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
The invention also discloses the application of described pharmaceutical composition in the anti-tumor medicine of preparation treatment pulmonary carcinoma, glioma.
When described pharmaceutical composition is used for prevention or treatment target in-vivo tumour, the described pharmaceutical composition of effective dose can be applied in the object.
Adopt this method, described growth of tumor, propagation, recurrence and/or transfer are suppressed.Further, at least 10% of described growth of tumor, propagation, recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% part is suppressed.
Sixth aspect present invention, the RNA that discloses a kind of people RNF40 gene of separation disturbs target sequence, is any sequence among the SEQ ID NO:1-8.
The RNA of the people RNF40 gene of described separation disturbs target sequence, can be applicable to screening and preparation at the siRNA of people RNF40 gene.
The RNA that the invention also discloses a kind of people RNF40 gene disturbs the application of target sequence in the anti-tumor medicine of preparation treatment pulmonary carcinoma or glioma.
Seventh aspect present invention discloses a kind of test kit for reducing the RNF40 gene expression in the tumor cell, and described test kit comprises: the oligonucleotide molecules or the described RNF40 gene that are present in the described separation in the container disturb slow virus.
In sum, the present invention has designed 8 RNAi target sequences at people RNF40 gene, make up corresponding RNF40RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-siRNF40 at target sequence SEQ ID NO:7 can significantly descend mediator RNF40 gene in the expression of mRNA level and protein level.Use slow virus (lentivirus, be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-siRNF40 as the genetic manipulation instrument and can will efficiently import people's pulmonary carcinoma 95D cell, glioma U251 cell at the RNAi sequence of RNF40 gene in targeting ground, reduce RNF40 expression of gene level, significantly suppress the multiplication capacity of above-mentioned tumor cell.Therefore the people RNF40 gene silencing of slow virus mediation is the potential clinical non-operative treatment mode of malignant tumor.
SiRNA provided by the invention or the slow virus carrier, slow virus that comprise this siRNA sequence can suppress people RNF40 expression of gene by specificity, especially slow virus, can efficiently infect target cell, suppress RNF40 expression of gene in the target cell expeditiously, and then suppress the growth of pulmonary carcinoma, glioma tumor cell, promote pulmonary carcinoma, glioma apoptosis of tumor cells, significant in pulmonary carcinoma, glioma oncotherapy.
Description of drawings
Fig. 1 represents pGCSIL-GFP plasmid DNA collection of illustrative plates
Fig. 2 represents that the siRNF40-Lentivirus slow virus infects people's pulmonary carcinoma 95D cell and glioma U251 cell after 5 days, and the expression of RNF40mRNA significantly reduces.
Fig. 3 represents that the siRNF40-Lentivirus slow virus infects people's pulmonary carcinoma 95D cell after 5 days, significantly suppresses cell proliferation.
Fig. 4 represents that the siRNF40-Lentivirus slow virus infects people's glioma U251 cell after 4 days, significantly suppresses cell proliferation.
The specific embodiment
The present invention is based on the research that ring finger protein may be relevant with propagation, drug resistance and the transfer etc. of tumor cell, think that RNF40 may participate in generation and the development of malignant tumor as a kind of newfound ring finger protein.
The present invention relates to one group of small molecules interference RNA at people RNF40 gene (siRNA) sequence, rna interference vector and RNA and disturbed slow virus.Choose people RNF40mRNA coding region sequence as the target site of siRNA, according to the individual base sequence design of 10-30 continuous in the target site (preferred 15-27, more preferably 19-23) siRNA target sequence.By gene clone, the slow virus carrier of the above-mentioned siRNA of construction expression, the further slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the reticent human tumor cells of specificity in endogenous RNF40 expression of gene.
The inventor finds, adopts the propagation that can suppress tumor cell under the RNAi method after the mediator RNF40 expression of gene effectively, and this achievement in research shows that the RNF40 gene is proto-oncogene, can be used as the target spot of oncotherapy.The inventor is further synthetic and tested multiple siRNA at the RNF40 gene, has filtered out the expression that can effectively suppress RNF40 and then has suppressed the siRNA of people's pulmonary carcinoma 95D cell, glioma U251 cell proliferation and growth, has finished the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of interference people RNF40 genes, but made up the slow virus of the reticent RNF40 gene expression of specificity.The present invention discovers, at siRNA and the RNAi slow virus of people RNF40 gene design, stablizes also and reduces the RNF40 expression of gene specifically, and suppress the propagation of human tumor cells effectively.The present invention shows that the RNF40 gene can promote growth of tumour cell, is expected to become the target spot of early diagnosis of tumor and treatment.And, by the reticent RNF40 expression of gene of RNAi mode, can be used as the effective means that suppresses tumor development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people RNF40 gene RNAi slow virus: transfer people RNF40 gene order from Genbank; Prediction siRNA site; Synthetic effective siRNA sequence at the RNF40 gene, two ends contain the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected the RNAi plasmid of construction expression RNF40 gene siRNA sequence behind the slow virus carrier double digestion with double-stranded DNA Oligo; RNAi plasmid and slow virus are packed assistant carrier (Packing Mix, Sigma-aldrich company) the cotransfection HEKC 293T that needs, the recombinant RNA i slow virus granule of packaging expression RNF40 gene.Slow virus granule in the collecting cell culture supernatant, purification concentrates, and namely makes slow virus (siRNF40-Lentivirus) pure, stably express RNF40siRNA.
Based on said method, the invention provides 8 effective target spots (specifically shown in SEQ ID NO 1-8) that disturb the RNF40 gene, made up the slow virus of special interference people RNF40 gene.
The present invention simultaneously also discloses a kind of people RNF40 gene RNAi slow virus (RNF40-RNAi) and preparation and application thereof.
Originally discover, utilize the RNAi method of slow virus mediation, after reducing the expression of RNF40 gene in tumor cell, can effectively suppress the propagation of tumor cell.Originally studies show that, the RNF40 gene is a proto-oncogene, can promote tumor cell proliferation, in taking place and develop, tumor has important biological function, the RNF40 gene can be the target of oncotherapy, and the RNF40 gene specific silence of slow virus mediation can be used as a kind of new tool of oncotherapy.
Further set forth the present invention below in conjunction with embodiment.Should be understood that embodiment only is used for explanation the present invention, but not limit the scope of the invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared prescription is according to normal condition among the embodiment, as works such as [U.S.] Sambrook.J; Huang Peitang etc. translate.The molecular cloning test guide, the third edition.Beijing: the condition of the condition described in the Science Press 2002 or manufacturer's suggestion is carried out or is disposed.
Embodiment 1: at the preparation of people RNF40 gene RNAi slow virus
1. screening is at the effective siRNA target spot of people RNF40 gene
From Genbank, choose the coding region sequence of people RNF40 (NM 014771) gene, every the sequence of 20 bases of an initial acquisition of base; Utilizing the design software of Shanghai JiKai Gene Chemical Technology Co., Ltd, is template with people RNF40mRNA sequence, determines 8 effective siRNA target sequences (SEQ ID NO:1-8), as shown in table 1:
Table 1 targeting is in the siRNA target sequence of people RNF40 gene
The double-stranded DNA Oligo sequence (table 2) that contains AgeI and EcoRI restriction enzyme site cohesive end at the synthetic two ends of siRNA target spot (be example with SEQ ID NO:7); (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, and Fig. 1), makes its linearisation (reaction system is as shown in table 4,37 ℃, reacts 1h), and agarose gel electrophoresis is identified endonuclease bamhi to act on the pGCSIL-GFP carrier with AgeI and EcoRI restricted enzyme.
Table 2 two ends contain the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
Be connected with the good double-stranded DNA Oligo of purification by the carrier DNA of T4DNA ligase after with the double digestion linearisation, in suitable buffer system (linked system is as shown in table 5), spend the night in 16 ℃ of connections, reclaim and connect product.
Fresh competent escherichia coli cell (the conversion operation reference: molecular cloning experiment guide second edition 55-56 page or leaf) that product transforms the calcium chloride preparation will be connected.Grow bacterium clone surface at the connection converted product and be stained with, be dissolved in 10 μ l LB culture medium, mixing is got 1 μ l as template; The upstream and downstream of RNAi sequence in slow virus carrier, design universal PC R primer forward primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:10); Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:11) carries out PCR identification experiment (the PCR reaction system is as table 6-1, and the PCR reaction condition is as table 6-2).PCR is identified that positive clone checks order and compare of analysis, compares correct clone and is the RNAi carrier at the target sequence shown in the SEQ ID NO:7 that successfully constructs, called after pGC SIL-GFP-siRNF40.
Make up pGCSIL-GFP-control negative control plasmid, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ IDNO:12).When making up pGCSIL-GFP-control negative control plasmid, synthesize the double-stranded DNA Oligo sequence (seeing Table 3) that two ends contain AgeI and EcoRI restriction enzyme site cohesive end at Scr (scramble) siRNA target spot, all the other construction methods, authentication method and condition be same pGCSIL-GFP-siRNF40 all.
Table 3 two ends contain the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
Table 5 carrier DNA and double-stranded DNA Oligo coupled reaction system
Table 6-1PCR reaction system
Table 6-2PCR reaction system amplification program
2. pack the siRNF40-Lentivirus slow virus
Extract the RNAi plasmid pGCSIL-GFP-siRNF40 of previous step preparation with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.
24h before the transfection, with the HEKC 293T cell of trypsinization exponential phase, adjusting cell density with the DMEM complete medium that contains 10% hyclone is 1.5 * 10
5Cell/ml is inoculated in 6 orifice plates, and 37 ℃, 5%CO
2Cultivate in the incubator.Treat to can be used for when cell density reaches 70%-80% transfection.2h before the transfection, the original culture medium of sucking-off adds the fresh complete medium of 1.5ml.Explanation according to the MISSION Lentiviral Packaging Mix test kit of Sigma-aldrich company, in a sterilization centrifuge tube, add Packing Mix (PVM) 20 μ l, PEI 12 μ l, serum-free DMEM culture medium 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed liquor.
Above-mentioned transfection mixture is at room temperature hatched 15min, be transferred in the culture medium of HEKC 293T cell, 37 ℃, 5%CO
2Cultivate 16h in the incubator.Discard the culture medium that contains the transfection mixture, the PBS solution washing adds complete medium 2ml, continues to cultivate 48h.The collecting cell supernatant, Centricon Plus-20 centrifugal ultrafiltration device (Millipore) purification and concentrated slow virus, step is as follows: (1) 4 ℃, the centrifugal 10min of 4000g removes cell debris; (2) 0.45 μ m filter filtering supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, and 10-15min is to the concentrated volume of the virus that needs; (4) after the centrifugal end, filter cup and following filtered solution collection cups are separated, filter cup is tipped upside down on the sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from the sample collection cup, be viral concentrated solution in the sample collection cup.With after the viral concentrated solution packing in-80 degrees centigrade of preservations.The siRNA sequence that contains in the virus concentrated solution is SEQ ID NO:21-22.
The packaging process of contrast slow virus only replaces the pGCSIL-GFP-siRNF40 carrier with the treatment of pGCSIL-GFP-control negative control with the packaging process of pGCSIL-GFP-siRNF40 slow virus carrier.
Embodiment 2: the real-time fluorescence quantitative RT-PCR method detects the reticent efficient of RNF40 gene
The people's pulmonary carcinoma 95D cell, the glioma U251 cell that are in exponential phase carry out trypsinization, and (cell number is about 5 * 10 to make cell suspension
4/ m1) be inoculated in 6 orifice plates, be cultured to the cell fusion degree and reach about 30%.According to infecting plural number (the MOI value of people's pulmonary carcinoma 95D cell is 20, and the MOI value of glioma U251 cell is 10) value, add the slow virus of embodiment 1 preparation of Sq, change culture medium after cultivating 24h, treat that time of infection reaches 5 days after, collecting cell.According to the Trizol operating instruction of Invitrogen company, extracted total RNA.According to the M-MLV operating instruction of Promega company, the RNA reverse transcription is obtained cDNA (the reverse transcription reaction system sees Table 7), 42 ℃ of reaction 1h, water-bath 10min makes the reverse transcriptase inactivation in 70 ℃ of water-baths then.
Adopting TP800 type Real time PCR instrument (TAKARA) to carry out real-time quantitative detects.The primer of RNF40 gene is as follows: forward primer 5 '-CTCCTCATCGTCAATCGCTAC-3 ' (SEQ ID NO:13) and downstream primer 5 '-CCCAGTGCCACCACAAAA-3 ' (SEQ ID NO:14).Be confidential reference items with house-keeping gene GAPDH, primer sequence is as follows: forward primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:15) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:16).Press the proportional arrangement reaction system in the table 8.
Table 7 reverse transcription reaction system
Table 8Real-time PCR reaction system
Setting program is two-step method Real-time PCR: 95 ℃ of pre-degeneration, 15s; Each circulation afterwards is: 95 ℃ of degeneration, 5s; Annealing is extended 60 ℃, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR finished, 95 ℃ of degeneration 1min were cooled to 55 ℃ then, make the abundant combination of dna double chain.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2
-Δ Δ CtAnalytic process is calculated the expression abundance that has infected RNF40mRNA.With the cell that infects contrast virus (control) relatively, the result as shown in Figure 2, the RNF40mRNA expression of people's pulmonary carcinoma 95D, glioma U251 cell has descended 97.5% and 90.3% respectively in the experimental group.
Embodiment 3: the multiplication capacity that detects the tumor cell that infects the siRNF40-Lentivirus slow virus
The people's pulmonary carcinoma 95D, the glioma U251 cell that are in exponential phase carry out trypsinization, and (cell number is about 5 * 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cell fusion degree and reach about 30%.According to infecting plural number (the MOI value of 95D cell is that the MOI value of 20, U251 cell is 10), add the virus of Sq, change culture medium after cultivating 24h, treat that time of infection reaches 5 days after, collect each the experimental group cell that is in exponential phase.The resuspended one-tenth cell suspension (2 * 10 of complete medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Every group 5 multiple holes, every hole 100 μ l.After completing plate, put 37 ℃, 5%CO
2Incubator is cultivated.Behind the bed board second day, detected with Cellomics instrument (Thermo Fisher) and read plate once every day, and continuous detecting was read plate 5 days.By adjusting the input parameter of Cellomics arrayscan, calculate the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, data are added up drawing, draw cell proliferation curve (result is as shown in Figure 3, Figure 4).
The result shows, the siRNF40-Lentivirus slow virus is infected each tumor of group after cells in vitro is cultivated 5 days, growth rate significantly slows down, growth rate far below the matched group tumor cell, the vigor cell number has descended 72.8% and 46.7% respectively, shows that the RNF40 gene silencing causes the tumor cell proliferation ability to be suppressed.
Claims (17)
1. the purposes of the people RNF40 gene of Fen Liing in arbitrary anti-tumor medicine of preparation or screening pulmonary carcinoma, glioma.
2. oligonucleotide molecules that reduces the separation of people RNF40 gene expression in the tumor cell, described oligonucleotide molecules comprises:
A) double-stranded RNA, containing in the described double-stranded RNA can be under stringent condition and the nucleotide sequence of people RNF40 gene recombination; Perhaps;
B) shRNA, containing among the described shRNA can be under stringent condition and the nucleotide sequence of people RNF40 gene recombination.
3. the oligonucleotide molecules of separation as claimed in claim 2 is characterized in that, described double-stranded RNA comprises positive-sense strand and antisense strand, described positive-sense strand and described antisense strand complementation, and the transcription product complementation of target sequence in described antisense strand and the people RNF40 gene; Described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, described positive-sense strand fragment and the complementation of described antisense strand fragments sequence, and the transcription product sequence complementation of target sequence in described antisense strand fragments sequence and the people RNF40 gene.
4. the oligonucleotide molecules of separation as claimed in claim 3 is characterized in that, the sequence of described loop-stem structure is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
5. as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that described people RNF40 gene disturbs target sequence, is any sequence among the SEQ ID NO:1-8.
6. as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that described double-stranded RNA is siRNA, the sequence of this siRNA is shown in SEQ ID NO:21-22.
7. as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that the sequence of described shRNA contains SEQ ID NO:9.
8. a people RNF40 gene disturbs slow virus carrier, for the slow virus carrier of the genetic fragment of the shRNA in the oligonucleotide molecules that contains the described separation of the coding arbitrary claim of claim 2-7, can express described shRNA.
9. slow virus carrier as claimed in claim 8 is characterized in that, described slow virus carrier also contains the nucleotide sequence of the label that can be detected in the codes for tumor cell.
10. slow virus carrier as claimed in claim 9 is characterized in that, the described label that is detected is green fluorescent protein.
11. slow virus carrier as claimed in claim 8, it is characterized in that described slow virus carrier is selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-1ammshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
12. a people RNF40 gene disturbs slow virus, by the described slow virus carrier of the arbitrary claim of claim 9-11 down auxiliary in slow virus packaging plasmid, cell line, forms through the virus packing.
13. a pharmaceutical composition that is used for prevention or treatment tumor, the oligonucleotide molecules or the described people RNF40 of claim 12 gene that contain in the described pharmaceutical composition just like arbitrary described separation among the claim 2-7 disturb slow virus.
14. the application of the described pharmaceutical composition of claim 13 in the anti-tumor medicine of preparation treatment pulmonary carcinoma or glioma.
15. the RNA of the people RNF40 gene of a separation disturbs target sequence, is any sequence among the SEQ ID NO:1-8.
16. the RNA of the described people RNF40 of claim 15 gene disturbs the application of target sequence in the anti-tumor medicine of preparation treatment pulmonary carcinoma, glioma.
17. test kit for reducing the people RNF40 gene expression in the tumor cell, it is characterized in that, described test kit comprises: be present in the container, according to oligonucleotide molecules or the described people RNF40 of the claim 12 gene interference slow virus of arbitrary described separation among the claim 2-7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210066898.3A CN103301474B (en) | 2012-03-14 | 2012-03-14 | Usage and related drugs of human RNF40 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210066898.3A CN103301474B (en) | 2012-03-14 | 2012-03-14 | Usage and related drugs of human RNF40 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103301474A true CN103301474A (en) | 2013-09-18 |
| CN103301474B CN103301474B (en) | 2017-05-17 |
Family
ID=49127479
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210066898.3A Active CN103301474B (en) | 2012-03-14 | 2012-03-14 | Usage and related drugs of human RNF40 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103301474B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109420171A (en) * | 2017-08-28 | 2019-03-05 | 中国医学科学院基础医学研究所 | Purposes of the RNF2 in treatment virus infection or the relevant diseases associated with inflammation of virus infection |
-
2012
- 2012-03-14 CN CN201210066898.3A patent/CN103301474B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| LILACH MOYAL等: "Requirement of ATM-Dependent Monoubiquitylation of Histone H2B for Timely Repair of DNA Double-Strand Breaks", 《MOLECULAR CELL》 * |
| TANJA PRENZEL等: "Estrogen-Dependent Gene Transcription in Human Breast", 《CANCER RESEARCH》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109420171A (en) * | 2017-08-28 | 2019-03-05 | 中国医学科学院基础医学研究所 | Purposes of the RNF2 in treatment virus infection or the relevant diseases associated with inflammation of virus infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103301474B (en) | 2017-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN110917357A (en) | Application of human GSDMB gene and related product | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103301474B (en) | Usage and related drugs of human RNF40 gene | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN103667430A (en) | Application and relevant medicament of nucleotide octamer binding protein expression gene | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
| CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
| CN110938630B (en) | Application of human B3GNT5 gene and related products | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200602 Address after: 201203 room 101-7, No. 332, Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI JIBEI BIOTECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
| TR01 | Transfer of patent right |