CN103305596A - Application and related pharmaceuticals of human ubiquitin-protein ligase 138 (RNF138) gene - Google Patents
Application and related pharmaceuticals of human ubiquitin-protein ligase 138 (RNF138) gene Download PDFInfo
- Publication number
- CN103305596A CN103305596A CN2012100665434A CN201210066543A CN103305596A CN 103305596 A CN103305596 A CN 103305596A CN 2012100665434 A CN2012100665434 A CN 2012100665434A CN 201210066543 A CN201210066543 A CN 201210066543A CN 103305596 A CN103305596 A CN 103305596A
- Authority
- CN
- China
- Prior art keywords
- rnf138
- gene
- people
- sequence
- plko
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses an application related pharmaceuticals of a human ubiquitin-protein ligase 138 (RNF138) gene and particularly discloses an application of the human RNF138 gene in tumor treatment and pharmaceutical preparation. The invention further structures an oligonucleotide molecule, a human RNF138 gene interference lentiviral vector and a human RNF138 gene interference lentivirus for human RNF138 gene separation and discloses applications thereof. The oligonucleotide molecule or the lentiviral vector and the lentivirus containing an oligonucleotide molecule sequence provided by the invention can specifically inhibit the human RNF138 gene expression, and particularly, the lentivirus can efficiently infect target cells, effectively inhibit the RNF138 gene expression of the target cells, further inhibit the tumor cell growth, promote the tumor cell apoptosis and have an important meaning on tumor treatment.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people RNF138 gene.
Background technology
Ring finger protein is the zinc finger protein that a class contains the ring structure territory, the ring structure territory is an a kind of zinc fingers that is comprised of 40-60 amino acid, it can be in conjunction with two zinc atom (Saurin AJ, Borden KL, BoddyMN, et al.Does this have a familiar RNG.Trends Biochem Sci 1996,21:208-214.Freemont PS The RNG finger Anovel protein sequence motif related to the zinc finger.Ann N Y Acad Sci, 1993,684:174-192.Borden KL, Freemont PS.The RNG finger domain:a recent example of a sequence-structure family.Curr Opin Struct Biol, 1996,6:395-401).This structural domain may participate in the interaction between albumen and the albumen, and it usually participates in the albumen of intracellular false folding and has finished the degradation process of the albumen of its mission.This process is important quality control process in the cell, for extremely important (the Hatakeyama S of keeping of cell homeostasis, Nakayama KI.Ubiquitylation as a quality control system for intracellular proteins.J Biochem, 2003,134:1-8).
The ring finger protein family member participates in the regulation and control of various cells widely, such as growth, carcinogenic mechanism, apoptosis and the virus replication etc. of tissue.The ring finger protein family member is huge, and these albumen almost can be expressed in each tissue of the mankind, organ.Up to now, have above hundreds of ring finger proteins and be found, be distributed in widely in the plant and animal body (Borden KL.Ring domains:master builders of molecular scaffolds J Mol Biol 2000,295:1103-1112).
RNF138 is a member of ring finger protein family, also is called the relevant ring finger protein (Nemo-like (NLK)-associated ring finger protein, NARF) of Nemo sample kinases.It contains 245 amino-acid residues, has the active (Yamada of ubiquitin ligase that finger ring relies on, M., Ohnishi, J., Ohkawara, B., et al.NARF, an Nemo-like Kinase (NLK)-associated Ring Finger Protein Regulates the Ubiquitylation and Degradation of T Cell Factor/Lymphoid Enhancer Factor (TCF/LEF) .J Biol Chem 2006,281,20749-20760).RNF138 albumen and the acting in conjunction of Nemo sample kinases are by reducing the TCF/LEF transcriptional activity, the degraded of targeting proteins enzyme mediation to examining the poly-ubiquitin of interior transcription factor (TCF/LEF).Therefore, RNF138 regulates Wnt/ β-catenin signal path (Tucker W.A as a kind of negative regulatory factor, Christopher W, William S.B.The E3 ubiquition ligase NARF promotes colony formation in vitro and exhibits enhanced expression levels in glioblastoma multiforme in vivo.American J Undergraduate research 2010,9:23-30).The Wnt signal transduction pathway comprises: extracellular factor (Wnt), transmembrane receptor (Ffizzled, Fz), cytoplasmic protein (Dsh, β-catenin/APC/Axin complex body etc.) and nuclear in transcription factor (TCF/LEF), with the genesis of kinds of tumors closely related (Bienz M, Clevers H.Linking colorectal cancerto Wnt signaling.Cell 2000; 103:311-20), and typical Wnt signal path can promote growth (the Barker N.The canonical Wnt/beta-catenin signaling pathway.Methods Mol Biol 2008 of tumour cell, 468:5-15.Gavert N, Ben-Zeve A.Beta-Catenin signaling in biological control and cancer.J Cell Biochem 2007,102 (4): 820-828)
At present existing research is found, in the Hela cell, cross and express ectogenic RNF138 gene, Cell clonality is strengthened, but the mechanism of action of RNF138 is still waiting further research (Tucker W.A, Christopher W, William S.B.The E3ubiquition ligase NARF promotes colony formation in vitro and exhibits enhanced expression levels in glioblastoma multiforme in vivo.American J Undergraduate research 2010,9:23-30).And in glioma parent cell (GBM), detect overexpression (the Marqareto J of RNF138 gene, Lesi O, Larrarte E, et al.Gene expression profiling ofhuman gliomas reveals differences between GBM and LGA related to energy metabolism and notch signaling pathways.J Mol Neurosci, 2007,32 (1): 53-63), these results show that the RNF138 gene plays very important effect in the carcinogenesis of human of tumour cell division and tumour.
Slow virus (lentivirus) carrier is efficient gene transfer instrument, is mainly used in infecting the cell lower to the ordinary method transfection efficiency, such as primary cell etc.The slow virus particle is the cell of infection development and non-propagation simultaneously, and infects more stable, lasting.Use lentiviral vectors, can realize the high expression level of specific gene, also can express hairpin RNA (short hairpin RNA, shRNA) and disturb (RNA interference, RNAi) mode to reduce the expression of certain gene with RNA.RNAi is the sequence-specific PTGS phenomenon of utilizing double chain RNA mediate, become a kind of emerging effective means of research gene function, and be expected to become instrument (the Izquierdo M.Short interfering RNAs a tool for cancer gene therapy.Cancer Gene Ther.2005 of the disease gene treatments such as tumour; 12 (3): 217-27.).The present invention intends adopting the function of RNAi technical study RNF138 gene in the tumour cell malignant proliferation of lentivirus mediated, for the non-operation clinical treatment of malignant tumour provides theoretical foundation.
Summary of the invention
The methods for the treatment of and the medicine that the object of the invention is to open and people RNF138 (ring finger protein 138) gene-correlation.
In order to further investigate the regulatory function of people RNF138 gene in tumour occurs, it is model that the present invention chooses human pancreas cancer Panc-1 cell, take the RNA interference as means research people RNF138 gene in the survival of above-mentioned tumour cell and the effect in the apoptosis destiny.
First aspect present invention, disclose the people RNF138 gene that will separate for the preparation of or the purposes of screening anti-tumor medicine.
The people RNF138 gene that separates for the preparation of or the screening anti-tumor medicine comprise the content of two aspects: one is applied to prepare anti-tumor medicine or preparation as medicine or preparation for the action target of tumour cell with people RNF138 gene; Its two, people RNF138 gene is applied to screen anti-tumor medicine or preparation as medicine or preparation for the action target of tumour cell.
Describedly people RNF138 gene is applied to prepare anti-tumor medicine as medicine or preparation for the action target of tumour cell or preparation specifically refers to: with the target of people RNF138 gene as the RNA interference effect, develop medicine or preparation for tumour cell, thereby can reduce the expression level of RNF138 gene in the tumour cell.
Describedly people RNF138 gene is applied to screen anti-tumor medicine as medicine or preparation for the action target of tumour cell or preparation specifically refers to: with people RNF138 gene as effective object, medicine or preparation are screened, to find the medicine that can suppress or promote RNF138 genetic expression as the oncotherapy drug candidate.Namely screening obtains people RNF138 gene small molecules interference RNA (siRNA) take people RNF138 gene as effective object as described in the present invention, can be used as the medicine with inhibition tumor cell proliferation function.In addition, such as antibody drug, small-molecule drug etc. also can be with RNF138 gene and albumen thereof as effective object.
Any tumour that described tumour is can be for the propagation of its tumour cell relevant with the expression of people RNF138 gene further, is a kind of malignant tumour, for example carcinoma of the pancreas.
Described anti-tumor medicine is specificity to suppress transcribing or translating of people RNF138 gene, or can specificity suppress the expression of people RNF138 gene protein or the molecule of activity.Thereby described anti-tumor medicine can reduce propagation, growth, propagation, differentiation and/or the survival of the expression level inhibition tumor cell of people RNF138 gene in the tumour cell.
The described anti-tumor medicine that obtains by people RNF138 gene preparation or the screening of separation comprises: nucleic acid, carbohydrate, lipid, small molecules, polypeptide or albumen.
Described nucleic acid comprises: siRNA (esiRNA) or the short hairpin RNA (shRNA) of antisense oligonucleotide, double-stranded RNA (dsRNA), ribozyme, endoribonuclease III preparation.
Described double-stranded RNA, ribozyme, esiRNA or shRNA contain the promoter sequence of people RNF138 gene or the information sequence of people RNF138 gene.
Further, described double-stranded RNA is siRNA (siRNA).Described siRNA comprises positive-sense strand and antisense strand, and described positive-sense strand and described antisense strand are complementary, jointly form the RNA dimer, and the transcription product of target sequence is complementary in described antisense strand and the people RNF138 gene.The coded mRNA fragment of described siRNA energy specific binding target sequence, and the expression of the reticent people RNF138 of specificity gene.
Described shRNA can be through vector expression, expresses after being cloned into lentiviral vectors such as the dna fragmentation with transcribed this shRNA.
The amount of application of described anti-tumor medicine perhaps enough reduces people RNF138 protein expression or active dosage for enough reducing transcribing or translating of people RNF138 gene.So that the expression of people RNF138 gene is lowered 50%, 80%, 90%, 95% or 99% at least.
Adopting the method for aforementioned anti-tumor medicine treatment tumour, mainly is the purpose that the propagation of the expression level inhibition tumor cell by reducing people RNF138 gene reaches treatment.Concrete, during treatment, can effectively reduce the administering substances of people RNF138 gene expression dose in the patient.
Second aspect present invention discloses a kind of oligonucleotide molecules that reduces the separation of people RNF138 genetic expression in the tumour cell, and described oligonucleotide molecules comprises:
A) double-stranded RNA, containing in the described double-stranded RNA can be under stringent condition and the nucleotide sequence of people RNF138 gene recombination; Perhaps
B) shRNA, containing among the described shRNA can be under stringent condition and the nucleotide sequence of people RNF138 gene recombination.
Further, described double-stranded RNA comprises positive-sense strand and antisense strand, and described positive-sense strand and described antisense strand are complementary, and the transcription product of target sequence is complementary in described antisense strand and the people RNF138 gene.
Further, the length of described positive-sense strand and antisense strand is 15-27 Nucleotide; Better, length is 19-23 Nucleotide; Best, length is 19,20 or 21 Nucleotide.
Further, described double-stranded RNA is siRNA (siRNA).
Further, the sequence of described siRNA is shown in SEQ ID NO:22-23.SiRNA shown in the SEQ ID NO:22-23 can play the effect of endogenous RNF138 genetic expression in the reticent tumour cell of specificity for disturb the siRNA for people RNF138 gene of target sequence design take the sequence shown in the SEQ ID NO:8 as RNA.
Further, described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, the sequence of described positive-sense strand fragment and described antisense strand fragment is complementary, and the transcription product sequence of target sequence is complementary in the sequence of described antisense strand fragment and the people RNF138 gene.Described shRNA can become siRNA (siRNA) and then play the effect of endogenous people RNF138 genetic expression in the reticent tumour cell of specificity after enzyme is cut.
Further, the sequence of the loop-stem structure of described shRNA can be selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of described shRNA contains the sequence shown in the SEQ ID NO:14, is specially: CACUGUAACAGUAAUCACCUAUUCAAGAGAUAGGUGAUUACUGUUACAGUG.
When the target sequence in the described people RNF138 gene is described small molecules interference RNA and is used for the reticent people RNF138 of specificity genetic expression, with the fragment in the corresponding people RNF138 of the mRNA fragment gene of the complementary combination of described small molecules interference RNA.
Further, described people RNF138 gene disturbs target sequence, is any sequence among the SEQ ID NO:1-13.
ShRNA can become siRNA after enzyme is cut processing, and then plays the effect of endogenous people RNF138 genetic expression in the reticent tumour cell of specificity.
The oligonucleotide molecules of described separation can be used for preparing the medicine of prevention or treatment tumour, and described tumour is carcinoma of the pancreas.
When as the treatment medicine of tumour or preparation, be that double-stranded RNA or the shRNA with safe and effective amount is applied to Mammals.Concrete dosage also should be considered the factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Third aspect present invention discloses a kind of people RNF138 gene and has disturbed lentiviral vectors, for containing the lentiviral vectors of the aforementioned shRNA gene fragment of encoding, and can express described shRNA.
It is that dna fragmentation with the aforementioned people RNF138 gene shRNA of coding is cloned into known carrier and obtains that this people RNF138 gene disturbs lentiviral vectors, described carrier mostly is lentiviral vectors, after described people RNF138 gene disturbs lentiviral vectors to become infectious virion through the virus packing, infected tumor's cell, and then transcribe out described shRNA.
The dna sequence dna of the described people RNF138 gene shRNA gene fragment of encoding contains arbitrary sequence and the complementary sequence thereof among the SEQ ID NO:1-13.
Further, described people RNF138 gene disturbs lentiviral vectors also to contain the nucleotide sequence of the marker that can be detected in promoter sequence and/or the codes for tumor cell; More excellent, the described marker that is detected such as green fluorescent protein (GFP).
Further, described lentiviral vectors can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
The people RNF138 gene that the embodiment of the invention has specifically been enumerated take pGCSIL-GFP as vector construction disturbs lentiviral vectors, called after pGCSIL-GFP-siRNF138.
People RNF138 gene siRNA of the present invention can be used for the propagation of inhibition tumor cell, further can be as medicine or the preparation for the treatment of tumour.People RNF138 gene disturbs lentiviral vectors then to can be used for preparing described people RNF138 gene siRNA.When as the treatment medicine of tumour or preparation, be that the people RNF138 gene siRNA with safe and effective amount is applied to Mammals.Concrete dosage also should be considered the factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Fourth aspect present invention discloses a kind of people RNF138 gene and has disturbed slow virus, disturbs lentiviral vectors lower assisting of slow virus packaging plasmid, clone by aforementioned people RNF138 gene, forms through the virus packing.But this slow virus infected tumor cell also produces people RNF138 gene small molecules interference RNA, thereby suppresses the propagation of pancreatic tumour cell.
This people RNF138 gene disturbs slow virus to can be used for preparing the medicine of prevention or treatment tumour.Further, described tumour is selected from carcinoma of the pancreas.
Fifth aspect present invention also discloses a kind of pharmaceutical composition for prevention or treatment tumour, and the oligonucleotide molecules or the people RNF138 gene that contain aforesaid separation in the described pharmaceutical composition disturb slow virus.
Except containing the siRNA or slow virus that treats significant quantity, also contain pharmaceutically acceptable carrier or vehicle in the described pharmaceutical composition.
In preparation during these compositions, usually with activeconstituents and mixed with excipients, or with the vehicle dilution, wrap in can capsule or the carrier that exists of anther sac form in.Do the time spent when vehicle plays thinner, it can be that solid, semisolid or fluent material are as the medium of vehicle, carrier or activeconstituents.Therefore, composition can be tablet, pill, pulvis, solution, syrup, sterilizing injecting solution etc.The example of suitable vehicle comprises: lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, Microcrystalline Cellulose, polyvinylpyrrolidone, Mierocrystalline cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, sanitas (such as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
The invention also discloses the application of described pharmaceutical composition in the anti-tumor medicine of preparation treatment carcinoma of the pancreas.
When described pharmaceutical composition is used for prevention or treatment target in-vivo tumour, the described pharmaceutical composition of effective dose can be applied in the object.
Adopt the method, the growth of described tumour, propagation, recurrence and/or shift suppressed.Further, at least 10% of the growth of described tumour, propagation, recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% part is suppressed.
Sixth aspect present invention, the RNA that discloses a kind of people RNF138 gene of separation disturbs target sequence, is any sequence among the SEQ ID NO:1-13.
The RNA of the people RNF138 gene of described separation disturbs target sequence, can be applicable to screening and preparation for the siRNA of people RNF138 gene.
The RNA that the invention also discloses a kind of people RNF138 gene disturbs the application of target sequence in the anti-tumor medicine of preparation treatment carcinoma of the pancreas.
Seventh aspect present invention discloses a kind of test kit for reducing the RNF138 genetic expression in the tumour cell, and described test kit comprises: the oligonucleotide molecules or the described RNF138 gene that are present in the described separation in the container disturb slow virus.
In sum, the present invention has designed 13 RNAi target sequences for people RNF138 gene, make up corresponding RNF138 RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-siRNF138 for target sequence SEQ ID NO:8 can significantly descend mediator RNF138 gene in the expression of mRNA level and protein level.Use slow virus (lentivirus, be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-siRNF138 as the genetic manipulation instrument and can will efficiently import for the RNAi sequence of RNF138 gene human pancreas cancer Panc-1 cell in target ground, reduce the expression level of RNF138 gene, significantly suppress the multiplication capacity of above-mentioned tumour cell.Therefore the people RNF138 gene silencing of lentivirus mediated is the potential clinical non-operative treatment mode of malignant tumour.
SiRNA provided by the invention or the lentiviral vectors, slow virus that carry this siRNA can specificity suppress the expression of people RNF138 gene, especially slow virus, can efficiently infect target cell, suppress expeditiously the expression of RNF138 gene in the target cell, and then the growth of inhibition pancreatic tumour cell, promote the pancreatic tumour apoptosis, significant in the pancreatic tumour treatment.
Description of drawings
Fig. 1 pGCSIL-GFP plasmid DNA collection of illustrative plates
Fig. 2 siRNF138-Lentivirus slow virus was infected human pancreas cancer Panc-1 cell after 5 days, and the expression level of RNF138mRNA significantly reduces.
Fig. 3 represents that the siRNF138-Lentivirus slow virus infects human pancreas cancer Panc-1 cell after 5 days, significantly suppresses cell proliferation.
Embodiment
The present invention is based on the research that ring finger protein may be relevant with propagation, resistance and the transfer etc. of tumour cell, think that RNF138 may participate in generation and the development of malignant tumour as a kind of newfound ring finger protein.
The present invention relates to one group of small molecules interference RNA for people RNF138 gene (siRNA) sequence, rna interference vector and RNA and disturb slow virus.Choose people RNF138mRNA coding region sequence as the target site of siRNA, according to the individual base sequence design of 10-30 continuous in the target site (preferred 15-27, more preferably 19-23) siRNA target sequence.By gene clone, the lentiviral vectors of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the reticent human tumor cells of specificity in the expression of endogenous RNF138 gene.
The contriver finds, adopts after the expression of mediator RNF138 gene under the RNAi method the effectively propagation of inhibition tumor cell, and this achievement in research shows that the RNF138 gene is proto-oncogene, can be used as the target spot of oncotherapy.The contriver further synthesizes and has tested multiple siRNA for the RNF138 gene, but has filtered out the siRNA of establishment RNF138 expression and then inhibition human pancreas cancer Panc-1 cell proliferation and growth, has finished on this basis the present invention.
The invention provides siRNA (siRNA) sequence of a series of interference people RNF138 genes, but made up the slow virus of the reticent RNF138 genetic expression of specificity.The present invention studies discovery, for siRNA and the RNAi slow virus of people RNF138 gene design, stablizes the expression of also reducing specifically the RNF138 gene, and effectively suppresses the propagation of human tumor cells.The present invention shows that the RNF138 gene can promote growth of tumour cell, is expected to become the target spot of early diagnosis of tumor and treatment.And, by the expression of the reticent RNF138 gene of RNAi mode, can be used as the effective means that suppresses tumor development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people RNF138 gene RNAi slow virus: transfer people RNF138 gene order from Genbank; Prediction siRNA site; Synthetic effective siRNA sequence for the RNF138 gene, two ends contain the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected the RNAi plasmid of construction expression RNF138 gene siRNA sequence behind the lentiviral vectors double digestion with double-stranded DNA Oligo; RNAi plasmid and slow virus are packed assistant carrier (Pa cking Mix, Sigma-aldrich company) the cotransfection HEKC 293T that needs, the recombinant RNA i slow virus particle of packaging expression RNF138 gene.Slow virus particle in the collecting cell culture supernatant, purifying is concentrated, namely makes slow virus (siRNF 138-Lentivirus) pure, stably express RNF138siRNA.
Based on aforesaid method, the invention provides 13 Effective target sites (specifically shown in SEQ ID NO 1-13) that disturb the RNF138 gene, made up the slow virus of special interference people RNF138 gene.
Simultaneously the present invention also discloses a kind of people RNF138 gene RNAi slow virus (RNF138-RNAi) and preparation and application thereof.
This research is found, utilizes the RNAi method of lentivirus mediated, after reducing the expression of RNF138 gene in tumour cell, and propagation that can the establishment tumour cell.Originally studies show that, the RNF138 gene is a proto-oncogene, can promote tumor cell proliferation, in occuring and develop, tumour has important biological function, the RNF138 gene can be the target of oncotherapy, and the RNF138 gene specific silence of lentivirus mediated can be used as a kind of new tool of oncotherapy.
Further set forth the present invention below in conjunction with embodiment.Should be understood that embodiment only is used for explanation the present invention, but not limit the scope of the invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared prescription is according to normal condition among the embodiment, such as works such as [U.S.] SambrookJ; Huang Peitang etc. translate.The molecular cloning test guide, the third edition.Beijing: the condition of the condition described in the Science Press 2002 or manufacturers's suggestion is carried out or is configured.
Embodiment 1: for the preparation of people RNF138 gene RNAi slow virus
1. screening is for the effective siRNA target spot of people RNF138 gene
From Genbank, choose the coding region sequence of people RNF138 (NM 016271) gene, every the sequence of 21 bases of an initial acquisition of base; Utilize the design software of Shanghai JiKai Gene Chemical Technology Co., Ltd, take people RNF138mRNA sequence as template, determine 13 effective siRNA target sequences (SEQ ID NO:1-13), as shown in table 1:
Table 1 target is in the siRNA target sequence of people RNF138 gene
The double-stranded DNA Oligo sequence (seeing Table 2) that contains Age I and EcoR I restriction enzyme site cohesive end for the synthetic two ends of siRNA target spot (take SEQ ID NO:8 as example); (Shanghai JiKai Gene Chemical Technology Co., Ltd provides to act on the pGCSIL-GFP carrier with Age I and EcoR I restriction enzyme, Fig. 1), (reaction system is as shown in table 4,37 ℃ to make its linearizing, reaction 1h), agarose gel electrophoresis is identified endonuclease bamhi.
Table 2 two ends contain the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
(it is as shown in table 4 that enzyme is cut system with the double digestion linearizing by the T4DNA ligase enzyme, 37 ℃, reaction 1h) the double-stranded DNA Oligo that carrier DNA is connected with purifying connects, and spends the night in 16 ℃ of connections in suitable buffer system (linked system is as shown in table 5), reclaims to connect product.
Transform fresh competent escherichia coli cell (the conversion operation reference: molecular cloning experiment guide second edition 55-56 page or leaf) that calcium chloride prepares with connecting product.Grow bacterium clone surface at the connection converted product and be stained with, be dissolved in 10 μ l LB substratum, mixing is got 1 μ l as template; The upstream and downstream of RNAi sequence in lentiviral vectors, design universal PC R primer upstream primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:15); Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:16) carries out PCR identification experiment (the PCR reaction system is such as table 6-1, and amplification condition is shown in table 6-2).PCR is identified that positive clone checks order and compare of analysis, compares correct clone and is the RNAi carrier for the target sequence shown in the SEQ ID NO:8 that successfully constructs, called after pGC SIL-GFP-siRNF 138.
Make up pGCSIL-GFP-control negative control plasmid, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO:17).When making up pGCSIL-GFP-control negative control plasmid, contain the double-stranded DNA Oligo sequence (table 3) of Age I and EcoR I restriction enzyme site cohesive end for the synthetic two ends of Scr (scramble) siRNA target spot, its carrier construction method, authentication method and condition be same pGCSIL-GFP-siRNF138 all.
Table 3 two ends contain the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
Table 5 carrier DNA and double-stranded DNA Oligo ligation system
Table 6-1PCR reaction system
Table 6-2PCR reaction amplification condition
2. pack the siRNF138-Lentivirus slow virus
Extract the RNAi plasmid pGCSIL-GFP-siRNF138 of previous step preparation with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.
24h before the transfection with the HEKC 293T cell of tryptic digestion logarithmic phase, adjusts cell density as 1.5 * 10 take the DMEM perfect medium that contains 10% foetal calf serum
5Cell/ml is inoculated in 6 orifice plates, and 37 ℃, 5%CO
2Cultivate in the incubator.Treat to can be used for when cell density reaches 70%-80% transfection.2h before the transfection, the original substratum of sucking-off adds the fresh perfect medium of 1.5ml.Explanation according to the MISSION Lentiviral Packaging Mix test kit of Sigma-aldrich company, in a sterilization centrifuge tube, add Packing Mix (PVM) 20 μ l, PEI 12 μ l, serum-free DMEM substratum 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed solution.
Above-mentioned transfection miscellany is at room temperature hatched 15min, be transferred in the substratum of HEKC 293T cell, 37 ℃, 5%CO
2Cultivate 16h in the incubator.Discard the developing medium that contains the transfection miscellany, the PBS solution washing adds perfect medium 2ml, continues to cultivate 48h.The collecting cell supernatant liquor, Centricon Plus-20 centrifugal ultrafiltration device (Millipore) purifying and concentrated slow virus, step is as follows: (1) 4 ℃, the centrifugal 10min of 4000g removes cell debris; (2) 0.45 μ m filter filtering supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, and 10-15min is to the concentrated volume of the virus that needs; (4) after the centrifugal end, filtering cup and following filtered solution collection cups are separated, filtering cup is tipped upside down on the sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from the sample collection cup, be viral concentrated solution in the sample collection cup.With after the viral concentrated solution packing in-80 degrees centigrade of preservations.The siRNA sequence that contains in the virus concentrated solution is SEQ ID NO:22-23.
The wrapping process of contrast slow virus only replaces the pGCSIL-GFP-siRNF138 carrier with pGCSIL-GFP-control negative control plasmid with the wrapping process of pGCSIL-GFP-siRNF138 lentiviral vectors.
Embodiment 2: the real-time fluorescence quantitative RT-PCR method detects the silence efficiency of RNF138 gene
The human pancreas cancer Panc-1 cell that will be in logarithmic phase carries out trysinization, and (cell count is about 5 * 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach approximately 30%.According to infecting plural number (the MOI value is 10) value, add the slow virus of embodiment 1 preparation of sufficient quantity, replaced medium behind the cultivation 24h, after time of infection reaches 5 days, collecting cell.According to the Trizol process specifications of Invitrogen company, extracted total RNA.According to the M-MLV process specifications of Promega company, the RNA reverse transcription is obtained cDNA (the reverse transcription reaction system sees Table 7), 42 ℃ of reaction 1h, then water-bath 10min makes the reversed transcriptive enzyme inactivation in 70 ℃ of water-baths.
Adopting TP800 type Real time PCR instrument (TAKARA) to carry out real-time quantitative detects.The primer of RNF138 gene is as follows: upstream primer 5 '-ATGTCCTATTTGTGTGTCTCTTCC-3 ' (SEQ ID NO:18) and downstream primer 5 '-GCAGTTTGGTATTGGGTTTCTTC-3 ' (SEQ ID NO:19).Take house-keeping gene GAPDH as confidential reference items, primer sequence is as follows: upstream primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:20) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:21).Press the proportional arrangement reaction system in the table 8.
Table 7 reverse transcription reaction system
Table 8Real-time PCR reaction system
Setting program is two-step approach Real-time PCR: 95 ℃ of denaturations, 15s; Afterwards each circulation is: 95 ℃ of sex change, 5s; Annealing is extended 60 ℃, 30s; Totally 45 circulations.Read light absorption value in the extension stage at every turn.After PCR finished, then 95 ℃ of sex change 1min were cooled to 55 ℃, make the abundant combination of dna double chain.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 4s, reads simultaneously light absorption value, makes melting curve.Adopt 2-
Δ Δ CtAnalytical method is calculated the gene expression abundance that has infected RNF138mRNA.With the cell that infects contrast virus (control) relatively, the result as shown in Figure 2, the RNF138mRNA expression level of human pancreas cancer Panc-1 cell has descended 55.1% in the experimental group.
Embodiment 3: the multiplication capacity that detects the tumour cell that infects the siRNF138-Lentivims slow virus
The human pancreas cancer Panc-1 cell that is in logarithmic phase carries out trysinization, and (cell count is about 5 * 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach approximately 30%.According to infecting plural number (the MOI value is 10), add the virus of sufficient quantity, replaced medium behind the cultivation 24h after time of infection reaches 5 days, is collected each the experimental group cell that is in logarithmic phase.The resuspended one-tenth cell suspension (2 * 10 of perfect medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Every group 5 multiple holes, every hole 100 μ l.After completing plate, put 37 ℃, 5%CO
2Incubator is cultivated.From second day behind the bed board, detect with Cellomics instrument (Thermo Fisher) and read plate once every day, and continuous detecting was read plate 5 days.By adjusting the input parameter of Cellomics arrayscan, calculate exactly the quantity with the cell of green fluorescence in each scanning orifice plate, data are added up drawing, draw cell proliferation curve (result is as shown in Figure 3).
The result shows, the siRNF138-Lentivirus slow virus is infected each tumour of group after cells in vitro is cultivated 5 days, rate of propagation significantly slows down, rate of propagation far below the control group tumour cell, the vigor cell number has descended 62.5%, shows that the RNF138 gene silencing causes the tumor cell proliferation ability suppressed.
Claims (17)
1. the purposes of the people RNF138 gene that separates in the anti-tumor medicine of preparation or screening carcinoma of the pancreas.
2. oligonucleotide molecules that reduces the separation of people RNF138 genetic expression in the tumour cell, described oligonucleotide molecules comprises:
A) double-stranded RNA, containing in the described double-stranded RNA can be under stringent condition and the nucleotide sequence of people RNF138 gene recombination; Perhaps
B) shRNA, containing among the described shRNA can be under stringent condition and the nucleotide sequence of people RNF138 gene recombination.
3. the oligonucleotide molecules of separation as claimed in claim 2 is characterized in that, described double-stranded RNA comprises positive-sense strand and antisense strand, and described positive-sense strand and described antisense strand are complementary, and the transcription product of target sequence is complementary in described antisense strand and the people RNF138 gene; Described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, the sequence of described positive-sense strand fragment and described antisense strand fragment is complementary, and the transcription product sequence of target sequence is complementary in the sequence of described antisense strand fragment and the people RNF138 gene.
4. the oligonucleotide molecules of separation as claimed in claim 3 is characterized in that, the sequence of described loop-stem structure is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
5. such as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that, described people RNF138 gene disturbs target sequence, is any sequence among the SEQ ID NO:1-13.
6. such as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that, described double-stranded RNA is siRNA, and the sequence of this siRNA is shown in SEQ ID NO:22-23.
7. such as the oligonucleotide molecules of the described separation of the arbitrary claim of claim 2-4, it is characterized in that, the sequence of described shRNA contains SEQ ID NO:14.
8. a people RNF138 gene disturbs lentiviral vectors, for the lentiviral vectors of the gene fragment of the shRNA in the oligonucleotide molecules that contains the described separation of the coding arbitrary claim of claim 2-7, can express described shRNA.
9. lentiviral vectors as claimed in claim 8 is characterized in that, described lentiviral vectors also contains the nucleotide sequence of the marker that can be detected in the codes for tumor cell.
10. lentiviral vectors as claimed in claim 9 is characterized in that, the described marker that is detected is green fluorescent protein.
11. lentiviral vectors as claimed in claim 8, it is characterized in that, described lentiviral vectors is selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-lammshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
12. a people RNF138 gene disturbs slow virus, and is lower assisting of slow virus packaging plasmid, clone by the described lentiviral vectors of the arbitrary claim of claim 9-11, forms through the virus packing.
13. a pharmaceutical composition that is used for prevention or treatment tumour, the oligonucleotide molecules or the described people RNF138 of claim 12 gene that contain in the described pharmaceutical composition just like arbitrary described separation among the claim 2-7 disturb slow virus.
14. the application of the described pharmaceutical composition of claim 13 in the anti-tumor medicine of preparation treatment carcinoma of the pancreas.
15. the RNA of the people RNF138 gene of a separation disturbs target sequence, is any sequence among the SEQ ID NO:1-13.
16. the RNA of the described people RNF138 of claim 15 gene disturbs the application of target sequence in the anti-tumor medicine of preparation treatment carcinoma of the pancreas.
17. test kit for reducing the people RNF138 genetic expression in the tumour cell, it is characterized in that, described test kit comprises: be present in the container, according to claim 2-7 in the oligonucleotide molecules of arbitrary described separation or the described people RNF138 of claim 12 gene disturb slow virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210066543.4A CN103305596B (en) | 2012-03-14 | 2012-03-14 | The purposes and its related drugs of people's RNF138 genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210066543.4A CN103305596B (en) | 2012-03-14 | 2012-03-14 | The purposes and its related drugs of people's RNF138 genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103305596A true CN103305596A (en) | 2013-09-18 |
| CN103305596B CN103305596B (en) | 2018-08-07 |
Family
ID=49131313
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210066543.4A Active CN103305596B (en) | 2012-03-14 | 2012-03-14 | The purposes and its related drugs of people's RNF138 genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103305596B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109420171A (en) * | 2017-08-28 | 2019-03-05 | 中国医学科学院基础医学研究所 | Purposes of the RNF2 in treatment virus infection or the relevant diseases associated with inflammation of virus infection |
| CN111647565A (en) * | 2020-05-26 | 2020-09-11 | 中国医学科学院基础医学研究所 | Preparation method and application of anti-RNF 138 monoclonal antibody |
| CN112301131A (en) * | 2020-11-13 | 2021-02-02 | 中国医学科学院基础医学研究所 | Application of RNF138 as biomarker for predicting sensitivity of colorectal cancer to SC75741 treatment |
-
2012
- 2012-03-14 CN CN201210066543.4A patent/CN103305596B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| JANGHOO LIM ET AL: "A Protein–Protein Interaction Network for Human Inherited Ataxias and Disorders of Purkinje Cell Degeneration", 《CELL》 * |
| YOU-XIN ZHOU ET AL: "A novel gene RNF138 expressed in human gliomas and its function in the glioma cell line U251", 《ANALYTICAL CELLULAR PATHOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109420171A (en) * | 2017-08-28 | 2019-03-05 | 中国医学科学院基础医学研究所 | Purposes of the RNF2 in treatment virus infection or the relevant diseases associated with inflammation of virus infection |
| CN111647565A (en) * | 2020-05-26 | 2020-09-11 | 中国医学科学院基础医学研究所 | Preparation method and application of anti-RNF 138 monoclonal antibody |
| CN112301131A (en) * | 2020-11-13 | 2021-02-02 | 中国医学科学院基础医学研究所 | Application of RNF138 as biomarker for predicting sensitivity of colorectal cancer to SC75741 treatment |
| CN112301131B (en) * | 2020-11-13 | 2021-10-26 | 中国医学科学院基础医学研究所 | Application of RNF138 as biomarker for predicting sensitivity of colorectal cancer to SC75741 treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103305596B (en) | 2018-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN103305596A (en) | Application and related pharmaceuticals of human ubiquitin-protein ligase 138 (RNF138) gene | |
| CN105586391A (en) | Application of human GTPBP4 gene and related drugs of human GTPBP4 gene | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
| CN103667430A (en) | Application and relevant medicament of nucleotide octamer binding protein expression gene | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103667422A (en) | Use and related medicament of human CUL4B gene | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN110938630B (en) | Application of human B3GNT5 gene and related products | |
| CN102534003B (en) | The purposes of people PBX1 gene and related drugs thereof | |
| CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN104225619A (en) | Application of human ILK gene in curing tumors and related drugs | |
| CN103667431A (en) | Applications and human related drugs of CCCH-type zinc finger protein expression gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200529 Address after: 201203 room 101-A, 328 Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI GENECHEM TECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |