CN112899275B - Application of circRHBDD1 in preparation of drugs for treating hepatocellular carcinoma - Google Patents

Abstract

The invention discloses a circular RNA, which is named as hsa _ circ _0058497 (circRHBDD1 for short), and the nucleic acid sequence of the circular RNA is shown as SEQ ID NO. 1. The invention discloses application of the circular RNA in preparing a medicine for treating hepatocellular carcinoma. The invention discloses an application of the circular RNA in preparation of a preparation for evaluating hepatocellular carcinoma prognosis. The expression of the circular RNA is obviously increased in hepatocellular carcinoma, and experiments in mice prove that the circular RNA has the tumor promotion effect of circRHBDD1, can promote glycolysis and glutaminolysis of liver cancer cells, enables target circRHBDD1/YTHDF1/PIK3R1 to possibly become a treatment method of hepatocellular carcinoma, and can independently predict the survival outcome of patients.

Description

Application of circRHBDD1 in preparation of drugs for treating hepatocellular carcinoma

Technical Field

The invention relates to the technical field of circular RNA, in particular to application of circRHBDD1 in preparation of a medicine for treating hepatocellular carcinoma.

Background

Hepatocellular carcinoma (HCC) ranks sixth in incidence and is the fourth leading cause of cancer-related death worldwide. Most patients are diagnosed in the late stage of liver cancer. Despite some advances in the treatment of liver cancer, the 5-year survival rate of liver cancer patients remains low. Therefore, it is of crucial importance to elucidate the underlying mechanisms and to identify new prognostic biomarkers and to identify therapeutic targets.

Behind the malignant phenotype of hepatocellular carcinoma is the reprogramming of cancer cell metabolism due to multiple genetic mutations. Alterations in cellular metabolism affect multiple core pathways, such as glucose and amino acid metabolism, and are therefore considered to be major hallmarks of cancer. Cancer cells do not oxidize completely through the tricarboxylic acid cycle, but convert glucose to lactate by accelerating aerobic glycolysis. Increased glycolysis can meet the growing energy demand of cancer cells, while increased glutamine metabolism provides biosynthetic precursors to cancer cells. Glutamine is considered a key amino acid that supplies carbon and nitrogen to cancer cells to maintain anabolism and biosynthesis. Tumor cells increase the glutamine decomposition rate by accelerating the tricarboxylic acid cycle, which converts glutamine to glutamate and subsequently produces alpha-ketoglutarate (alpha-KG). Inhibition of glycolysis and glutamine catabolism is an emerging area of new drug discovery.

Circular RNAs (circRNAs) are a class of covalently closed RNA transcripts that result from reverse splicing of mRNA precursors. The circular RNA has the characteristics of abundance, stability, evolution conservation and presentation of an expression mode with specificity of time and space. As an indispensable regulatory factor in various physiological and pathological processes, circular RNAs function through a variety of mechanisms, including acting as microRNA sponges, interacting with RNA-binding proteins, regulating gene transcription, translation into polypeptides. There is increasing evidence that circular RNAs are involved in the metabolic reprogramming of cancer cells. In neuroblastoma, circ-CUX1 promotes aerobic glycolysis by binding to EWSR 1. It has been reported that circHECTD1 promotes glutaminolysis by acting on USP5 target in gastric cancer.

Therefore, the potential effect of circular RNA on liver cancer progression during metabolism is worthy of study.

Disclosure of Invention

The invention aims to solve the defects in the prior art and provides a method for processing a multi-functional chip.

A circular RNA is named hsa _ circ _0058497, circRHBDD1 for short, and the nucleic acid sequence of the circular RNA is shown as SEQ ID NO. 1.

The application of the circular RNA in preparing the medicine for treating hepatocellular carcinoma.

Preferably, the therapeutic agent for hepatocellular carcinoma has at least the following effects:

inhibit glycolysis and glutaminolysis of hepatoma cells, and/or inhibit the translational expression of PIK3R 1.

A therapeutic agent for hepatocellular carcinoma, comprising: the above circular RNA, or an inhibitor of the above circular RNA.

Preferably, the above circular RNA serves as a target of action.

The application of the circular RNA in preparing a preparation for evaluating hepatocellular carcinoma prognosis.

Preferably, the circular RNA is used as a biomarker.

A prognostic formulation for evaluating hepatocellular carcinoma comprising: a reagent that specifically recognizes the circular RNA.

The application shows that: circrhbd 1 was significantly elevated in HCC expression and promoted glycolysis and glutaminolysis of liver cancer cells. Similarly, circRHBDD1 interacted with YTHDF1 and enhanced PIK3R1 translation in an m6 a-dependent manner. EIF4a3 may induce up-regulation of circRHBDD1 in liver cancer. Therefore, targeting circRHBDD1/YTHDF1/PIK3R1 may become a treatment method for hepatocellular carcinoma.

Drawings

FIG. 1A is a circRNA expression profile between HCC tissue and adjacent liver tissue; FIG. 1B is a graph of the up-and down-regulation profile of circRNA in HCC tissue; FIG. 1C is a graph showing the comparison of the relative expression levels of circRNA at the first 5 th position of the above-mentioned upregulation in HCC and pericyte cells; FIG. 1D is a graph comparing the relative expression of circRHBDD1 in different liver cell lines; FIG. 1E is a schematic source diagram of circRHBDD 1; FIG. 1F is an agarose gel electrophoresis test of circRHBDD1 in HCCLM3 cell line; FIG. 1G is an agarose gel electrophoresis test of circRHBDD1 in HepG2 cell line; FIG. 1H is a graph comparing the relative expression of circRHBDD1 and RHBDD 1mRNA in different liver cell lines using different primers; FIG. 1I is a graph comparing the relative expression of circRHBDD1 and RHBDD 1mRNA after degradation in different liver cell lines; FIG. 1J is a graph of the fold difference between circRHBDD1 and RHBDD 1mRNA after treatment with actinomycin D in HCCLM3 cell line; FIG. 1K is a graph of the fold difference between circRHBDD1 and RHBDD 1mRNA after treatment with actinomycin D in HepG2 cell line; FIG. 1L is a graph showing the results of an RNA fluorescence in situ hybridization experiment with circRHBDD 1; FIG. 1M is a graph showing the results of an experiment in which circRHBDD1 was isolated from HCCLM3 cell line; FIG. 1N is a graph showing the results of an experiment in which circRHBDD1 was isolated from HepG2 cell line.

FIG. 2A is a graph of 96 pairs of circRHBDD1 expression in HCC tissues and peritumoral specimens; FIG. 2B is a graph showing the results of RNA fluorescence in situ hybridization experiments of circRHBDD1 in HCC tissues and peritumoral specimens; FIG. 2C is a graph comparing the expression levels of circRHBDD1 in tumors ≦ 5cm and tumors >5 cm; FIG. 2D is a graph comparing the expression levels of circRHBDD1 in tumor lymph node metastasis grades I-II and III-IV; FIG. 2E is a graph comparing the expression levels of circRHBDD1 in HCC and pericancerous cells; figure 2F is a graph of the effect of the expression level of circRHBDD1 on overall survival of HCC patients; FIG. 2H is a graph of the effect of the expression level of circRHBDD1 on disease-free survival in HCC patients; FIG. 2G is a graph of the expression level of circRHBDD1 as a function of tumor size and tumor lymph node metastasis duration in total survival HCC patients; FIG. 2I is a graph of the expression level of circRHBDD1 as a function of the duration of alpha-fetoprotein, microvascular invasion, tumor lymph node metastasis in disease-free survival HCC patients.

FIG. 3A is a graph of the expression levels of circRHBDD1 and RHBDD 1mRNA in HCCLM3 cell line following knockdown of circRHBDD 1; FIG. 3B is a graph of the expression levels of circRHBDD1 and RHBDD 1mRNA in MHCC97H cell line following knockdown of circRHBDD 1; FIG. 3C is a graph comparing the proliferation of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 3D is a graph comparing the viability of HCCLM3 cell line following knockdown of circRHBDD 1; FIG. 3E is a graph comparing the viability of MHCC97H cell line following knockdown of circRHBDD 1; FIG. 3F is an EdU map of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1.

FIG. 4A is a graph of RNA-seq analysis of HCCLM3 cells and control cells following knockdown of circRHBDD 1; FIG. 4B is a KEGG analysis of circRHBDD 1; FIG. 4C is a graph of mRNA levels of GLUT1, HK2 in HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4D is a graph of the mRNA levels of ASCT2, GLS1 in HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4E is a Western blot of GLUT1, HK2, ASCT2, GLS1 in HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4F is a diagram of an ECAR analysis of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4G is a chart of OCR analysis of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4H is a graph comparing the levels of G6P, lactate, ATP in HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 4I is a graph comparing the levels of glutamine, glutamic acid and α -KG of cell lines HCCLM3 and MHCC97H following knockdown of circRHBDD 1.

FIG. 5A is a schematic diagram of a process for preparing a PDX mouse model; figure 5B is a graph comparing the expression levels of circRHBDD1 in a PDX mouse model from 10 patients; FIG. 5C is a histopathological section of transplanted tumors from patient Nos. 5 and 2; FIG. 5D is a photograph showing anatomical comparison of transplanted tumors in two groups following injection with cholesterol-conjugated circRHBDD1siRNA and circRHBDD1 plasmids; figure 5E is a graph comparing the volume of transplanted tumors in both groups following injection with cholesterol conjugated circRHBDD1siRNA and circRHBDD1 plasmids; figure 5F is a graph comparing the mass of transplanted tumors in both groups following injection with cholesterol conjugated circRHBDD1siRNA and circRHBDD1 plasmid; FIG. 5G is a graph comparing the expression levels of circRHBDD1 in the two groups following injection with the cholesterol-conjugated circRHBDD1siRNA and the circRHBDD1 plasmid; FIG. 5H is a comparison of RNA fluorescence in situ hybridization experiments in two groups following injection with cholesterol-conjugated circRHBDD1siRNA and circRHBDD1 plasmids; FIG. 5I is a graph comparing the expression levels of GLUT1, ASCT2 and Ki-67 in the two groups following injection with cholesterol-conjugated circRHBDD1siRNA and circRHBDD1 plasmid.

FIG. 6A is a comparison of AKT Western blots of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 6B is a comparison of PIK3R1 Western blots of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 6C is a graph of an immunohistochemical analysis of HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 6D is a graph comparing PIK3R1mRNA levels in HCCLM3 and MHCC97H cell lines following knockdown of circRHBDD 1; FIG. 6E is a comparison of PIK3R1 Western blots after CHX treatment of HCCLM3 cell line knockdown into circRHBDD 1; FIG. 6F is a chart comparing the protein content of PIK3R1 after CHX treatment of HCCLM3 cell line knockdown into circRHBDD 1; FIG. 6G is a comparison of PIK3R1 Western blots after treatment of the HCCLM3 cell line knockdown into circRHBDD1, respectively; FIG. 6H is a profile of PIK3R1mRNA from HCCLM3 cell line knockdown of circRHBDD 1; FIG. 6I is a graph comparing AGO2-RIP detection of HCCLM3 cell line and MHCC 97H; FIG. 6J is a CPAT bioinformatics prediction graph of circRHBDD 1; FIG. 6K is a drawing of an RNA pull-down analysis of circRHBDD 1; FIG. 6L is an enlarged view of the box of FIG. 6K; FIG. 6M is a diagram showing the results of RIP experiments using HCCLM3 cell line; FIG. 6N is a FISH detection result chart of HCCLM3 cell line; FIG. 6O is a graph showing the results of bioinformatic analysis of HCC and pericytes; FIG. 6P is a graph showing the relationship between YTHDF1 expression level and overall survival time.

FIG. 7A is a schematic representation of the REPIC database results for PIK3R 1; FIG. 7B is a graph comparing YTHDF 1mRNA levels in HCCLM3 and MHCC97H cell lines after downregulation of YTHDF 1; FIG. 7C is a Western blot comparison of PIK3R1 in HCCLM3 and MHCC97H cell lines after downregulation of YTHDF 1; FIG. 7D is a graph comparing the abundance of PIK3R1 in HCCLM3 and MHCC97H cell lines after downregulation of YTHDF 1; FIG. 7E is a graph comparing YTHDF 1mRNA levels in HepG2 and Huh7 cell lines ectopically expressing YTHDF 1; FIG. 7F is a Western blot comparison of PIK3R1 in HepG2 and Huh7 cell lines ectopically expressing YTHDF 1; FIG. 7G is a graph comparing the abundance of PIK3R1 in HepG2 and Huh7 cell lines ectopically expressing YTHDF 1; FIG. 7H is a graph comparing PIK3R1mRNA levels in HepG2 cell line ectopically expressing YTHDF 1; FIG. 7I is a graph comparing the distribution of PIK3R1mRNA in HepG2 cell line ectopically expressing YTHDF 1; figure 7J is a western blot comparison of PIK3R1 in HCCLM3 cell lines knockdown circRHBDD1 and/or overexpressing YTHDF 1; FIG. 7K is a graph comparing PIK3R1mRNA levels in HCCLM3 cell lines knockdown circRHBDD1 and/or overexpressing YTHDF 1; FIG. 7L is a comparative Western blot of PIK3R1 after transfection of HepG2 and Huh7 cell lines with YTHDF1-wt or YTHDF 1-mut; FIG. 7M is a graph comparing the levels of PIK3R1mRNA after YTHDF1-wt or YTHDF1-mut transfection of HepG2 and Huh7 cell lines; FIG. 7N is a graph showing the results of RIP experiments after transfection of HepG2 and Huh7 cell lines with YTHDF1-wt or YTHDF 1-mut.

FIG. 8A is a schematic representation of the three EIF4A3 binding sites flanking circRHBDD 1; FIG. 8B is a graph showing the comparison of the expression level of EIF4A3 in HCC and pericyte; FIG. 8C is a graph showing the relationship between the expression level of EIF4A3 in HCC and the overall survival rate; FIG. 8D is a graph of the level of circRHBDD1 versus the level of EIF4A3 expression; FIG. 8E is a graph comparing the mRNA levels of EIF4A3 in HCCLM3 and MHCC97H cell lines after knockdown of EIF4A 3; FIG. 8F is a Western blot of EIF4A3 in HCCLM3 and MHCC97H cell lines after knockdown of EIF4A 3; FIG. 8G is a graph comparing the level of circRHBDD 1mRNA in HCCLM3 and MHCC97H cell lines following knockdown of EIF4A 3; FIG. 8H is a graph comparing the levels of EIF4A3 mRNA in HepG2 and Huh7 cell lines overexpressing EIF4A 3; FIG. 8I is a Western blot of EIF4A3 in HepG2 and Huh7 cell lines overexpressing EIF4A 3; FIG. 8J is a graph comparing expression levels of circRHBDD1 in HepG2 and Huh7 cell lines overexpressing EIF4A 3; FIG. 8K is a graph of fold difference analysis of three binding sites EIF4A3 flanking circRHBDD1 after binding to EIF4A 3; FIG. 8L is a graph comparing the expression levels of circRHBDD1 following knockdown of the three EIF4A3 binding sites EIF4A3 flanking circRHBDD1 following binding of EIF4A 3; FIG. 8M is a schematic diagram of the pathway by which EIF4A3 promotes the expression of circRHBDD 1.

FIG. 9A is a graph comparing the expression levels of circRHBDD1, RHBDD 1mRNA in HepG2 cell line after overexpression of circRHBDD 1; FIG. 9B is a graph comparing the expression levels of circRHBDD1, RHBDD 1mRNA in Huh7 cell line after the overexpression of circRHBDD 1; FIG. 9C is a graph comparing the proliferation of HepG2 and Huh7 cell lines after overexpression of circRHBDD 1; FIG. 9D is a graph comparing the viability of HepG2 cell lines after overexpression of circRHBDD 1; FIG. 9E is a graph comparing the viability of Huh7 cell lines after overexpression of circRHBDD 1; FIG. 9F is an EdU map of HepG2 and Huh7 cell lines after overexpression of circRHBDD 1.

FIG. 10A is a graph of the mRNA levels of GLUT1, HK2 in HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10B is a graph of the mRNA levels of ASCT2, GLS1 in HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10C is a Western blot of GLUT1, HK2, ASCT2, GLS1 from HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10D is a diagram of ECAR analysis of HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10E is a chart of OCR analysis of HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10F is a graph of the levels of G6P, lactate, ATP in HepG2 and Huh7 cell lines overexpressing circRHBDD 1; FIG. 10G is a graph of glutamine, glutamic acid and α -KG levels in HepG2 cell line overexpressing circRHBDD1 and Huh 7.

FIG. 11A is a Western blot of high expression of PIK3R1 in circRHBDD1 silenced HCCLM3 cell line; FIG. 11B is a detection map of CCK-8 highly expressing PIK3R1 in circRHBDD1 silenced HCCLM3 cell line; figure 11C is a graph of EdU detection of high expression of PIK3R1 in circRHBDD1 silenced HCCLM3 cell line.

FIG. 12A is a graph of an ECAR analysis of high expression of PIK3R1 in circRHBDD1 silenced HCCLM3 cell line; FIG. 12B is a graph of OCR analysis of high expression of PIK3R1 in circRHBDD1 silenced HCCLM3 cell line; FIG. 12C is a graph of the levels of G6P, lactate, ATP after high expression of PIK3R1 in the circRHBDD1 silenced HCCLM3 cell line; FIG. 12D is a graph of the levels of glutamine, glutamic acid and α -KG after high expression of PIK3R1 in the circRHBDD 1-silenced HCCLM3 cell line; FIG. 12E is a Western blot of transporters and enzymes of relevant metabolism following high expression of PIK3R1 in the circRHBDD 1-silenced HCCLM3 cell line.

FIG. 13A is a schematic representation of biotinylated RNA fragments; FIG. 13B is a graph of the results of RNA pull-down experiments with YTHDF1 and P1, P2, P3; FIG. 13C is a schematic diagram of YTHDF1-N and YTHDF1-C structures; FIG. 13D is a comparison of the RIP assay results for YTHDF1-N, YTHDF1-C and circRHBDD 1.

FIG. 14A is a graph comparing the mRNA levels of EIF4A3 in HCCLM3 and MHCC97H cell lines that knockdown circRHBDD 1; FIG. 14B is a Western blot of EIF4A3 in HCCLM3 and MHCC97H cell lines knockdown circRHBDD 1.

FIG. 15 is a schematic representation of circRHBDD1 at the loop forming junction.

Detailed Description

The present invention will be further illustrated with reference to the following specific examples.

The applicant collected a total of 96 pairs of HCC tissue and corresponding adjacent liver tissue from patients who received hepatectomy in the first subsidiary hospital of the southern anhui medical college from 2010 to 2014.

All patients enrolled in the study did not receive chemotherapy or radiation therapy prior to surgery. Prior to the study, patients signed written informed consent. The present application was based on the declaration of helsinki, approved by the ethical committee of the first subsidiary hospital of the southern Anhui medical college.

The detection method used in the following examples is as follows:

1. sequencing of CircRNA

RiboBio (Guangzhou, China) performed CircRNA sequencing using three pairs of HCC tissue and adjacent liver tissue. Briefly, total RNA was extracted from HCC tissues and adjacent tissues using TRIzol reagent (Invitrogen, Calsbad, Calif., USA). RNA purity was assessed using an ND-1000 nm dropper and RNA integrity was tested using an Agilent 2200TapeStation (Agilent technologies, Santa Clara, Calif., USA). rRNA was removed using an rRNA removal kit (Illumina, san Diego, Calif., USA). RNase R (Vickers technology, Wisconsin, USA) was used to degrade linear RNA. Linker ligation and low cycle enrichment were performed according to the protocol for the preparation of kits for the next Ultra RNA library of Illumina. The purified RNA is then used for gene synthesis and sequencing. Cirrnas were determined using CIRI2 and circexplor 2 algorithms. Differentially expressed circRNAs were identified by DESeq2 package (P <0.05 and fold change > 2).

2. RNA extraction, RNase R treatment and quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen). RNase R treatment refers to incubation of 2. mu.g total RNA with 3U/. mu.g RNase R (Virginia technology) for 15 minutes at 37 ℃. Reverse transcription was performed using the PrimeScript RT Master Mix (TaKaRa, Chinese Dalian). The qPCR experiment was performed in ABI 7900HT (applied biosystems, foster city, CA, usa) using the tuberculosis green premix taq (takara). The RT-qPCR primers used in this application are shown below:

3. fluorescence In Situ Hybridization (FISH) and immunofluorescence

Cells and tissues were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 in phosphate buffered saline, and incubated overnight in hybridization buffer containing the circRHBDD1 probe. DAPI was used to stain nuclei. All images were analyzed on a fluorescence microscope (Leica microscopy systems, Inc., Mannheim, Germany). RiboBio designed and synthesized a specific fluorescent in situ hybridization probe.

Immunofluorescence assay cells were fixed in 4% paraformaldehyde solution, permeabilized with 0.5% Triton X-100 in phosphate buffered saline, blocked with 3% bovine serum albumin, and incubated overnight at 4 ℃ with primary antibody against YTHDF 1. The cells were then photographed under a fluorescent microscope (Leica microscopy systems, Inc.) by incubating with a secondary antibody.

4. RNA In Situ Hybridization (ISH)

HCC samples in cohort 2 and corresponding adjacent liver tissues were used for TMA construction. With 3% methanol-H₂O₂After blocking endogenous peroxidase, TMAs were hybridized overnight at 37 ℃ with digoxigenin-labeled circRHBDD1 probe. TMAs were incubated in bovine serum albumin for 30 minutes, and anti-digoxigenin-labeled peroxidase was maintained at 37 ℃ for 40 minutes, followed by staining with diaminobenzidine solution. Images were obtained by microscopy (nikon, japan), with ISH intensity scores defined as follows: 0 (weak), 1 (medium), 2 (strong) and 3 (very strong).

5. Hippocampal metabolic analysis

The extracellular acidification rate (ECAR) and the cellular Oxygen Consumption Rate (OCR) were measured using the hippocampal XF glycolysis stress test kit and hippocampal XF cell mtorr stress test kit (agilent technologies) according to the manufacturer's protocol. Briefly, 1X 10⁴Individual cells/well were seeded into hippocampal XF 96 cell culture plates and then loaded into hippocampal XF 96 extracellular flux analyzers (agilent technologies). ECAR measurements were performed by adding glucose, the oxidative phosphorylation inhibitor oligomycin, and the glycolytic inhibitor 2-deoxyglucose (2-DG) sequentially at the indicated time points. In addition, OCR detection was performed by sequentially injecting oligomycin, the mitochondrial uncoupling agent carbonyl cyanide, and the mitochondrial complex III inhibitor antimycin a and the mitochondrial complex I inhibitor rotenone.

6. Lactate production, cellular glucose-6-phosphate (G6P) and ATP level measurements

Cells were seeded into 96-well cell culture plates and incubated overnight. After 2 hours of starvation, the supernatant was collected and the lactic acid production was determined using an L-lactic acid assay kit (Abcam, Cambridge, UK). Cellular G6P levels were measured using a glucose-6-phosphate fluorescence assay kit (Cayman, Ann Arbor, MI, USA) and ATP levels were determined using an ATP assay kit (Thermo Fisher Scientific, CA, USA) according to the manufacturer's instructions.

7. Analysis of Glutamine, glutamic acid and alpha-KG levels

Cells were plated in 6-well plates for 24 h. Glutamine and glutamate concentrations were determined by a glutamine/glutamate assay kit (Sigma-Aldrich, st.louis, MO, USA) according to the manufacturer's protocol. Applicants tested the alpha-KG level using the alpha-KG assay kit (Abcam) according to the manufacturer's protocol.

8. RNA Immunoprecipitation (RIP) and methylated RNA immunoprecipitation (MeRIP) analysis

RIP detection was performed using a Magna RIP RNA binding protein immunoprecipitation kit (EMD Millipore, Billarica, MA, USA) according to the manufacturer's instructions. Briefly, cells were lysed using RIP lysis buffer containing protease and RNase inhibitor (EMD Millipore). The cell lysates were then incubated overnight at 4 ℃ with antibodies or non-specific IgG antibodies (#12-371, EMD Millipore) against AGO2(ab186733, Abcam), EIF4A3(ab32485, Abcam), Flag (F1804, Sigma-Aldrich), respectively. MeRIP detection was performed using the Magna MeRIP m6A kit (EMD Millipore) according to the manufacturer's protocol. The immunoprecipitated RNA was then isolated and analyzed by RT-qPCR.

9. RNA pull-down analysis

The CircRHBDD1 pull-down assay was performed using the RNA-protein pull-down kit (Thermo Fisher Scientific) according to the manufacturer's protocol. Biotin-labeled sense-antisense probes were designed and synthesized by Ruibo corporation. Briefly, total RNA was incubated with biotin-labeled probes at 70 ℃ for 5 minutes and streptavidin magnetic beads (Invitrogen) were spun down at room temperature for 30 minutes. Unbound RNA was washed away and RNA protein binding buffer was added. And finally obtaining the supernatant used for silver staining, mass spectrometry and western blotting.

Example 1

By circRNA sequencing analysis, the applicant compared the circRNA expression profiles between three pairs of HCC tissues and adjacent liver tissues. The cirri2 and CIRCCexplor 2 algorithms detected 7747 cirRNA candidate genes with 2 or more unique reverse-splicing reads in total. Among them, 5010 genes were noted in circBase. Differentially expressed circRNA was further identified by DESeq2 package.

As shown in fig. 1A and fig. 1B, there were 44 and 65 circrnas up-and down-regulated in HCC tissues, respectively, where 20 matched HCC and peritumoral tissues were randomly selected from cohort 1 and the circrnas at the first 5 positions of up-regulation were verified by RT-qPCR (as shown in fig. 1C). The applicant found that hsa _ circ _0058497 (hereinafter referred to as circRHBDD1) derived from the RHBDD1 gene site showed the most significant upregulation and was selected for further study.

The sequence of hsa _ circ _0058497 is as follows:

GACTTCCTTCGCTGGGCATCTGGCTGGGATTCTTGTTGGACTAATGTACACTCAAGGGCCTCTGAAGAAAATCATGGAAGCATGTGCAGGCGGTTTTTCCTCCAGTGTTGGTTACCCAGGACGGCAATACTACTTTAATAGTTCAGGCAGCTCTGGATATCAGGATTATTATCCGCATGGCAGGCCAGATCACTATGAAGAAGCACCCAGGAACTATGACACGTACACAGCAGGACTGAGTGAAGAAGAACAGCTCGAGAGAGCATTACAAGCCAGCCTCTGGGACCGAG；

and circRHBDD1 at the loop-forming junction is shown in FIG. 15.

Consistent with the results from the HCC tissue samples, the expression level of circRHBDD1 in the liver cell line of a group of liver cancer patients was significantly higher than that of the liver cell line QSG-7701 of normal persons (as shown in FIG. 1D).

Divergent PCR and Sanger sequencing analysis showed that circRHBDD1 was generated from exons 6-8 of the RHBDD1 gene by the reverse splicing machinery (as shown in FIG. 1E). Agarose gel electrophoresis detection showed that the subvergent primers amplified circRHBDD1 in the cDNA, but no product was detected in the gDNA (as shown in fig. 1F and 1G). RT-qPCR using oligo dT containing oligonucleotide primers showed that circRHBDD1 had no poly (A) tail (as shown in FIG. 1H). As shown in FIG. 1I, circRHBDD1 is insensitive to degradation by RNase R, whereas the RHBDD1 product in linear form is susceptible to degradation by RNase R. The stability of circRHBDD1 was tested by treatment with the transcription inhibitor actinomycin D. As shown in fig. 1J and 1K, the results indicate that the circular subtype is more stable than the linear subtype. RNA fluorescence in situ hybridization experiments revealed that circRHBDD1 was distributed mainly in the cytoplasm of HCCLM3 cells (as shown in FIG. 1L). Similarly, isolation experiments showed that circRHBDD1 is located primarily in the cytoplasm, not the nucleus (as shown in fig. 1M and 1N).

To further investigate the clinical value of circRHBDD1 in HCC, applicants next examined the expression of circRHBDD1 in cohort 1 consisting of 96 pairs of HCC tissues and peritumoral specimens. RT-qPCR experiments showed that circRHBDD1 was highly expressed in HCC tissues compared to peritumoral specimens (as shown in figure 2A).

High expression of circRHBDD1 in HCC tissues was further verified by FISH analysis (as shown in figure 2B). Patients in cohort 1 were divided into the circRHBDD1 high and low expression groups based on median expression values. The above 96 HCC samples were analyzed for clinical pathological variables and circRHBDD1 expression levels as follows:

note: AFP is alpha-fetoprotein, TNM is tumor lymph node metastasis, and the bold numbers show that the statistical significance is achieved.

The table above shows: the circRHBDD1 expression level was correlated with tumor number (P ═ 0.013), microvascular infiltration (P ═ 0.002), tumor size (P ═ 0.007), alpha fetoprotein (P ═ 0.014), and tumor lymph node metastasis (TNM) staging (P ═ 0.001).

circRHBDD1 was significantly upregulated in HCC patients with tumors >5cm and TNM stages III-IV (as shown in fig. 2C and 2D). Independent cohort 2 included 160 matched HCC and peritumoral samples and had complete follow-up data for TMA analysis. Using a scoring system based on ISH staining intensity, it was found that circRHBDD1 was expressed at higher levels in tumor specimens than in peritumoral specimens (as shown in FIG. 2E).

To determine the effect of circRHBDD1 on HCC patient prognosis, the applicant performed single and multifactorial survival analyses. kaplan-Meier survival analysis showed that both overall survival and disease-free survival were poor in HCC patients with high expression of circRHBDD1 (as shown in figures 2F and 2H). .

Cox risk regression model analysis was used for the above 96 HCC patients overall survival and disease-free survival as follows:

from the above table and as shown in fig. 2G and 2I: the circRHBDD1 expression level was that affecting overall survival [ risk ratio (HR):1.549, 95% Confidence Interval (CI): 1.046-2.293; p-0.029 ] and disease-free survival (HR:2.388, 95% CI: 1.417-4.024; P-0.001).

Taken together, these results indicate that circRHBDD1 is up-regulated in HCC tissues and cell lines, and that high expression of circRHBDD1 is predictive of poor patient prognosis.

Example 2

To explore the function of circRHBDD1 in HCC, applicants attempted to knock down or highly express circRHBDD1 to observe altered cellular phenotypes in HCC cells. The applicant designed two lentiviruses against the anti-splicing sequence of circRHBDD 1. Knockdown efficiency was tested in two HCC cell lines (HCCLM3 and MHCC97H) using RT-qPCR. As shown in fig. 3A and fig. 3B, sh-circRHBDD1#1 and sh-circRHBDD1#2 significantly inhibited the expression of circRHBDD1, but did not significantly inhibit the expression of RHBDD1 mRNA. A significant decrease in proliferation of HCCLM3 and MHCC97H cells following the knockdown of the circRHBDD1 gene was detected by colony formation experiments (as shown in figure 3C). Cell Counting Kit-8 (CCK-8) experiments show that the liver cancer Cell activity is remarkably inhibited by the silent circRHBDD1 (shown in figure 3D and figure 3E). The inhibition of HCC cells by the circRHBDD1 gene knockdown was confirmed by 5-ethyl-2' -deoxyuridine (EdU) imaging analysis (as shown in figure 3F).

The applicants further utilized lentiviruses to highly express circRHBDD1 in HepG2 and Huh7 cells. As shown in fig. 9A and 9B, specific overexpression of circRHBDD1 in HepG2 and Huh7 cells was verified, while the expression level of linear RHBDD1 was not affected all the time. Consistent with the knockdown experiments, upregulation of circRHBDD1 significantly enhanced the proliferative capacity of hepatoma cells as shown by clonogenic, CCK-8 and EdU assays (as shown in fig. 9C, 9D, 9E and 9F). These results indicate that circRHBDD1 promotes the viability of liver cancer in vitro.

Next, the applicants performed RNA-seq analysis on circRHBDD1 silenced HCCLM3 cells and corresponding control cells (as shown in FIG. 4A). KEGG analysis showed that PI3K-Akt signaling pathway, metabolic pathway, glycolysis/gluconeogenesis, d-glutamine and d-glutamate metabolism were all in the enrichment pathway (as shown in figure 4B), suggesting a role for circRHBDD1 in reprogramming glucose and glutamine metabolism.

The applicants then examined mRNA levels of several key transporters and enzymes of glycolysis and glutamine metabolism, including GLUT1, HK2, ASCT2 and GLS1, in circRHBDD 1-silenced HCCLM3 and MHCC97H cells. As shown in fig. 4C and 4D, circRHBDD1 gene knockdown was associated with decreased mRNA levels of GLUT1, HK2, ASCT2, GLS 1. Furthermore, western blotting assays showed that protein levels of these transporters and enzymes were reduced in circRHBDD 1-knocked-down HCCLM3 and MHCC97H cells (as shown in figure 4E). ECAR data showed that knock-down circRHBDD1 significantly reduced the glycolytic rate and glycolytic capacity of HCCLM3 and MHCC97H cells (as shown in fig. 4F). OCR, an indicator of mitochondrial respiration, was increased in circRHBDD 1-silenced HCCLM3 and MHCC97H cells (shown in fig. 4G). Analysis of glycolysis and glutamine metabolite levels, as shown in figure 4H and figure 4I, the circRHBDD1 knockdown resulted in decreased levels of G6P, lactate, ATP, glutamine, glutamate and α -KG.

Similarly, circRHBDD1, highly expressed in HepG2 and Huh7 cells, resulted in elevated levels of mRNA and protein of transporters and enzymes during glycolysis and glutamine metabolism (as shown in fig. 10A, 10B, 10C). As shown in fig. 10D, elevated EACR was observed in circrhbdd1 highly expressed HCC cells. As shown in figure 10E, both basal and maximal respiration decreased after circRHBDD1 was upregulated according to the results of OCR. As shown in fig. 10F and fig. 10G, overexpression of circRHBDD1 significantly promoted glycolysis and levels of glutamine metabolites.

Example 3

The present applicant constructed PDX models of liver cancer as described previously using NOD/SCID and BALB/c mice. Briefly, tumor tissue from primary liver cancer patients after hepatectomy was retained in frozen medium supplemented with 1% penicillin/streptomycin and cut to approximately 2-3mm in 100. mu.l of 50% matrix (BD Biosciences, San Jose, Calif., USA)³A fragment of (a). Tissue samples were then implanted subcutaneously in the flank of NOD/SCID mice. Transplanted tumors grew to 1-2cm³Are harvested and spliced into serial transplants of BALB/c nude mice. When the volume of the transplanted tumor reaches 50mm³On the left and right, the injection of circRHBDD1 plasmid, cholesterol-conjugated circRHBDD1siRNA or corresponding control was intratumorally administered for 3 weeks. Tumor volume and weight were finally measured and tumors were subjected to RT-qPCR, FISH and Immunohistochemical (IHC) detection as shown in fig. 5A.

The applicant studied the effect of circRHBDD1 on HCC growth using a PDX mouse model using 10 fresh HCC tissues from patients undergoing hepatectomy. The expression level of circRHBDD1 in the transplanted tumors was detected using RT-qPCR. As shown in figure 5B, the expression level of circrhbd 1 was highest in the transplanted tumor from patient 5, while the expression level of circrhbd 1 was lowest in the transplanted tumor from patient 2. Histopathological analysis of transplanted tumors from patients 5 and 2 was performed as shown in fig. 5C. The applicant injected the circRHBDD1 plasmid and the cholesterol-conjugated circRHBDD1siRNA, respectively, into tumor tissue continuously for 3 weeks. As shown in fig. 5D, 5E and 5F, the si-circRHBDD1 treatment group significantly reduced the volume and weight of the graft tumor; in contrast, the transplants injected with the circRHBDD1 plasmid were larger and heavier. Both RT-qPCR and FISH detection were used to find that circRHBDD1 was consistently down-regulated or highly expressed in HCC transplantable tumors (as shown in fig. 5G and 5H). As shown in figure 5I, the applicants found that the expression levels of GLUT1, ASCT2 and Ki-67 were reduced in circRHBDD1 silenced transplants, while the expression levels of GLUT1, ASCT2 and Ki-67 were increased in transplants treated with the circRHBDD1 plasmid, as seen from immunohistochemical results.

Example 4

The applicant has demonstrated in example 2 that after knockdown of circRHBDD1, the PI3K/AKT signaling pathway is one of the enrichment pathways (as shown in figure 4B). Next, the applicant performed a western blotting analysis to verify that the knockdown of circRHBDD1 inhibited the PI3K/AKT signaling pathway (as shown in FIG. 6A). The laboratory and other preliminary studies find that the regulatory subunit PIK3R1 of PI3K is an important upstream molecule of a PI3K/AKT signal pathway in the HCC development process. Applicants wanted to know whether PIK3R1 was affected by circRHBDD 1.

As shown in figure 6B, PIK3R1 protein levels were decreased in circRHBDD 1-silenced HCCLM3 and MHCC97H cells. Immunohistochemical analysis of PDX demonstrated that knockdown of the circRHBDD1 gene was associated with decreased levels of PIK3R1 and p-AKT, while PIK3R1 and p-AKT were elevated in circRHBDD1 highly expressed transplants (as shown in figure 6C). Interestingly, PIK3R1mRNA levels in circRHBDD 1-silenced cells were not altered compared to the control group (as shown in fig. 6D). There was no significant difference in the degradation of PIK3R1 protein following the knockdown of the circrhbd 1 gene (as shown in fig. 6E and 6F). In addition, proteasome inhibitor MG132 and the autophagy inhibitor Chloroquine (CQ) also failed to reverse circRHBDD1 knockdown-induced down-regulation of PIK3R1 protein (as shown in figure 6G).

Based on these results, the applicant hypothesized that circRHBDD1 might enhance expression of PIK3R1 protein through translational control. Thus, the present applicant extracted single/multi-somal fractions from cytoplasmic extracts of sh-circRHBDD1#1 cells and sh-NC HCCLM3 cells using sucrose gradient centrifugation. As shown in fig. 6H, circRHBDD1 knockdown significantly reduced the proportion of PIK3R1mRNA in the multimeric portion, while PIK3R1mRNA had increased presence in the untranslated ribosomal portion.

The applicant then carried out rescue experiments by highly expressing PIK3R1 in circRHBDD 1-silenced HCCLM3 cells, and western blotting demonstrated high expression efficiency (as shown in fig. 11A). CCK-8 and EdU assays indicated that PIK3R1 upregulation could rescue the inhibited cell proliferation in sh-circRHBDD1#1HCCLM3 cells (as shown in FIGS. 11B and 11C). From ECAR and OCR data, glycolysis rate, glycolysis volume, basal respiration and maximal respiratory recovery (as shown in fig. 12A and 12B) were followed by high expression of PIK3R1 in circRHBDD 1-silenced HCCLM3 cells. In circRHBDD 1-silenced cells, upregulation of PIK3R1 inhibited the reduction of glycolysis and glutaminolytic metabolite levels (as shown in fig. 12C and 12D). As shown in figure 12E, expression levels of key transporters and enzymes of glycolysis and glutamine metabolism, as well as p-AKT levels, were restored following up-regulation of PIK3R1 in circRHBDD 1-silenced cells.

Taken together, circRHBDD1 promotes translation of PIK3R1mRNA and is associated with activation of PI3K/AKT signaling in HCC.

Example 5

To understand how circRHBDD1 promotes translation of PIK3R1mRNA, the applicant performed an AGO2-RIP test, which indicated that circRHBDD1 generally failed to function as a microRNA sponge (as shown in fig. 6I). CPAT bioinformatics prediction results showed that circRHBDD1 failed to encode a polypeptide (as shown in figure 6J). Subsequently, the applicants performed RNA pull-down analysis in conjunction with mass spectrometry. As shown in fig. 6K and 6L, YTHDF1 was able to interact with circRHBDD 1. RIP experiments further confirmed the interaction between YTHDF1 and circRHBDD1 (as shown in figure 6M). FISH assay results showed that circRHBDD1 co-localized with YTHDF1 in HCCLM3 cells (as shown in FIG. 6N). Bioinformatic analysis showed that YTHDF1 was up-regulated in HCC tissues compared to peritumoral tissues (as shown in figure 6O) and correlated with poor overall survival in HCC patients (as shown in figure 6P), consistent with previous studies.

The applicant knows that YTHDF1 is a binding protein of m6A and can promote translation of m6A modified mRNA, and the applicant hypothesized that YTHDF1 can enhance translation of PIK3R1 by m6A modification. The results of the REPIC database (as shown in FIG. 7A) indicate the presence of two m6A peaks in PIK3R1 (chr5:68226662 and 68226933, chr5:68298071 and 68298312). The RMV ar and RMBase v2.0 databases also confirm the presence of the RRACH m6A sequence motif in PIK3R 1. Likewise, CLIP and RIP data from the m6A2Target database determined PIK3R1mRNA to be a potential Target on YTHDF1(GSE78030 and GSE63591) exons and 3' UTR sites. By downregulating the expression of YTHDF1 in two HCC cell lines (as shown in figure 7B), applicants found that both PIK3R1 protein expression and m6A levels were significantly reduced (as shown in figures 7C and 7D).

In contrast, ectopic expression of YTHDF1 in HepG2 and Huh7 cell lines resulted in a significant increase in PIK3R1 protein expression and m6A levels (as shown in fig. 7E, 7F and 7G). RT-qPCR analysis showed that high expression of YTHDF1 had no effect on PIK3R1mRNA levels (as shown in fig. 7H). Highly expressed YTHDF1 significantly increased the presence of PIK3R1mRNA in the multimeric fraction (as shown in fig. 7I). Furthermore, the introduction of YTHDF1 abolished the inhibitory effect of circRHBDD1 gene knock-down on PIK3R1 protein expression levels (as shown in fig. 7J), but had no effect on PIK3R1mRNA expression (as shown in fig. 7K).

To elucidate whether the upregulation of PIK3R1 mediated by YTHDF1 was dependent on m6A modification, the applicant generated a marker mutant, YTHDF1 construct (YTHDF1-mut) with two point mutations (K395A and Y397A), which, as previously studied, abolished its ability to bind to m 6A. After successful transfection of HepG2 and Huh7 cells with the YTHDF 1-broad (YTHDF1-wt) and YTHDF1-mut recombinant plasmids, the applicants found that elevated protein expression of PIK3R1 in YTHDF1-wt was abolished in YTHDF1-mut transfected HCC cells (as shown in FIG. 7L). However, PIK3R1mRNA levels between YTHDF1-WT and YTHDF1-Mut were comparable (as shown in FIG. 7M). RIP experimental results showed that ectopic expression of YTHDF1-mut significantly disrupted the interaction of PIK3R1mRNA with YTHDF1 (as shown in FIG. 7N).

Taken together, circRHBDD1 interacted with YTHDF1 to increase translation of PIK3R1mRNA in an m6 a-dependent manner.

To map the region of interaction of circRHBDD1 with YTHDF1, the applicant constructed three non-overlapping biotinylated RNA fragments (P1: 1-100 nt; P2: 101-290 nt; P3: 201-290nt) as shown in FIG. 13A. After incubation of each biotinylated RNA with cell lysates, the applicant performed pull-down experiments followed by YTHDF1 western blotting analysis. As shown in fig. 13B, applicants observed specific binding of YTHDF1 to P1. The applicants then used the full length and two truncation structures labelled YTHDF1 to determine which domain of YTHDF1 is required for binding of YTHDF1 to circRHBDD 1. (YTHDF 1-N: N terminal, 1-359 aa; YTHDF 1-C: C terminal, also known as YTH domain, 360559 aa). RIP detection showed that the N-terminus of YTHDF1 mediated its interaction with circRHBDD1 (as shown in fig. 13C and 13D).

Example 6

RNA binding proteins can bind to flanking intron sequences of the circular RNA and mediate the production of the circular RNA. To investigate the upstream regulatory factor of circRHBDD1 in HCC, applicants searched the CircInteractome database and found three EIF4A3 binding sites flanking the circRHBDD1, sites a, b and c, respectively (as shown in figure 8A). TCGA data showed that EIF4A3 was up-regulated in HCC and high expression of EIF4A3 was associated with poor overall survival (as shown in fig. 8B and 8C).

It has been shown that EIF4A3, a key component of the exon junction complex, promotes the expression of several circular RNAs. Correlation analysis showed that the circRHBDD1 level was positively correlated with EIF4A3 expression level (as shown in figure 8D). To elucidate the effect of EIF4A3 on circRHBDD1 expression, the applicant used two sirnas in HCCLM3 and MHCC97H cells to knock down EIF4A3 expression (as shown in fig. 8E and 8F). As shown in fig. 8G, circRHBDD1 levels were significantly reduced following EIF4a3 gene knockdown. Similarly, overexpression of EIF4a3 resulted in elevated expression levels of circRHBDD1 in HepG2 and Huh7 cells (as shown in fig. 8H, 8I, and 8J). In contrast, mRNA and protein levels of EIF4A3 were unchanged in circRHBDD 1-silenced cells (as shown in fig. 14A and 14B). As can be seen in fig. 8K, EIF4a3 can bind to the flanking sequence through two upstream binding sites (sites a and b), but cannot bind to the flanking sequence through a downstream site (site c). Mutations at positions a and b inhibited the reduction in the expression level of circRHBDD1 in EIF4a 3-silenced cells (as shown in fig. 8L). These results indicate that EIF4a3 may induce the generation of circRHBDD1 through binding sites a and b. In the present application, the applicants demonstrate that EIF4a3 mediated upregulation of circRHBDD1 can interact with YTHDF1 to promote translation of PIK3R1 in an m6a dependent manner, thereby activating the PI3K/AKT signaling pathway to promote glycolysis and glutaminolysis in HCC.

Thanks to the rapid development and application of high-throughput sequencing technologies, emerging studies have discovered abnormal expression patterns of circular RNAs in different human cancers. However, the role of circular RNA in the metabolism and reprogramming of HCC cells is not clear. The applicant discloses in the present application that RHBDD 1-derived cyclic RNA is involved in alterations in glucose and glutamine metabolism in liver cancer in HCC cells.

The applicant demonstrated high expression of circRHBDD1 in HCC tissues and correlation with adverse clinical pathology using two independent HCC cohorts. Single and multifactorial survival analyses showed that high expression of circRHBDD1 was an independent predictor of overall survival and disease-free survival in HCC patients.

More importantly, the applicants found that circRHBDD1 promotes the translation of PIK3R1mRNA in a m6a dependent manner, thereby enhancing glycolysis and glutaminolysis. Meanwhile, EIF4A3 is involved in biogenesis of circRHBDD 1. The applicant found that: circRHBDD1 regulated HCC metabolic reprogramming via m6A modification of PIK3R1 and underscored its value as a prognostic predictor in HCC patients.

Cancer cells tend to accumulate metabolic changes to obtain the necessary nutrients to promote growth and survival. Glucose and amino acid metabolism are often taken up by tumor cells to maintain viability and establish new biological viability. New evidence has suggested a regulatory role for circular RNAs in cancer cell glycolysis and glutamine metabolism. As in colorectal cancer, circACC1 regulates glycolysis by promoting the enzymatic activity of AMPK holoenzyme. For example, CircHMGCS1 promotes hepatoblastoma cell proliferation, apoptosis and glutamine metabolism by acting as a microRNA sponge.

The results of RNA-seq and pathway enrichment analysis in this application indicate that circRHBDD1 may be involved in glucose and glutamine metabolic changes in HCC. Using loss of function and gain of function analysis, applicants examined the effect of circRHBDD1 on levels of ECAR, OCR and several key transporters, enzymes and metabolites in glycolysis and glutaminolysis.

The results show that: circRHBDD1 is closely related to the enhancement of glycolysis and glutaminolysis in hepatoma cells. Reviewing the main morphological and genetic characteristics of the original tumor, the PDX model provides a powerful resource for assessing the in vivo efficacy of new therapeutic strategies. In agreement with the results of the in vitro experiments, the applicant constructed a PDX mouse model and verified the tumorigenic effect of circRHBDD1 in vivo.

The PI3K/AKT signaling pathway regulates a variety of metabolic processes in cancer, playing a central role in regulating glucose and glutamine metabolism. PIK3R1, acting as a regulatory subunit of PI3K, activates the PI3K/AKT signaling pathway, accelerating the processes of glycolysis and glutaminolysis. In breast cancer, mir-155 mediated PIK3R1 up-regulates glycometabolism via the FOXO3a/cMYC axis pathway. PIK3R1 has also been reported to promote glutamine dissolution and to promote gastric cancer progression. The application demonstrates that circRHBDD1 activates the PI3K/AKT signal via PIK3R 1. Upregulation of CircRHBDD1 resulted in elevated levels of PIK3R1 protein, whereas downregulation of CircRHBDD1 resulted in the opposite outcome. No significant change was seen in PIK3R1mRNA after overexpression or knock-down of circRHBDD 1. MG132 or CQ treatment failed to reverse the decrease in PIK3R1 protein levels in circRHBDD 1-silenced HCC cells, indicating that circRHBDD1 did not affect the degradation of PIK3R1 protein. Various analyses showed that circRHBDD1 may control the expression of PIK3R1 protein by affecting the translation process.

m6A is involved in many biological processes as the most abundant posttranscriptional mRNA modification. The dynamically reversible m6A modification is bound by m6A methyltransferase (writer), recognized by m6A binding protein (reader), and removed by demethylase (eraser). m6A is involved in almost every aspect of the RNA life cycle, including mRNA translation, splicing and stabilization.

To elucidate how circRHBDD1 regulates the translation of PIK3R1, the applicant performed RNA pull-down analysis followed by mass spectrometry, and YTHDF1 demonstrated an interaction with circRHBDD 1. YTHDF1, as a m6A reading protein, recognized the m6A site and facilitated targeted mRNA translation.

It was reported that YTHDF1 enhanced the translation of EIF3C in an m6a dependent manner, thereby promoting tumorigenesis and metastasis of ovarian cancer. Binding of YTHDF1 to m6a modified TRIM29 was involved in translation of TRIM29 in cisplatin-resistant ovarian cancer cells. FZD7 translation in gastric cancer was controlled by YTHDF 1. The application, combined with 4 bioinformatics databases and meip analysis, found that YTHDF1 promoted translation of PIK3R1mRNA by m6A modification. Loss of function of the YTH domain blocks the ability of YTHDF1 to bind to m6 a. The application found that YTHDF1-mut interrupted the interaction of PIK3R1mRNA with YTHDF1 and abolished the elevated expression level of PIK3R1 protein in HCC cells. Whether other m6A authors and erasers were involved in the interaction between YTHDF1 and PIK3R1 required further investigation.

RNA binding proteins have been proposed as trans-factors to play a role in the regulation of circular RNA biogenesis. It has been reported that QKI can enhance the formation of circular RNA by binding to introns flanking circular RNA-forming exons and bring the circular exons closer together. Splicing factors (including EIF4a3, FUS, HNRNPL, RBM20 and Mbl) have been found to regulate the production of circRNA in different biological environments. The present application found that EIF4a3 can bind to the upstream region of the RHBDD1 pre-mRNA transcript, regulating the expression of circRHBDD 1. Upregulation of circRHBDD1 in HCC was likely associated with eif4a 3-mediated exon reverse splicing.

In summary, the applicant demonstrated that expression of the cyclic RNA RHBDD1(circRHBDD1) up-regulates glycolysis and glutaminolysis in liver cancer and independently predicts the survival outcome of patients. In vivo experiments in a patient-derived xenograft (PDX) mouse model demonstrated the tumor-promoting effect of circRHBDD1 mechanistically, circRHBDD1 interacts directly with YTHDF1, promoting N6-methyladenosine (m6A) modification of PIK3R1mRNA, accelerating translation of PIK3R1, and activating PI3K/AKT signaling pathway. In addition, EIF4a3 can induce upregulation of circRHBDD1 expression in liver cancer. The application provides better insight for understanding the role of the circular RNA in the metabolic reprogramming of liver cancer.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.

Sequence listing

<110> Wannan medical college first subsidiary hospital (Wannan medical college Yijishan hospital)

Application of <120> circRHBDD1 in preparation of drug for treating hepatocellular carcinoma

<130> 2020

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 290

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

gacttccttc gctgggcatc tggctgggat tcttgttgga ctaatgtaca ctcaagggcc 60

tctgaagaaa atcatggaag catgtgcagg cggtttttcc tccagtgttg gttacccagg 120

acggcaatac tactttaata gttcaggcag ctctggatat caggattatt atccgcatgg 180

caggccagat cactatgaag aagcacccag gaactatgac acgtacacag caggactgag 240

tgaagaagaa cagctcgaga gagcattaca agccagcctc tgggaccgag 290

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ccaggaacta tgacacgtac acag 24

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

agcgaaggaa gtcctcggt 19

Claims (4)

1. The application of circular RNA in preparing a medicine for treating hepatocellular carcinoma is characterized in that the circular RNA is named as hsa _ circ _0058497, and the nucleic acid sequence of the circular RNA is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein the therapeutic agent for hepatocellular carcinoma has at least the following effects:

inhibit glycolysis and glutaminolysis of hepatoma cells, and/or inhibit the translational expression of PIK3R 1.

3. Use of the circular RNA of claim 1 for the preparation of a prognostic agent for the assessment of hepatocellular carcinoma.

4. The use according to claim 3, wherein the circular RNA of claim 1 is used as a biomarker.

Images