WO2013086639A1

WO2013086639A1 - Mutations indicative of weaver syndrome

Info

Publication number: WO2013086639A1
Application number: PCT/CA2012/050902
Authority: WO
Inventors: William T. GIBSON; Steven J. M. JONES
Original assignee: British Columbia Cancer Agency Branch; The University Of British Columbia
Priority date: 2011-12-14
Filing date: 2012-12-14
Publication date: 2013-06-20

Abstract

A method for diagnosing Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject is provided. The method includes, in part, obtaining sequence information for a subject, and identifying one or more mutations within the EZH2 gene.

Description

MUTATIONS INDICATIVE OF WEAVER SYNDROME

FIELD

[0001] The present disclosure relates generally to gene mutations. More specifically, the present disclosure relates to gene mutations that are correlated with Weaver syndrome.

BACKGROUND

[0002] Weaver syndrome is a rare congenital anomaly syndrome that can result in generalized overgrowth, advanced bone age, marked macrocephaly, developmental delay, intellectual disability, hypertelorism and characteristic facial features (1). Limb anomalies in human subjects with Weaver syndrome are, in general, relatively mild. In most cases, Weaver syndrome will be associated with developmental delay and/or intellectual disability. Weaver syndrome generally occurs as a sporadic condition, although cases of parent-to- child transmission have been documented (2,3).

[0003] The cause of Weaver syndrome is unknown as are the genes involved. In addition, there are many conditions and genetic syndromes which may cause excessive growth. For example, with classic Sotos syndrome, a rare genetic disorder characterized by excessive physical growth during the first 2 to 3 years of life, the nuclear receptor binding SET domain 1 (NSD1) gene is mutated or deleted in most patients. Some patients with Weaver syndrome have been shown to also have mutations in the NSD1 gene. Some patients with Weaver syndrome have been reported to develop tumours or malignancies, including acute lymphoblastic leukemia (29). The lifetime risk of malignancy in Weaver syndrome patients has been estimated to be about 11 %.

[0004] The enhancer of zeste homologue 2 (EZ 2) protein partners with suppressor of zeste 12 homolog (SUZ12) and embryonic ectoderm development (EED) proteins to form the polycomb repressive complex (PRC2). The PRC2 complex catalyses the methylation of lysine 27 of histone H3 (H3K27), and can add one, two or three methyl groups to this lysine residue. EZH2 itself forms the catalytic subunit for this reaction. Thus, EZH2 forms a key component of molecular machinery that shuts off transcription of loci to which trimethylated H3K27 is bound. The methylation of lysine residues on histones is often associated with either the activation or repression of transcription. Furthermore, histone methylation participates in a wide array of cellular processes and has been found, in some cases, to be associated with cancer. Mutations that affect histone methylation may also confer a stronger selective advantage for cell growth (41). Thus, mutations in EZH2 may result to some degree in an increase and/or decrease in the activity of enzymes controlling H3K27 methylation, chromosome inactivation and result in altered cell growth and/or cell death (39).

[0005] In some instances, EZH2 has been shown to be somatically mutated in lymphoid and myeloid cancers (9, 27, 28). A mutation of the histidine 694 residue to arginine of EZH2 (with functional effects) has been reported in a 41 year-old male with chronic myelomonocytic leukemia (27). Furthermore, mutations in nearby residues at positions 690 and 693 were also reported in other hematological malignancies (27, 40). Mutation of the histidine residue that occupies a similar position in SUV39H1 has been shown to have abolished SUV39H1 's methyltransferase activity in an in vitro assay (26). Mutation of tyrosine at position 641 may alter the affinity of EZH2 for H3K27 (9). Residues other than tyrosine at position 641 may reduce the preference for unmethylated and monomethylated lysine, favoring trimethylation of lysine (9).

[0006] Animal studies have yielded insights into the specific role of mouse EZH2 in organ systems other than the hemopoietic system. For example, EZH2 appears to regulate proximodistal axis elongation and anteroposterior axis specification in developing mouse limbs (31). Mice with targeted knockout of EZH2 in beta cells demonstrated reduced beta cell proliferation and beta cell mass (32). Mice with targeted knockout of EZH2 in satellite cells demonstrated impaired regeneration of muscle (33).

[0007] Direct protein-protein interactions between EZH2 and NSD1 have not been demonstrated.

SUMMARY

[0008] The present disclosure provides, in part, methods and reagents for diagnosing Weaver syndrome.

[0009] In one embodiment, the present disclosure provides a method of diagnosing

Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject, by providing a test sample including an EZH2 nucleic acid molecule from the subject;

assaying the test sample for at least one mutation in the EZH2 nucleic acid molecule; and detecting at least one rare, non-conservative mutation in the EZH2 nucleic acid molecule, where the presence of at least one detected mutation in the EZH2 nucleic acid molecule is diagnostic for Weaver syndrome or a genetic predisposition for developing Weaver syndrome in the subject. [0010] In alternative embodiments, the present disclosure provides a method of screening a subject for risk of Weaver syndrome by providing a test sample comprising an EZH2 nucleic acid molecule from the subject; detecting the presence or absence of at least one rare, non-conservative mutation in the EZH2 nucleic acid molecule in the test sample; and determining that the subject is at an increased risk of Weaver syndrome due to the presence of the detected mutation in the EZH2 nucleic acid molecule.

[0011] The detected mutation may be a de novo mutation or a nonsynonymous mutation. The detected mutation may be selected from one or more of the group consisting of: a deletion of at least three or more bases wherein the deletion includes nucleotides 457 to 459 of the coding region of the EZH2 gene or a homologous region thereof; a deletion of a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the coding region of the EZH2 gene or a homologous region thereof and the deletion is at about amino acid 153; a missense variant in a knot substructure of the active site of the coding region of the EZH2 gene or a homologous region thereof; a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide; a substitution of a HIS amino acid with a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 694 or a homologous region thereof; a missense variant at about nucleotide 394 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a PRO amino acid with a SER amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 132 or a homologous region thereof; a missense variant at about nucleotide 398 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a TYR amino acid with a CYS amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 133 or a homologous region thereof; a modification of an amino acid involved in histone methylation activity; a deletion of three bases at positions 457-459 of SEQ ID NO: 2; a deletion of one amino acid at position 153 of SEQ ID NO: 3; a substitution of one nucleotide at position 2080 of SEQ ID NO: 2; a substitution of one amino acid at position 694 of SEQ ID NO: 3; a substitution of one nucleotide at position 394 of SEQ ID NO: 2; a substitution of one amino acid at position 132 of SEQ ID NO: 3; a substitution of one nucleotide at position 398 of SEQ ID NO: 2; or a substitution of one amino acid at position 133 of SEQ ID NO: 3. The detected mutation may be in the SET domain or may be adjacent to the SANT domain of an EZH2 polypeptide, or may be in exon 5 or exon 18 of the EZH2 gene.

[0012] The test sample may include genomic DNA, chromosomal DNA, or the EZH2 gene or fragment thereof. Assaying the test sample may include amplifying all or a fragment of the EZH2 nucleic acid molecule sequence to produce an amplification product. The amplification product may be analyzed to detect the presence of a mutation in the EZH2 nucleic acid molecule sequence. Analyzing the amplification product may include sequencing the amplification product. The amplification product may be digested with a restriction enzyme and the resulting restriction fragment sequenced.

[0013] The detecting may include direct sequence analysis. The detecting may include detecting the rare, non-conservative mutation in at least one genomic copy of the EZH2 gene and/or may include detecting whether the subject is homozygous for the detected mutation and/or may include detecting whether the subject is heterozygous for the detected mutation.

[0014] The subject may be a human.

[0015] In alternative embodiments, the present disclosure provides a kit for diagnosing Weaver syndrome, where the kit includes an oligonucleotide that specifically hybridizes to or adjacent to a site of mutation of an EZH2 gene, and instructions for use. The site of mutation may be selected from one or more of the group consisting of: a deletion of at least three or more bases wherein the deletion includes nucleotides 457 to 459 of the coding region of the EZH2 gene or a homologous region thereof; a deletion of a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the coding region of the EZH2 gene or a homologous region thereof and the deletion is at about amino acid 153; a missense variant in a knot substructure of the active site of the coding region of the EZH2 gene or a homologous region thereof; a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide; a substitution of a HIS amino acid with a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 694 or a homologous region thereof; a missense variant at about nucleotide 394 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a PRO amino acid with a SER amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 132 or a homologous region thereof; a missense variant at about nucleotide 398 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a TYR amino acid with a CYS amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 133 or a homologous region thereof; a modification of an amino acid involved in histone methylation activity; a deletion of three bases at positions 457-459 of SEQ ID NO: 2; a deletion of one amino acid at position 153 of SEQ ID NO: 3; a substitution of one nucleotide at position 2080 of SEQ ID NO: 2; a substitution of one amino acid at position 694 of SEQ ID NO: 3; a substitution of one nucleotide at position 394 of SEQ ID NO: 2; a substitution of one amino acid at position 132 of SEQ ID NO: 3; a substitution of one nucleotide at position 398 of SEQ ID NO: 2; and a substitution of one amino acid at position 133 of SEQ ID NO: 3.

[0016] The kit may include at least one oligonucleotide comprising the site of mutation. The kit may include a first oligonucleotide primer comprising at least fifteen (15) oligonucleotides of SEQ ID NOs: 1 or 2 and a second oligonucleotide primer comprising at least fifteen (15) oligonucleotides of a sequence complementary to SEQ ID NOs: 1 or 2. The kit may include an oligonucleotide primer pair as set forth in Table 3. The kit may further include comprising an oligonucleotide that specifically hybridizes to or adjacent to a site of mutation of an NSD1 gene and instructions for use, for example, the kit may include an oligonucleotide primer pair as set forth in Table 2.

[0017] In alternative embodiments, the present disclosure provides a method of diagnosing Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject, by providing a test sample comprising an EZH2 polypeptide from the subject; assaying the test sample for at least one mutation in the EZH2 polypeptide; and detecting at least one mutation in the EZH2 polypeptide, where the detected mutation affects the function of an EZH2 polypeptide, and where the presence of at least one detected mutation in the EZH2 polypeptide is diagnostic for Weaver syndrome or a genetic predisposition for developing Weaver syndrome in the subject.

[0018] The mutation may be of an amino acid involved in histone methylation activity.

The mutated EZH2 polypeptide may have altered methylation activity compared to a basal level of activity of an EZH2 polypeptide of SEQ ID NO:3. The mutation in the EZH2 polypeptide may be selected from one or more of the group consisting of: a deletion of a TYR amino acid at about amino acid 153; a substitution of a HIS amino acid at about amino acid 694; a substitution of a PRO amino acid at about amino acid 132; a substitution of a TYR amino acid at about amino acid 133; a deletion of one amino acid at position 153 of SEQ ID NO: 3; a substitution of one amino acid at position 694 of SEQ ID NO: 3; a substitution of one amino acid at position 132 of SEQ ID NO: 3; and a substitution of one amino acid at position 133 of SEQ ID NO: 3.

[0019] The assaying of the test sample may include a histone methylation assay.

The detecting may include detecting methylation activity. The detecting may include an antibody that specifically binds the site of mutation. The subject may be a human.

[0020] In alternative embodiments, the present disclosure provides a kit for diagnosing Weaver syndrome, including an antibody that specifically recognizes a mutation in an EZH2 polypeptide that correlates to Weaver syndrome; and instructions for use.

[0021] In alternative embodiments, the present disclosure provides an isolated EZH2 polypeptide variant, or an isolated nucleic acid encoding the isolated EZH2 polypeptide variant, comprising a mutation correlated to Weaver syndrome, where the mutation is selected from one or more of the group consisting of: a deletion of at least three or more bases wherein the deletion includes nucleotides 457 to 459 of the coding region of the EZH2 gene or a homologous region thereof; a deletion of a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the coding region of the EZH2 gene or a homologous region thereof and the deletion is at about amino acid 153; a missense variant in a knot substructure of the active site of the coding region of the EZH2 gene or a homologous region thereof; a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide; a substitution of a HIS amino acid with a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 694 or a homologous region thereof; a missense variant at about nucleotide 394 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a PRO amino acid with a SER amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 132 or a homologous region thereof; a missense variant at about nucleotide 398 of the coding region of the EZH2 gene or a homologous region thereof; a substitution of a TYR amino acid with a CYS amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 133 or a homologous region thereof; a modification of an amino acid involved in histone methylation activity; a deletion of three bases at positions 457-459 of SEQ ID NO: 2; a deletion of one amino acid at position 153 of SEQ ID NO: 3; a substitution of one nucleotide at position 2080 of SEQ ID NO: 2; a substitution of one amino acid at position 694 of SEQ ID NO: 3; a substitution of one nucleotide at position 394 of SEQ ID NO: 2; a substitution of one amino acid at position 132 of SEQ ID NO: 3; a substitution of one nucleotide at position 398 of SEQ ID NO: 2; and a substitution of one amino acid at position 133 of SEQ ID NO: 3.

[0022] In alternative embodiments, the present disclosure provides a host cell, including an expression vector, wherein the vector includes a nucleic acid molecule operably linked to an expression control sequence, where the nucleic acid molecule encodes an isolated EZH2 polypeptide variant as described herein.

[0023] In alternative embodiments, the present disclosure provides a method of treating a subject diagnosed with Weaver syndrome or at risk for Weaver syndrome, by administering an effective amount of methionine, S-Adenosyl-L-methionine, S-adenosyl-L- homocysteine, betaine, choline, or combinations thereof to the subject, where the subject has a mutation in an EZH2 polypeptide and where the mutation affects methylation activity.

[0024] In alternative embodiments, the present disclosure provides a method of treating a subject diagnosed with Weaver syndrome or at risk for Weaver syndrome, by administering an effective amount of an agent that modulates the activity of a mutated EZH2 polypeptide to the subject, where the subject has a mutation in the EZH2 nucleic acid molecule that encodes a mutated EZH2 polypeptide. The subject may be a human.

[0025] In alternative embodiments, the present disclosure provides a method for screening for a candidate compound for treating Weaver syndrome, by providing a mutated EZH2 polypeptide, or a nucleic acid molecule encoding the mutated EZH2 polypeptide, wherein the mutation correlates to Weaver syndrome; contacting the mutated EZH2 polypeptide, or the nucleic acid molecule encoding the mutated EZH2 polypeptide, with a test compound; determining whether the test compound specifically binds the site of mutation or modulates the activity of the mutated EZH2 polypeptide, when compared to the binding or activity of a wild type EZH2 polypeptide, where the test compound is a candidate compound for treating Weaver syndrome if the test compound specifically binds the site of mutation or exhibits an altered activity when compared to the wild type EZH2 polypeptide. [0026] The test compound may be an antisense oligonucleotide or siRNA, an antibody or fragment thereof. The test compound may increase the activity of the EZH2 polypeptide.

[0027] In alternative embodiments, the present disclosure provides a use of the isolated EZH2 polypeptide variant, or an isolated nucleic acid encoding the isolated EZH2 polypeptide variant, as described herein, for diagnosis of Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject in need thereof.

[0028] In another aspect, the present disclosure provides a method of detecting

Weaver syndrome or a propensity toward a condition of Weaver syndrome by assessing a biological sample for a mutation, in a nucleotide sequence of a protein coding region of the EZH2 gene, where the presence of a mutation is indicative of a propensity toward a diagnosis of Weaver syndrome.

[0029] In some aspects, mutations in the nucleotide sequence of the protein coding region of EZH2 are causative of Weaver syndrome.

[0030] In some aspects of the invention, the mutation may include a Proline to Serine substitution at amino acid 132 in the EZH2 protein.

[0031] In some aspects of the invention, the mutation may include a Histidine to

Tyrosine substitution at amino acid 694 in the EZH2 protein.

[0032] In some aspects of the invention, the mutation may include a deletion of the amino acid Tyrosine at amino acid 153 in EZH2 protein.

[0033] In some aspects of the invention, the mutation may include a Tyrosine to

Cysteine substitution at amino acid 133 in the EZH2 protein.

[0034] In a further embodiment, there is provided a method for identifying genetic markers that are causative of Weaver syndrome or a propensity toward a condition of Weaver syndrome using DNA-based diagnostic techniques.

[0035] In a further embodiment, there is provided a method for validating the functional effects of coding variants in the EZH2 protein, where theoretical doubt exists regarding the likelihood that such variants cause the Weaver syndrome phenotype

(collectively termed "coding variants of unknown significance").

[0036] In a further embodiment, there is provided a method of selecting a therapeutic regimen for subjects having Weaver syndrome or a propensity toward a condition of Weaver syndrome. The therapeutic regimen may include one or more of the following: providing the patients with a methyl-donating compound. In some aspects, the methyl-donating compound may be methionine, S-Adenosylmethionine, S-adenosylhomocysteine, betaine or choline.

[0037] Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.

[0039] Fig. 1 shows the nucleotide sequence for EZH2, NCBI Reference Sequence:

Nm_004456.4 (Homo sapiens enhancer of zeste homolog 2 (Drosophila) (EZH2), transcript variant 1 , mRNA), SEQ ID NO: 1.

[0040] Fig. 2 shows the nucleotide sequence for the protein coding region of EZH2, corresponding to nucleotides 194...2449 of NCBI Reference Sequence: Nm_004456.4 (Fig. 1), SEQ ID NO:2.

[0041] Fig. 3 shows the amino acid sequence of EZH2, NCBI Reference Sequence

NP_004447.2, related to nucleotide NCBI Reference Sequence: NM_004456.4, SEQ ID NO:3.

[0042] Figs. 4A-F show the exonic coding sequence (cDNA) of the EZH2 gene with partial flanking regions of noncoding intronic genomic DNA sequence aligned alongside the amino acid sequence of the EZH2 protein (SEQ ID NO:3). A: Exons 2-4 with partial flanking regions (SEQ ID NOs: 4-6); B: Exons 5-7 with partial flanking regions (SEQ ID NOs: 7-9); C: Exons 8-10 with partial flanking regions (SEQ ID NOs: 10-12); D: Exons 11-14 with partial flanking regions (SEQ ID NOs: 13-16); E: Exons 15-17 with partial flanking regions (SEQ ID NOs: 17-19); F: Exons 18-20 with partial flanking regions (SEQ ID NOs: 20-22). The binding sites of PCR primer pairs used to amplify each exon prior to sequencing are underlined and further listed in Table 3. The coding sequence begins with the ATG start codon. Protein-coding (exonic) sequences are shown in upper case, bold type; noncoding (intronic) sequences are shown in upper case, italic type. Amino acid residues are numbered and shown in bold type. The DNA sequence is written in a 5'-to-3' direction.

[0043] Figs. 5A-C illustrates the results of Sanger confirmation of the de novo nature of the EZH2 mutations seen in Weaver syndrome. (A) The c.457_459del mutation in Proband 1 (curly bracket) is de novo, (B) The c.2080C>T mutation in Proband 2 (arrow) is de novo, and (C) The c.394C>T mutation in Proband 3 (arrow) is de novo. None of the mutations are present in the fathers (open squares) or mothers (open circles) of the probands (filled squares and filled circles).

[0044] Fig. 6 illustrates a schematic diagram of the human EZH2 gene, with specific domains of the protein indicated. Coding exons are indicated by filled rectangles, non-coding exons are by open rectangles. Exons are numbered starting from the exon containing the 5' UTR. The putative SANT DNA-binding domain is shown in dark grey, the SET domain in black, and the WD-binding domain in textured grey. The SMART of Pfam domain identifier is presented in parentheses. Exons with no InterPro annotations are indicated in grey.

[0045] Fig. 7 shows a ribbon model of the EZH2 SET Domain, bound to S- adenosylmethionine cofactor.

[0046] Fig. 8 shows a linearized plot of incorporation of tritiated methyl groups into core histones by G9a methylase (positive methylation control), wild-type EZH2 protein pre- assembled into the PRC2 complex (WT: normal activity control) and by three mutant forms of EZH2 also pre-assembled into the PRC2 complex.

[0047] Figs. 9A-D show linearized plots of methylation activity of wild-type EZH2 (A) and Weaver syndrome-associated EZH2 mutants (B-D) preassembled into PRC2 complexes on peptide substrate 1-13(21-44). "meO" refers to the addition of the first methyl group on to the unmethylated peptide, "me1" refers to the conversion of monomethylated 1-13(21-44) to dimethylated 1-13(21-44) and "me2" refers to the conversion of dimethylated 1-13(21-44) to a trimethylated state. Results from experiments performed in triplicate.

[0048] Figs. 10A-D shows linearized plots of methylation activity of wild-type EZH2

(A) and mutant EZH2 proteins from patients with leukemia (B-D). "meO" refers to the addition of the first methyl group on to the unmethylated peptide, "me1" refers to the conversion of monomethylated 1-13(21-44) to dimethylated 1-13(21-44) and "me2" refers to the conversion of dimethylated 1-13(21-44) to a trimethylated state.

[0049] Figs. 11 A-E shows linearized plots of methylation activity of wild-type EZH2

(A) and other EZH2 mutations (B-E). "meO" refers to the addition of the first methyl group on to the unmethylated peptide, "me1" refers to the conversion of monomethylated 1-13(21-44) to dimethylated 1-13(21-44) and "me2" refers to the conversion of dimethylated 1-13(21-44) to a trimethylated state. Results from experiments performed in duplicate. DETAILED DESCRIPTION

[0050] The present disclosure provides, in part, methods and reagents for diagnosing

Weaver syndrome or a genetic predisposition for developing Weaver syndrome. In particular, the present disclosure describes the correlation between intellectual disability (such as that found in patients with Weaver syndrome) and EZH2, thus providing a molecular tool for diagnosis of Weaver syndrome. In some embodiments, the present disclosure thus provides a method for distinguishing Weaver syndrome from other phenotypically-related diseases or disorders.

[0051] In some embodiments, identification of the causative disease gene

association for Weaver syndrome enables improved detection of Weaver syndrome which in turn, may lead to improved treatment and prevention of Weaver syndrome. Furthermore, identification of the disease gene association for Weaver syndrome may decrease the cost and improve the efficiency of genomic scans for diagnosing a condition of Weaver syndrome. In general, a definitive diagnosis can prevent the expense and discomfort of further diagnostic testing, which is particularly beneficial when invasive tests such as muscle biopsies or lumbar punctures are avoided. In general, a diagnosis can also provide information on a patient's prognosis over the long term, and can enable family planning, reproductive counselling about recurrence risk, and prenatal diagnosis for individuals at risk to have an affected child (such as individuals who carry the mutation in the mosaic or fully heterozygous states). In general, a correct diagnosis of Weaver syndrome can also enable appropriate medical and supportive interventions such as special education classes, and drug therapy.

[0052] In some embodiments, the methods and reagents disclosed herein are useful for identification or diagnosis of a subject who is at an early, pre-symptomatic stage of Weaver syndrome. In alternative embodiments, the methods and reagents disclosed herein may be useful for confirmation of the Weaver syndrome in subjects presenting with specific signs or symptoms of Weaver syndrome. In alternative embodiments, the methods and reagents disclosed herein may be useful for identification of a subject with a genetic predisposition to Weaver syndrome, for example a subject with a family history of Weaver syndrome or features of Weaver syndrome in a relative who is deceased or otherwise unavailable.

[0053] In alternative embodiments, the methods and reagents disclosed herein may be useful for screening a subject with clinical features of Sotos syndrome but without any identified mutation or deletion of the NSD1 gene, for example to determine whether the diagnosis of Sotos syndrome should be replaced with a diagnosis of Weaver syndrome.

[0054] In some instances, constitutive EZH2 mutations may confer a predisposition to malignancy. Accordingly, in some embodiments, a diagnosis of Weaver syndrome may be useful for identification of an individual who is at an early, pre-symptomatic stage of a cancer associated with Weaver Syndrome including, but not limited to, neuroblastoma, lymphoma, acute lymphoblastic leukemia, endodermal sinus tumours, sacrococcygeal teratomas and other embryonic, solid or haematopoietic tumours.

[0055] In some embodiments, the methods and reagents disclosed herein may be useful for determining the cause of spontaneous pregnancy losses, placental tumours, or other similar conditions.

[0056] In some embodiments, a method of detecting a propensity toward a condition of Weaver syndrome or an existing condition of Weaver syndrome is described herein. The method includes detecting a mutation in a nucleotide sequence of a protein coding region of the EZH2 gene. The presence of the mutation is indicative of a propensity toward a diagnosis of Weaver syndrome and/or a diagnosis of Weaver syndrome. In one

embodiment, the mutation may be a de novo mutation, a non-synonymous mutation, a heterozygous mutation, mutations that may present in a mosaic state, or combinations thereof. For example, mutations may occur after conception and cause Weaver syndrome but not leukemia.

[0057] By "Weaver syndrome" is meant a subject exhibiting, without limitation, one or more of the following symptoms: excessive growth (e.g. of prenatal onset), macrocephaly, hypertelorism, intellectual disability (for example, mental retardation, developmental delay), non-syndromic intellectual disability, facial features consistent with Weaver syndrome, advanced bone age, limb anomalies (for example, deep-set nails, joint contractures or dysharmonic bone age), accelerated osseous maturation, a large bifrontal diameter, downslanting palpebral fissures, retrognathia, a hoarse, low-pitched cry, mild or borderline intellectual disability, poor balance or gravitational insecurity, prominent digit pads with thin, deep-set nails and scoliosis, etc. In some embodiments, by "Weaver syndrome" is meant a subject exhibiting one or more of the following symptoms: intellectual disability of any degree, accelerated osseous maturation (carpal bone centres more advanced than phalangeal bone centres), the presence of retrognathia in early life, a hoarse, low-pitched cry and prominent digit pads. [0058] As used herein, a subject may be a human, non-human primate, rat, mouse, cow, horse, pig, sheep, goat, dog, cat, etc. In some embodiments, a subject may be a clinical patient, a clinical trial volunteer, an experimental animal, etc. In some embodiments, a subject may be an adult, adolescent, child, infant or fetal subject. In some embodiments, the subject may not have been previously diagnosed to have Weaver syndrome or may be a control subject that is, for example, confirmed to not have Weaver syndrome. In some embodiments, a subject may exhibit no apparent specific signs or symptoms of Weaver syndrome other than tall stature, a large head circumference and/or intellectual disability, which are consistent with many genetic disorders. In some embodiments, a subject may exhibit no apparent specific signs or symptoms of Weaver syndrome other than intellectual disability of any degree. In some embodiments, a subject may be considered at risk for Weaver syndrome, or have been preliminarily diagnosed with Weaver syndrome, where confirmation of Weaver syndrome is desired. In some embodiments, a subject may be an individual with a family history of Weaver syndrome or features of Weaver syndrome in a relative who is deceased or otherwise unavailable. In some embodiments, a subject may be confirmed to not have one or more of Sotos Syndrome, expanded Fragile X Syndrome (FMR1) alleles, or abnormalities on clinical karyotyping. In some embodiments, a subject may be confirmed to not have a mutation in or deletion of the NSD1 gene. In a further embodiment, a subject may be a patient with clinical features of Sotos syndrome but without mutation or deletion of the NSD1 gene. In some embodiments, the subject may be heterozygous or homozygous or hemizygous, as each option can be considered

representative of a predisposition or propensity or condition. For example, two mild mutations present in the homozygous state may be causative for Weaver syndrome.

[0059] A "sample" can be any organ, tissue, cell, or cell extract isolated from a subject. As used herein, a "test sample" is a sample used according to the methods set forth in the present disclosure. In some embodiments, a test sample can be a biological sample. A biological sample can include, without limitation, cells or tissue (e.g., from a biopsy or autopsy) from bone, brain, breast, colon, muscle, nerve, ovary, prostate, retina, skin, skeletal muscle, intestine, testes, heart, liver, lung, kidney, stomach, pancreas, uterus, adrenal gland, tonsil, spleen, soft tissue, peripheral blood, whole blood, red cell concentrates, platelet concentrates, leukocyte concentrates, blood cell proteins, blood plasma, platelet-rich plasma, a plasma concentrate, a precipitate from any fractionation of the plasma, a supernatant from any fractionation of the plasma, blood plasma protein fractions, purified or partially purified blood proteins or other components, serum, semen, mammalian colostrum, milk, urine, stool, saliva, placental extracts, amniotic fluid, a cryoprecipitate, a cryosupernatant, a cell lysate, mammalian cell culture or culture medium, products of fermentation, ascitic fluid, proteins present in blood cells, solid tumours, isolated from a mammal with a cancer, placental tissue, placental blood, fetal tissue, or fetal blood, skin biopsy, archival tissue e.g. preserved specimens from and autopsy on a deceased patient, polar body, motile sperm or any other precursor of sperm or egg cells, or any other specimen, or any extract thereof, obtained from a patient (human or animal), test subject, or experimental animal. A sample may also include, without limitation, products produced in cell culture by normal or transformed cells (e.g., via recombinant DNA or monoclonal antibody technology). A biological sample may also include, without limitation, any organ, tissue, cell, or cell extract isolated from a non- mammalian subject, such as an insect or a worm. A "sample" may also be a cell or cell line created under experimental conditions, that is not directly isolated from a subject. A

"sample" may also be a patient-derived cell line such as fibroblast cell-line or a transformed lymphoblast. A "sample" may also be obtained by a number of means including from cancerous cells or tissue e.g., from cells from a tumor or cancerous cells of a subject with cancer. A sample can also be cell-free, artificially derived or synthesized.

[0060] A "control" includes a sample obtained for use in determining base-line expression or activity. Accordingly, a control sample may be obtained by a number of means including from subjects not having Weaver syndrome or a cancer; from subjects not suspected of being at risk for Weaver syndrome or a cancer; from subjects with Sotos syndrome that have been confirmed to not have Weaver syndrome, or from cells or cell lines derived from such subjects. A control also includes a previously established standard.

Accordingly, any test or assay conducted according to the invention may be compared with the established standard and it may not be necessary to obtain a control sample for comparison each time.

[0061] The sample may be analyzed to detect the presence of an EZH2 gene, genome, polypeptide, nucleic acid molecule, or to detect a mutation in an EZH2 gene, expression levels of a an EZH2 gene or polypeptide, or the biological function of an EZH2 polypeptide, using methods that are known in the art. For example, methods such as sequencing, single-strand conformational polymorphism (SSCP) analysis, or restriction fragment length polymorphism (RFLP) analysis of PCR products derived from a sample can be used to detect a mutation in an EZH2 gene; ELISA or western blotting can be used to measure levels of EZH2 polypeptide or antibody affinity; northern blotting can be used to measure EZH2 mRNA levels, or PCR can be used to measure the level of an EZH2 nucleic acid molecule.

[0062] In some embodiments, a biological sample can be used directly as a test sample. In alternative embodiments, a test sample can be prepared from a biological sample from a subject. For example, a biological sample can be prepared so as to isolate nucleic acids or polypeptides. In some embodiments, a test sample contains a nucleic acid molecule comprising an EZH2 gene, a fragment of an EZH2 gene, an exon of an EZH2 gene with our without flanking sequences, an EZH2 mRNA or a fragment of an EZH2 mRNA, an EZH2 cDNA or a fragment of an EZH2 cDNA, or contains an EZH2 polypeptide or a fragment of an EZH2 polypeptide, obtained from a subject.

[0063] The terms "nucleic acid" or "nucleic acid molecule" encompass both RNA

(plus and minus strands) and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The nucleic acid may be a gene and may include both transcribed and untranscribed sequences. Transcribed sequences may include introns and untranslated sequences, as well as exons. The nucleic acid may be double-stranded or single-stranded. Where single-stranded, the nucleic acid may be the sense strand or the antisense strand. A nucleic acid molecule may be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides, or nucleotide analogs or derivatives. By "RNA" is meant a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides. One example of a modified RNA included within this term is phosphorothioate RNA. By "DNA" is meant a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides. By "cDNA" is meant complementary or copy DNA produced from an RNA template by the action of RNA- dependent DNA polymerase (reverse transcriptase). Thus a "cDNA clone" means a duplex DNA sequence complementary to an RNA molecule of interest, carried in a cloning vector. By "complementary" is meant that two nucleic acids, e.g., DNA or RNA, contain a sufficient number of nucleotides which are capable of forming Watson-Crick base pairs to produce a region of double-strandedness between the two nucleic acids. Thus, adenine in one strand of DNA or RNA pairs with thymine in an opposing complementary DNA strand or with uracil in an opposing complementary RNA strand. It will be understood that each nucleotide in a nucleic acid molecule need not form a matched Watson-Crick base pair with a nucleotide in an opposing complementary strand to form a duplex. A nucleic acid molecule according to the invention includes both complementary molecules, unless stated otherwise.

[0064] A nucleic acid molecule is "complementary" to another nucleic acid molecule if it hybridizes with the second nucleic acid molecule, although some level of mismatch is permitted. Hybridization may be under conditions of low stringency, moderate stringency or high stringency. Suitable stringency conditions are, in general, determined by the length of the nucleic acid molecules, the degree of complementation, and other factors readily understood by those of skill in the art. In some embodiments, for example, for preliminary screening, low stringency conditions, such as a temperature of about 48 to about 55°C, in a buffer including about 5x SSC, about 0.1 to about 0.5 % SDS, and about 0 to about 30% formamide. Moderate stringency hybridization conditions may be at a temperature of about 60°C in a buffer including about 5x to about 6x SSC, about 0.1 to about 0.5 % SDS, and about 40% formamide. High stringency hybridization conditions may be at a temperature of about 65°C in a buffer including about 5x to about 6x SSC, about 0.1 to about 0.5 % SDS, and about 50% formamide. In some embodiments, high stringency conditions are as described herein or are, for example, conditions that allow hybridization comparable with the hybridization that occurs using a DNA probe of at least 500 nucleotides in length, in a buffer containing 0.5 M NaHP0₄, pH 7.2, 7% SDS, 1 mM EDTA, and 1 % BSA (fraction V), at a temperature of 65°C, or a buffer containing 48% formamide, 4.8x SSC, 0.2 M Tris-CI, pH 7.6, 1x Denhardt's solution, 10% dextran sulfate, and 0.1 % SDS, at a temperature of 42°C.

(These are typical conditions for high stringency northern or Southern hybridizations.) Hybridizations may be carried out over a period of about 20 to 30 minutes, or about 2 to 6 hours, or about 10 to 15 hours, or over 24 hours or more. High stringency hybridization is also relied upon for the success of numerous techniques routinely performed by molecular biologists, such as high stringency PCR, DNA sequencing, single strand conformational polymorphism analysis, and in situ hybridization. In contrast to northern and Southern hybridizations, these techniques are usually performed with relatively short probes (e.g., usually about 15 nucleotides or longer for PCR or sequencing and about 40 nucleotides or longer for in situ hybridization). The stringency conditions used in these techniques are well known to those skilled in the art of molecular biology, and examples of them can be found, for example, in Ausubel et al. (42), which is hereby incorporated by reference.

[0065] A probe or primer is a single-stranded DNA or RNA molecule (e.g., an oligonucleotide) of defined sequence that can base pair to a second DNA or RNA molecule that contains a complementary sequence (the target). The stability of the resulting hybrid molecule depends upon the extent of the base pairing that occurs, and is affected by parameters such as the degree of complementarity between the probe and target molecule, and the degree of stringency of the hybridization conditions. The degree of hybridization stringency is affected by parameters such as the temperature, salt concentration, and concentration of organic molecules, such as formamide, and is determined by methods that are known to those skilled in the art. Probes or primers specific for the nucleic acid sequences described herein, or portions thereof, may vary in length by any integer from at least 8 nucleotides to over 500 nucleotides, including any value in between, depending on the purpose for which, and conditions under which, the probe or primer is used. For example, a probe or primer may be 8, 10, 15, 20, or 25 nucleotides in length, or may be at least 30, 40, 50, or 60 nucleotides in length, or may be over 100, 200, 500, or 1000 nucleotides in length. Probes or primers specific for the nucleic acid molecules described herein may have greater than 55-75% sequence identity, or at least 75-85% sequence identity, or at least 85-99% sequence identity, or 100% sequence identity to the nucleic acid sequences described herein.

[0066] Probes or primers may be derived from a gene, chromosomal segment, or chromosome that is used as a reference, for example, in variance detection to determine whether a test sample of the same gene, chromosomal segment, or chromosome derived from a particular individual contains the identical sequence or a different sequence at one or more nucleotide positions. Probes may be derived from genomic DNA or cDNA, for example, by amplification, or from cloned DNA segments, and may contain either genomic DNA or cDNA sequences representing all or a portion of a single gene from a single individual.

Probes or primers may be chemically synthesized.

[0067] Probes or primers can be detectably-labeled, either radioactively or nonradioactive^, by methods that are known to those skilled in the art. Probes or primers can be used for methods involving nucleic acid hybridization, such as nucleic acid sequencing, nucleic acid amplification by the polymerase chain reaction, single stranded conformational polymorphism (SSCP) analysis, restriction fragment polymorphism (RFLP) analysis,

Southern hybridization, northern hybridization, in situ hybridization, electrophoretic mobility shift assay (EMSA), and other methods that are known to those skilled in the art.

[0068] A "protein," "peptide" or "polypeptide" is any chain of two or more amino acids, regardless of post-translational modification (e.g., glycosylation or phosphorylation). The terms "protein," "peptide" or "polypeptide" may be used interchangeably to refer to a molecule encloded by a nucleic acid molecule, such as the gene product (or corresponding synthetic product) of a gene.

[0069] By "enhancer of zeste homologue 2" or "EZH2" is meant a histone

methyltransferase or homologues thereof, including allelic variants and orthologs. In some embodiments, by an EZH2 gene is meant a nucleic acid molecule of human origin. As used herein, "EZH2" (in italics) refers to a nucleic acid sequence (e.g., genomic, cDNA, mRNA) and "EZH2" (without italics) refers to an amino acid sequence (e.g., protein or polypeptide). The EZH2 gene is located on chromosome 7 (7q36. 1) and related nucleic acid and amino acid sequences have been described in GenBank Accession No. NM_004456. In some embodiments, an EZH2 nucleic acid molecule may have any one of the sequences described herein, for example, in Figures 1 , 2 or 4, or identified in SEQ ID NOs: 1 or 2, or fragments thereof. In some embodiments, an EZH2 polypeptide may have any one of the sequences described herein, for example, in Figures 3 or 4 or identified in SEQ ID NO: 3, or fragments thereof.

[0070] In some embodiments, an EZH2 nucleic acid molecule or EZH2 polypeptide may be substantially identical to any one of the sequences described herein. A "substantially identical" sequence is an amino acid or nucleotide sequence that differs from a reference sequence only by one or more conservative substitutions, as discussed herein, or by one or more non-conservative substitutions, deletions, or insertions located at positions of the sequence that do not destroy the biological function of the amino acid or nucleic acid molecule. Such a sequence can be any integer from 80% to 99%, or more generally at least 80%, 85%, 90%, or 95%, or as much as 96%, 97%, 98%, or 99% identical when optimally aligned at the amino acid or nucleotide level to the sequence used for comparison using, for example, the Align Program (Myers and Miller, CABIOS, 1989, 4:1 1-17) or FASTA. For polypeptides, the length of comparison sequences may be at least 2, 5, 10, or 15 amino acids, or at least 20, 25, or 30 amino acids. In alternate embodiments, the length of comparison sequences may be at least 35, 40, or 50 amino acids, or over 60, 80, or 100 amino acids. For nucleic acid molecules, the length of comparison sequences may be at least 5, 10, 15, 20, or 25 nucleotides, or at least 30, 40, or 50 nucleotides. In alternate embodiments, the length of comparison sequences may be at least 60, 70, 80, or 90 nucleotides, or over 100, 200, or 500 nucleotides. Sequence identity can be readily measured using publicly available sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, or BLAST software available from the National Library of Medicine, or as described herein). Examples of useful software include the programs Pile-up and PrettyBox. Such software matches similar sequences by assigning degrees of homology to various substitutions, deletions, substitutions, and other

modifications. Alternatively, or additionally, two nucleic acid sequences may be "substantially identical" if they hybridize under high stringency conditions, as described herein.

[0071] In some embodiments, EZH2 nucleic acid variants may be EZH2 genomic

DNA, cDNA, or mRNA including at least one rare, non-conservative mutation, such as a nucleotide substitution, insertion or deletion. The mutation may be in a coding or non-coding region. In some embodiments, EZH2 nucleic acid variants may further include at least one conservative mutation, such as a nucleotide substitution, insertion or deletion, that does not affect the function of EZH2 polypeptide.

[0072] In some embodiments, EZH2 polypeptide variants are polypeptides including at least one mutation, such as an amino acid substitution, insertion or deletion, which results in a functional change in enzyme activity (e.g., a change in methylation activity).

[0073] A conservative mutation or variant refers to a change which, in the case of a nucleic acid molecule, does not result in any alteration of the corresponding encoded amino acid. By contrast, a non-conservative mutation or variant, in the case of a nucleic acid molecule, results in an alteration in the corresponding encoded amino acid. With respect to polypeptides, a conservative mutation or variant (such as by substitution of an amino acid with another of similar physical properties, as recognized in the art) does not result in an alteration in the overall conformation or function of the polypeptide. A non-conservative mutated or variant polypeptide is one in which the mutation results in an alteration in the overall conformation or function of the polypeptide.

[0074] As used herein, a "rare, non-conservative mutation" refers to an EZH2 mutation found in less than about 1 % of healthy controls matched by ethnicity to the subject and which has an effect on the functional activity of EZH2. Such mutations are readily identified using any nucleic acid analysis technology as described herein or known in the art. In some embodiments, such mutations are detected in the nucleotide sequence of a protein coding region of the EZH2 gene. The presence of such a mutation in a subject is generally correlated to a risk or predisposition of a genetic disorder, such as Weaver syndrome (i.e. correlated to Weaver syndrome), in that subject. Conservative mutations are excluded unless the mutation has a functional effect on other aspects of EZH2 protein biology, for example, by activating a cryptic splice site. Conservative and non-conservative polypeptide mutations may be readily identified by determining whether or not a mutation has an effect on the functional activity of EZH2 by, for example, performing a histone methylation assay or other assay for EZH2 activity as described herein or known in the art.

[0075] In one embodiment, the mutation may comprise a deletion or insertion of at least one or more nucleotide bases. For example, the deletion may include nucleotides 457 to 459 of the protein coding region of the EZH2 gene corresponding to the deletion of a tyrosine amino acid at about amino acid 153 in the EZH2 protein. The deletion, insertion or structural rearrangement may allow the remaining coding nucleotides to be read "in frame." The deletion, insertion or structural rearrangement may also prevent the remaining coding nucleotides from being read "in frame," if the deletion, insertion or other structural

rearrangement affects a number of nucleotides that is not an integral multiple of three.

[0076] In one embodiment, the mutation may comprise a missense variant in a knot substructure of the active site of the protein coding region of the EZH2 gene. For example, the missense variant may be at about nucleotide 2080 and correspond to the substitution of a C nucleotide with a T nucleotide. The missense variant may comprise a Histidine to Tyrosine substitution, for example at about amino acid 694 in the EZH2 protein.

[0077] In one embodiment, the mutation may comprise a missense variant at about nucleotide 394 of the protein coding region of the EZH2 gene. For example, the missense variant may be at about nucleotide 394 and correspond to the substitution of a C nucleotide with a T nucleotide. The missense variant may comprise a Proline to Serine substitution, for example at about amino acid 132 in the EZH2 protein.

[0078] In one embodiment, the mutation may comprise a missense variant at about nucleotide 398 of the protein coding region of the EZH2 gene. For example, the missense variant may be at about nucleotide 398 and correspond to the substitution of an A nucleotide with a G nucleotide. The missense variant may comprise a Tyrosine to Cysteine substitution, for example at about amino acid 133 in the EZH2 protein.

[0079] In one embodiment, mutations in the protein coding region of the EZH2 gene interfere with intron splicing. For example, an intronic mutation affecting splicing may affect the mRNA and the expression of the protein.

[0080] Any suitable method of nucleic acid or DNA-based analysis, including polymerase chain reaction (PCR), labelled dideoxynucleotide incorporation also referred to as "Sanger sequencing", whole exome sequencing (7, 8), whole genome sequencing, fluorescence in situ hybridization, restriction fragment length polymorphisms, and subcloning may effectively be used in the methods described herein, such as for diagnosing Weaver syndrome. For example, polymerase chain reaction may be used to amplify a nucleic acid molecule. Additional methods that involve selective or non-selective sequencing of the entire expressed portion of the genome (the "exome") or the entire genome, that currently exist or may be developed in the future, may also be used to diagnose Weaver syndrome. A person skilled in the art would understand that additional methods currently existing or developed in the future that may be used to interrogate the human genome or human-derived genomes for the detection of mutations in EZH2 may be used in the context of testing for Weaver syndrome or features thereof. High-throughput sequencing across the entire coding portion of the genome (the "exome") or across the entire genome itself may be used to detect mutations that indicate a genetic predisposition to Weaver syndrome, a propensity toward a diagnosis of Weaver syndrome and/or a diagnosis of Weaver syndrome.

[0081] Determining the presence or absence of nucleic acid encoding a specific mutation may be carried out with an oligonucleotide probe labeled with a suitable detectable group, and/or by means of an amplification reaction such as a polymerase chain reaction. The detecting may include detecting whether the subject is heterozygous or homozygous for the mutation. Amplification of a selected, or target, nucleic acid sequence may be carried out by any suitable means. Examples of suitable amplification techniques include, but are not limited to, PCR. PCR may be carried out as known in the art. For example, PCR methods include treating a nucleic acid sample (e.g., in the presence of a heat stable DNA

polymerase) with one oligonucleotide primer for each strand of the specific sequence to be detected, under suitable hybridization conditions, so as to synthesize an extension product of each primer which is complementary to each nucleic acid strand. The primers are sufficiently complementary to each strand of the specific sequence to hybridize therewith so that the extension product synthesized from each primer, when it is separated from its complement, can serve as a template for synthesis of the extension product of the other primer, and then treating the sample under denaturing conditions to separate the primer extension products from their templates if the sequence or sequences to be detected are present. These steps are cyclically repeated until the desired degree of amplification is obtained. Detection of the amplified sequence may be carried out by adding to the reaction product an oligonucleotide probe capable of hybridizing to the reaction product (e.g., an oligonucleotide probe of the present invention), the probe carrying a detectable label, and then detecting the label in accordance with known techniques, or by direct visualization on a gel. When PCR conditions allow for amplification of all allelic types, the types can be distinguished by hybridization with an allelic specific probe, by restriction endonuclease digestion, by electrophoresis on denaturing gradient gels, or other techniques. DNA amplification techniques such as the foregoing can involve the use of a probe, a pair of probes, or two pairs of probes which specifically bind to DNA containing the functional polymorphism, but do not bind to DNA that does not contain the functional polymorphism. Alternatively, the probe or pair of probes could bind to DNA that both does and does not contain the functional polymorphism, but produce or amplify a product (e.g., an elongation product) in which a detectable difference may be ascertained (e.g., a shorter product, where the functional polymorphism is a deletion mutation). Such probes can be generated in accordance with standard techniques from the known sequences of DNA in or associated with a gene linked to Weaver syndrome or from sequences which can be generated from such genes in accordance with standard techniques. It will be appreciated that the detecting steps described herein may be carried out directly or indirectly.

[0082] Generally, several sub-steps are necessary to remove cell debris and to further purify the DNA from the biological crude sample. At this point several options exist for further processing and analysis. One option involves denaturing the DNA and carrying out a direct hybridization analysis in one of many formats (dot blot, microbead, microplate, etc.). A second option, called Southern blot hybridization, involves cleaving the DNA with restriction enzymes, separating the DNA fragments on an electrophoretic gel, blotting the DNA to a membrane filter, and then hybridizing the blot with specific DNA probe sequences. This procedure effectively reduces the complexity of the genomic DNA sample, and thereby helps to improve the hybridization specificity and sensitivity. Unfortunately, this procedure can be long and arduous. A third option is to carry out an amplification procedure such as the polymerase chain reaction (PCR) or the strand displacement amplification (SDA) method. These procedures amplify (increase) the number of target DNA sequences relative to non- target sequences. Amplification of target DNA helps to overcome problems related to complexity and sensitivity in genomic DNA analysis. After these sample preparation and DNA processing steps, the actual hybridization reaction is performed. Finally, detection and data analysis convert the hybridization event into an analytical result. Nucleic acid hybridization analysis generally involves the detection of a very small number of specific target nucleic acids (DNA or RNA) with an excess of probe DNA, among a relatively large amount of complex non-target nucleic acids. A reduction in the complexity of the nucleic acid in a sample is helpful to the detection of low copy numbers (i.e. 10,000 to 100,000) of nucleic acid targets. DNA complexity reduction is achieved to some degree by amplification of target nucleic acid sequences. This is because amplification of target nucleic acids results in an enormous number of target nucleic acid sequences relative to non-target sequences thereby improving the subsequent target hybridization step. The actual hybridization reaction represents one of the most important and central steps in the whole process. The

hybridization step involves placing the prepared DNA sample in contact with a specific reporter probe at set optimal conditions for hybridization to occur between the target DNA sequence and probe.

[0083] In alternative embodiments, polypeptide-based techniques may be used. For example, methylation assays or antibody-based detection assays as described herein or known in the art may be used.

[0084] In one embodiment, in vitro diagnosis of Weaver syndrome may be performed by contacting a nucleic acid-containing sample from a subject (such as a human suspected of having Weaver syndrome), contacting the sample with a probe or primer for amplifying all or part of an EZH2 nucleic acid molecule, amplifying the nucleic acid, detecting the amplification products, and comparing the amplification products to those from a control (such as from a subject that is confirmed to not have Weaver syndrome or a mutation in an EZH2 nucleic acid molecule) or established standard such as a wild type EZH2 sequence.

[0085] In some embodiments, the present disclosure provides a method for detecting the presence of a mutation associated with Weaver syndrome in a nucleic acid-containing sample from a subject. The method can include amplifying an EZH2 gene sequence from the nucleic acid to produce an amplification product, and identifying the presence of a Weaver syndrome-associated mutation in the amplification product by, for example, sequencing the amplification product. Alternatively, the amplification product can first be digested with a restriction enzyme, which can then be sequenced to identify the Weaver syndrome- associated mutation.

[0086] In some embodiments, the present disclosure provides a method for diagnosing Weaver syndrome or a genetic predisposition for Weaver syndrome in a sample containing an EZH2 gene from a subject, detecting one or more mutations in the sample, and determining that the subject has at least one detected mutation in at least genomic copy of the EZH2 gene. Thus, a test can be performed to determine if the subject is homozygous or heterozygous for Weaver syndrome. The presence of at least one detected mutation in at least one copy of the sequence encoding the EZH2 gene is diagnostic for Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject or the subject's offspring.

[0087] In some embodiments, the nucleic acid sequences described herein (such as in the Examples, can be used as probes or primers. Some of these sequences can be used to detect particular EZH2 mutations present in a sample from a subject. In some

embodiments, therefore, a probe or primer will hybridize under suitable hybridization conditions at a site of mutation. In alternative embodiments, a probe or primer will hybridize under suitable hybridization conditions adjacent to a site of mutation i.e., the probe or primer will not hybridize directly to the site of mutation but will hybridize at a distance upstream or downstream of the site of mutation that is sufficiently close to permit amplification of a nucleic acid molecule that contains the site of mutation. Appropriate primer or probe design is well within the capabilities of the skilled person.

[0088] In alternative embodiments, in vitro diagnosis of Weaver syndrome may be performed by contacting a polypeptide-containing sample from a subject (such as a human suspected of having Weaver syndrome), contacting the sample with an antibody that specifically binds a mutated EZH2 polypeptide, detecting specific binding of the antibody, and comparing the binding to that from a control (such as wild type EZH2 polypeptide). An antibody "specifically binds" an antigen when it recognises and binds the antigen, for example, an EZH2 polypeptide variant, but does not substantially recognise and bind other reference molecules in a sample, for example, a wild type EZH2 polypeptide. Such an antibody has, for example, an affinity for the antigen which is at least 10, 100, 1000 or 10000 times greater than the affinity of the antibody for another reference molecule in a sample.

[0089] In alternative embodiments, in vitro diagnosis of Weaver syndrome may be performed by contacting a polypeptide-containing sample from a subject (such as a human suspected of having Weaver syndrome), assaying methylation activity in the sample, and comparing the methylation activity to that of wild type EZH2 polypeptide and/or a variant EZH2 polypeptide. Methylation assays can be performed as described herein or known in the art.

[0090] In alternative embodiments, the methods according to the present disclosure may further include detection of at least one or more further mutations in a EZH2 polypeptide or EZH2 nucleic acid molecule, where the further mutations are those correlated with a cancer, for example, those as described herein or known in the art.

[0091] In some embodiments, the present disclosure provides a method for treating

Weaver syndrome by administering an effective amount of an agent that modulates EZH2. In particular embodiments, the present disclosure provides a method for treating Weaver syndrome by administering an effective amount of an agent or compounds that increase EZH2 activity, such as a methyl-donating compound, for example methionine, S- Adenosylmethionine, S-adenosylhomocysteine, betaine or choline. In alternative

embodiments, the present disclosure provides a method for treating Weaver syndrome by administering an effective amount of an agent that decreases EZH2 activity, for example by gene-silencing, such as an antisense or short interfering RNA (siRNA) molecule. By

"antisense," as used herein in reference to nucleic acids, is meant a nucleic acid sequence that is complementary to the coding strand of a nucleic acid molecule, for example, a gene, such as an EZH2 gene. By "siRNA" is meant a single stranded nucleic acid molecule which is complementary to a DNA or RNA molecule and can inhibits its function. In some embodiments, an antisense or siRNA nucleic acid molecule is one which targets a mutation, such as a rare, non-conservative mutation, as described herein, in an EZH2 gene. In some embodiments, an antisense or siRNA nucleic acid molecule is one which is capable of lowering the level of polypeptide encoded by the complementary gene when both are expressed in a cell. In some embodiments, the polypeptide level is lowered by any integer from at least 10% to at least 25%, or by any integer from at least 25% to at least 50%, or by any integer from at least 50 % to at least 75%, or by any integer from at least 75% to 100%, as compared to the polypeptide level in a cell expressing only the gene, and not the complementary antisense or siRNA nucleic acid molecule.

[0092] Furthermore, there is described herein a therapeutic regimen for subjects having a propensity toward a condition of Weaver syndrome. The therapeutic regimen may comprise providing the patients with a methyl-donating compound, for example methionine, S-Adenosylmethionine, S-adenosylhomocysteine, betaine or choline.

[0093] Compounds of the invention can be provided alone or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides, or peptide analogues), in the presence of a liposome, an adjuvant, or any pharmaceutically acceptable carrier, in a form suitable for administration to mammals, for example, humans, cattle, sheep, etc. If desired, treatment with a compound according to the invention may be combined with more traditional and existing therapies for Weaver syndrome. Compounds according to the invention may be provided chronically or intermittently. "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. "Intermittent" administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature

[0094] Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to subjects suffering from or presymptomatic for Weaver syndrome. Any appropriate route of administration may be employed, for example, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, topical, or oral administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.

[0095] Methods well known in the art for making formulations are found in, for example, "Remington's Pharmaceutical Sciences" (19^th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel. For therapeutic or prophylactic compositions, the compounds are administered to an individual in an amount sufficient to stop or slow the symptoms of Weaver syndrome.

[0096] An "effective amount" of a compound according to the invention includes a therapeutically effective amount or a prophylactically effective amount. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as such as amelioration of Weaver syndrome. A therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the compound are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as amelioration of Weaver syndrome. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount may be less than a therapeutically effective amount. A preferred range for therapeutically or prophylactically effective amounts of a compound may be any integer from 0.1 nM-0.1 M, 0.1 nM-0.05M, 0.05 ηΜ-15μΜ or 0.01 ηΜ-10μΜ.

[0097] It is to be noted that dosage values may vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgement of the person administering or supervising the administration of the compositions. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners. The amount of active compound(s) in the composition may vary according to factors such as the disease state, age, sex, and weight of the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.

[0098] In general, therapeutic compounds should be used without causing substantial toxicity. Toxicity of the compounds of the invention can be determined using standard techniques, for example, by testing in cell cultures or experimental animals and determining the therapeutic index, i.e., the ratio between the LD50 (the dose lethal to 50% of the population) and the LD100 (the dose lethal to 100% of the population). In some

circumstances however, such as in severe disease conditions, it may be necessary to administer substantial excesses of the compositions.

[0099] In some embodiments, the present disclosure provides a method for screening for candidate compounds to treat Weaver syndrome. In general, candidate compounds are identified from large libraries of both natural products or synthetic (or semisynthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the method(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceanographic Institute (Ft. Pierce, FL, USA), and PharmaMar, MA, USA. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods. When a crude extract is found to modulate EZH2 activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having EZH2 modulatory activities. The same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogeneous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic, prophylactic, diagnostic, or other value may be subsequently analyzed using a suitable animal model.

[00100] A kit for detection of Weaver syndrome or a propensity toward a condition of Weaver syndrome is described. The kit comprises a probe for detecting a mutation in a nucleotide sequence of a protein coding region of the EZH2 gene in a sample from a subject together with directions for use. The presence of the mutation is indicative of Weaver syndrome or a propensity toward a condition of Weaver syndrome. The kit may be in the form of a chip or biological sensor, a laboratory-based assay, PCR, ELISA, or other known methods, and may be offered as a point of care test or a test that is conducted under laboratory conditions. In some embodiments, the kit may contain a probe for detection of mutations in the NSD1 gene. In some embodiments, the kit may contain data for analysis of mutations. In some embodiments, the kit may contain hybridization reagents.

[00101] Kits for determining if a subject is or was (in the case of deceased subjects) afflicted with or is or was at increased risk of developing Weaver syndrome will include at least one reagent specific for detecting for the presence or absence of at least one mutation as described herein and instructions for observing that the subject is or was afflicted with or is or was at increased risk of developing Weaver syndrome if at least one of the mutations is detected. The kit may optionally include one or more nucleic acid probes for the amplification and/or detection of the mutation by any of the techniques described above, such as PCR, or known in the art. Kits useful for carrying out the methods of the present invention will, in general, comprise one or more oligonucleotide probes and other reagents for carrying out the methods as described above, such as restriction enzymes, optionally packaged with suitable instructions for carrying out the methods.

[00102] In alternative embodiments, the kit may contain an antibody that specifically binds a mutated EZH2 polypeptide as well as an antibody that specifically binds a wild type EZH2 polypeptide but does not specifically bind a mutated EZH2 polypeptide. In some embodiments, the antibody may be detectably labeled.

EXAMPLES

[00103] EXAMPLE 1 : Determination of Subject Characteristics

[00104] Saliva-derived DNA samples were collected using Oragene® kits from one of the probands from the original report describing Weaver syndrome (1), from two other unrelated probands with classical features of Weaver syndrome, such as excessive growth of prenatal onset, accelerated osseous maturation, macrocephaly, a large bifrontal diameter, downslanting palpebral fissures, retrognathia, a hoarse, low-pitched cry, mild or borderline intellectual disability, poor balance or gravitational insecurity, prominent digit pads with thin, deep-set nails and scoliosis, and from all six unaffected parents of the probands. Probands were confirmed in childhood to have classical features of Weaver syndrome and not classical features of Sotos syndrome. Distinguishing features were the specific pattern of accelerated osseous maturation (carpal bone centres more advanced than phalangeal bone centres), the presence of retrognathia in early life, the hoarse, low-pitched cry and the prominent digit pads seen in Weaver syndrome. Various phenotypic manifestations of Weaver syndrome in the probands are illustrated in Table 1 below.

Table 1 : Phenotypic manifestations of Weaver Syndrome in patients with EZH2 mutations.

Ocular hypertelorism ++ ++ - ++ ++

Downslanted palpebral fissures + + + ++ +

Long philtrum ++ ++ ++ + ++

Retrognathia + + + + +

Cardiovascular

Patent Ductus Arteriosus - - + - ++

Ventricular Septal Defect - - - - ++

Limbs

Hands

Prominent digit pads ++ ++ ++ + +

Single transverse palmar

- ++

crease

Camptodactyly ++ + - + -

Broad thumbs ++ ++ - - -

Thin, deep-set nails ++ ++ ++ + +

Feet

Clinodactyly, toes + + - - +

Talipes equinovarus ++ - - - +

Short fourth metatarsals + - - - -

Hind foot valgus - - + - +

Limited elbow and k nee + +

- +

extension in early life

Limited elbow and knee + +

- Nk extension after puberty

Widened distal femurs and ++ Nk

Nk ++

ulnas

Skin

Excessive loose skin ++ ++ - - ++

Inverted nipples + Hypoplastic/

- supernumerary

Thin hair + - - - -

Increased pigmented nevi - ++ ++ - +

Connective tissue

Umbilical hernia ++ + + + +

Inguinal hernia ++ - - - -

Spinal Curvature Scoliosis ++ Scoliosis ++ Scoliosis ++ - Kyphosis ++

Endocrine

Hypothyroidism [age of onset] ~25y - - - -

Growth hormone deficiency ~27y

[age of onset]

Perinatal Hypoglycemia - - - - ++

Cancer predisposition

Cancer subtype - - - neuroblastoma neuroblastoma

Key: + = minimally present, ++ = obviously present, +++ = very prominent, ++++ = severe, = assessed and found to be absent, Nk = Not known, y = years, m = months ~ = approximate

[00105] Parents of each of the probands were confirmed by clinical history and physical examination to be unaffected with Weaver syndrome. Subsequently, blood was collected from two additional probands and their parents, bringing the total number of affected probands to five.

[00106] None of the three original probands exhibited deletions or duplications in the NSD1 gene that are detectable by standard diagnostic microarray analysis (lllumina Human Omni2.5-Quad chip, analyzed with CNVPartition from GenomeStudio V2010.3). None of the probands had expanded Fragile X Syndrome (FMR1) alleles or abnormalities on clinical karyotyping.

[00107] Using Sanger sequencing on saliva-derived DNA samples for each of the three original probands, and on proband 5, it was determined that none of the probands had rare variants, i.e., variants present in fewer than 1 % of ethnically-matched controls, in the NSD1 gene. Primers used in the Sanger sequencing are shown in Table 2 below.

[00108] Table 2: Primers used with NSD1 sequencing.

NSD1.ex4C.R AGCCTCCTGAAACCAAAACC (SEQ ID NO: 88)

NSD1.ex4D.F CCAGACTACAAATTCAGTACATTGC (SEQ ID NO: 89)

NSD1.ex4D.R TTCCGTTTTCAAAAGAGAGTCC (SEQ ID NO: 90)

NSD1.ex4E.F CGTGGAGGTTCATTGAGAGG (SEQ ID NO: 91)

NSD1.ex4E.R CAACAGACCAATTTCAGAAGGAC (SEQ ID NO: 92)

NSD1.ex5.F ATGTGGTTTCCCATCTGGTT (SEQ ID NO: 93)

NSD1.ex5.R TGTGCTAGAAGCTGAGAATAAAAA (SEQ ID NO: 94)

NSD1.ex6.F GCCTTTGTCAGAATTTCATTCC (SEQ ID NO: 95)

NSD1.ex6.R CCAGGACAAAAGGGGGTAGT (SEQ ID NO: 96)

NSD1.ex7.F CATCCTGCCTCTTCCCATAA (SEQ ID NO: 97)

NSD1.ex7.R TGTATGACTGCTGACACACACAC (SEQ ID NO: 98)

NSD1.ex8.F TGGCAGCTGACAATTCAGAC (SEQ ID NO: 99)

NSD1.ex8.R CTCACTGGTCGGGCTTACAC (SEQ ID NO: 100)

NSD1.ex9.F TCCTAATCCACAAAGCTGGAG (SEQ ID NO: 101)

NSD1.ex9.R TTATGGCCATCAGCCATTTC (SEQ ID NO: 102)

NSD1.ex10.F CGAGTGATTGGCTGAACATC (SEQ ID NO: 103)

NSD1.ex10.R TCCACTGGAATCATCCAAAAG (SEQ ID NO: 104)

NSD1.ex11.F TCCTTTTCTGCCACTTTTAACC (SEQ ID NO: 105)

NSD1.ex11.R CCCAGTGTTGCCACAAAATAG (SEQ ID NO: 106)

NSD1.ex12.F CTTTCTGTTGTATCACGTCAGG (SEQ ID NO: 107)

NSD1.ex12.R AGGCTGAAGCAGGAGAATGG (SEQ ID NO: 108)

NSD1.ex13.F TTTTTCAGTGCTAACAAATAGACTTGA (SEQ ID NO: 109)

NSD1.ex13.R TTCCAGTGGCAATATGATGAA (SEQ ID NO: 1 10)

NSD1.ex14.F ATACTCTGGTCATTATGTGTCACTG (SEQ ID NO: 11 1)

NSD1.ex14.R AAGAGGGGAGGAGTACCATGA (SEQ ID NO: 112)

NSD1.ex15.F TGTGGACAGACAGACATTGC (SEQ ID NO: 1 13)

NSD1.ex15.R GCCAGATAATGCCCTGAGAG (SEQ ID NO: 1 14)

NSD1.ex16.F TCTCCAACTTAAAGGGGAAAAAG (SEQ ID NO: 1 15)

NSD1.ex16.R GCTTGTGCTTCCGTTCTTG (SEQ ID NO: 1 16)

NSD1.ex17.F GGAAATGTGGCTGCAACTTC (SEQ ID NO: 117)

NSD1.ex17.R TGGCAAGACACAACAATAAGG (SEQ ID NO: 118)

NSD1.ex18.F TGCTTTGTAGAATGTGATGTTTTC (SEQ ID NO: 1 19) NSD1.ex18.R GGGAAAAGACCCTACCTTGG (SEQ ID NO: 120)

NSD1.ex19.F GGGATCTTTTCTCTGAGAGGTTC (SEQ ID NO: 121)

NSD1.ex19.R AAATGAACTTAATTCCAGAGAACG (SEQ ID NO: 122)

NSD1.ex20.F TCTGTTCTCTTGGGAGTTGG (SEQ ID NO: 123)

NSD1.ex20.R ACCATGCCTGGCTGAATG (SEQ ID NO: 124)

NSD1.ex21.F TTTCCCAGAGAAGAGAATGAGG (SEQ ID NO: 125)

NSD1.ex21.R CAAATGGCACTTTCTTCAAGG (SEQ ID NO: 126)

NSD1.ex22A1.F TCTGAAGCAGGGACAGTGTG (SEQ ID NO: 127)

NSD1.ex22A1.R TTTATCCAGCCTTGGGTCAG (SEQ ID NO: 128)

NSD1.ex22B1.F AATCCCAATCCTTGGTTTCC (SEQ ID NO: 129)

NSD1.ex22B1.R TCTTCCTGAGGCCTGAGTTG (SEQ ID NO: 130)

NSD1.ex22C1.F TGAGAAGATGCCAGTGTTGG (SEQ ID NO: 131)

NSD1.ex22C1.R TTCTGAGTGTTGGGATATGAGG (SEQ ID NO: 132)

[00109] None of the three original probands nor the two subsequent probands had an elevated fasting glucose. In fact, proband 5 (36) manifested low blood glucose in the neonatal period. Probands 2 and 3 manifested hypotonia; a state of low muscle tone, as shown in Table 1.

[00110] Example 2: Exome Sequencing, Identification of Mutations and

Confirmation with Sanger Sequencing

[00111] Exome sequencing was performed on samples from six individuals; two family trios of Probands 1 and 2. The DNA concentration was quantified using a Quant-iT dsDNA HS assay kit and a Qubit fluorometer (Invitrogen). Approximately 500ng DNA was sheared for 75 seconds at duty cycle of 20% and intensity of 5 using a Covaris E210. The DNA was size fractionated on an 8% polyacrylamide gel. A 200-250 bp size fraction was excised, eluted from the gel slice, and ligated to lllumina paired-end adapters following a standard protocol as described by Morin et al. (9). Adapter-ligated DNA was amplified for 10 cycles using the standard commercially available lllumina PE primer set and purified. The primer sequences used for EZH2 sequencing are shown in Table 3 below, and in Figures 4A-F. The alignment of Figures 4A-F allows easy correlation of cDNA sequence variants with their corresponding amino acids, in order to determine whether a nucleotide change results in an amino acid change and, if so, to identify the novel amino acid that will replace the normal amino acid in the reference sequence.

[00112] The DNA was compiled in a "pre-exome capture library DNA" and the DNA was assessed using an Agilent DNA 1000 Series II assay, and 500ng of DNA was hybridized to the 50Mb exon probe using the Human All Exon Kit (Cat#G3370) following the Agilent's SureSelect Target Enrichment protocol (Version 1.0, September 2009). The captured DNA was purified using a Qiagen MiniElute column, and amplified for 12 cycles using the standard commercially available lllumina PE primer set. The PCR products were separated by size on an 8% PAGE gel, prior to gel extraction at the desired size range (320-370bp). The samples were then assessed using an Agilent DNA 1000 series II assay. The final library DNA concentration was diluted to a concentration of 10nM, which was confirmed via a Quant-iT dsDNA HS assay kit and Qubit fluorometer (Invitrogen), prior to cluster generation and exome sequencing.

[00113] Table 3. Primers used with EZH2 sequencing.

EZH2_ex9.F AGCATGGGTGCAGACAACAT (SEQ ID NO: 51)

EZH2_ex9.R TCCATTAATTGACTTTTCCAGTG (SEQ ID NO: 52)

EZH2_ex10.F TCTGGTCTTTATACTGAAACTAACCAA (SEQ ID NO: 53)

EZH2_ex10.R GATTATTTGTGATAAATGGATAATGTG (SEQ ID NO: 54)

EZH2_ex11.F TTTTTAGGAGATGAATAGGAGCTT (SEQ ID NO: 55)

EZH2_ex11.R TGTCCTCATCTTTTCGCTTTT (SEQ ID NO: 56)

EZH2_ex12.F CCAACAACAGCCCTTAGGAA (SEQ ID NO: 57)

EZH2_ex12.R CCCAGCATCTAGCAGTGTCA (SEQ ID NO: 58)

EZH2_ex13.F AACCCAAGCTCTAATCCAGTTA (SEQ ID NO: 59)

EZH2_ex13.R TCTTGGCTTTAACGCATTCC (SEQ ID NO: 60)

EZH2_ex14.F AGGGAGTGCTCCCATGTTCT (SEQ ID NO: 61)

EZH2_ex14.R GCCAGCTACACTCCACAGGT (SEQ ID NO: 62)

EZH2_ex15.F TTTGCCCCAGCTAAATCATC (SEQ ID NO: 63)

EZH2_ex15.R GTACAGCCCTTGCCACGTAT (SEQ ID NO: 64)

EZH2_ex16.F TCCAATCAAACCCACAGACTT (SEQ ID NO: 65)

EZH2_ex16.R TGAGGATTTACAGTGATAGCTTTTG (SEQ ID NO: 66)

EZH2_ex17.F CCTCTACCCTCGTTTCTGAACA (SEQ ID NO: 67)

EZH2_ex17.R CTTGGCTGTAGTGACCCTTTTT (SEQ ID NO: 68)

EZH2_ex18.F GGGGGTTAACTGACTTGTTCAC (SEQ ID NO: 69)

EZH2_ex18.R AGGCAAACCCTGAAGAACTGTA (SEQ ID NO: 70)

EZH2_ex19.F GGCAAAGTGACCCATCAAAA (SEQ ID NO: 71)

EZH2_ex19.R TGGACTTGAATACTTCTGGGATA (SEQ ID NO: 72)

EZH2_ex20.F CACTTTGCAGCTGGTGAGAA (SEQ ID NO: 73)

EZH2_ex20.R TGCACCCACTATCTTCAGCA (SEQ ID NO: 74)

[00114] Paired-end tag (PE100) sequencing was performed using an lllumina

HiSeq2000 machine. Sequencing reads were removed using lllumina's GA Pipeline (1.12.0 RTA 1.12.4.2). The remaining reads were mapped to the reference genome sequence (hg18) using BWA 0.5.7 (10). Duplicate reads and reads with a mapping score of zero were removed. The aligned reads were exported to pileup format and called using SAMtools 0.1.13 (11). Single nucleotide variants were filtered and variants with a minimum quality of 20 at varFilter parameter -D 1000 were retained. Small insertion/deletions, referred to as indels, were processed similarly using varFilter parameters -D 1000, -d 2 and -I. The variants were then imported into a local PostgreSQL database used to store and process human variation data (12). The filtered variants were annotated as "known" or "novel" depending on whether they had been previously reported in a public database, for example dbSNP (13) or the 1000 Genomes Project (14). Currently, the in-house local PostgreSQL database of normal germline genomes sequenced at the British Columbia Cancer Agency contains over 1.47 billion observed sequence variants mapping to 63.9 million unique base substitutions derived from over 1 ,360 individuals.

[00115] Variations that cause non-synonymous changes in protein-coding regions, and those that fell within two bases of exon boundaries were identified. The mutations within the exon boundaries may interfere with intron splicing. The exome sequencing results are shown in Table 4.

[00116] Table 4: Summary statistics of exome re-sequencing

^a - span of the human genome (hg18) covered by >1 read aligned with Phred-scaled mapping quality of > 10

b - reads having Phred-scaled mapping quality of > 10 and after duplicates are removed

c - average read depth of exons annotated in Ensembl 54; (sum of the number of reads aligned per site for all exonic sites) / (total number of exonic sites)

d - variants as output from [samtools.pl varFilter -D 1000 | awk '$6>=20'], excluding those in 5'UTR, 3'UTR, introns, and intergenic regions

e - variants include nsSNVs, splice-site SNVs within 2bp of exon boundaries, and small indels ^f - coding region insertions/deletions supported by > 6 aligned reads

⁹ - not previously reported in dbSNPI 29/130, 1000 Genomes Project, or other non-cancer genomes collected in the Genome Sciences Centre local database. For probands, the total of "novel" variants excludes those seen in their unaffected parents and represents de novo variants. Numbers in parentheses include apparently de novo variants seen at low coverage (i.e. fewer than 100 reads per variant).

[00117] In Proband 1 , a heterozygous c.457_459del (p.Tyr153del) variant in isoform A of EZH2 (RefSeq NM_004456.4) was identified. This variant was not seen in either of the parents of Proband 1 , indicating that this was a de novo mutation. Results are shown in

Figure 5A.

[00118] In Proband 2, a heterozygous de novo missense variant c.2080C>T

(p.His694Tyr) of the same gene was identified. This variant was not seen in either of the parents of Proband 2, indicating that this was a de novo mutation. Results are shown in

Figure 5B.

[00119] Each of these variants were seen at high coverage in both probands; in 121 out of 239 reads and in 153 out of 304 reads, respectively; but neither of the variants were seen in the parental EZH2 gene. The high coverage of the variants has a positive predictive value of about 100% for subsequent Sanger sequence verification. Next-generation sequencing did not find mutations in the NSD1 gene in Probands 1 , 2 and their respective parents, confirming the absence of mutations in NSD1 that might be associated with Weaver syndrome or Sotos syndrome.

[00120] The presence of both of the c.457_459del and c.2080C>T mutations and their de novo status was validated using Sanger sequencing. Results of the Sanger sequencing are illustrated in Figure 6.

[00121] After filtering out any parental variants, no other gene (including NSD1) demonstrated novel mutations in both of the probands as shown in Table 4. These novel mutations were not found in dbSNP, 1000 genomes project data, or among normal genomes (including the parents of the probands) sequenced in-house at the British Columbia Genome Science Centre (BCGSC). [00122] The presence of both of the c.457_459del and c.2080C>T mutations and their de novo status was validated using Sanger sequencing. Sanger confirmation of the c.457_459del mutation in Proband 1 , showing a heterozygous c.457_459del (p.Tyr153del) mutation in exon 5 of Proband 1 's EZH2 gene was as follows, with the missing nucleotides and amino acid indicated by the gaps the nucleic acid and amino acid sequences, respectively:

Reference DNA sequence (SEQ ID NO: 23):

414 TTTAGATCAG GATGGTACTT TCATTGAAGA ACTAATAAAA AATTATGATG 463 Patient DNA sequence (SEQ ID NO: 24):

414 TTTAGATCAG GATGGTACTT TCATTGAAGA ACTAATAAAA AAT GATG 463

Reference amino acid sequence (SEQ ID NO: 25): 139 L D Q D G T F I E E L I K N Y D G 155

Patient amino acid sequence (SEQ ID NO: 26): 139 L D Q D G T F I E E L I K N D G 155

[00123] Sanger confirmation of a heterozygous c.2080C>T (p.His694Tyr) mutation in exon 18 of Proband 2's EZH2 gene was as follows, with the nucleotide and amino acid substitution indicated in bold:

Reference DNA sequence (SEQ ID NO: 27):

2079 TCATTCGGTA AATCCAAACT GCTATGCAAA kGGTAGGTAC CTTTGACGTG +18 Patient DNA sequence (SEQ ID NO: 28):

2079 TTATTCGGTA AATCCAAACT GCTATGCAAA kGGTAGGTAC CTTTGACGTG +18

Reference amino acid sequence (SEQ ID NO: 29): 694 H S V N P N C Y A K 703

Patient amino acid sequence (SEQ ID NO: 30): 694 Y S V N P N C Y A K 703 [00124] PCR was conducted in a 96-well plate using the reagents and volumes specified in Table 5. The final volume of the PCR reaction was 25 μΙ_Λ βΙΙ. The PCR running conditions were as follows: a "hot start" at 94°C for 2 minutes (min), followed by 35 cycles of 94°C for 45 sec (denaturation step), 55°C for 1 min (primer annealing step, and 72°C for 1 min (amplification step). The 35 cycles were followed by a single extension step at 72°C for 10 min. At the end of PCR reaction, the PCR products were kept at 4°C until removed for storage at -20°C. The PCR products were then checked for size and specificity using gel electrophoresis (1.5% agarose gel containing SYBR® Safe DNA gel stain, run at 100V for approximately 1.5h). The PCR bands were visualized using a transilluminator and considered to be of high-quality if they were seen to be sharply-demarcated single fluorescent lines of the appropriate size. Diffuse lines, "smears" or PCR reactions that produced more than one line were considered inadequate, and the PCR conditions adjusted to improve the specificity of binding.

[00125] Upon confirming the PCR product, the concentration of PCR product was estimated using the brightness of the GeneRuler 100 bp DNA ladder bands (Fermentas; 0.1 μg/μL; 4 μΙ_Λ βΙΙ) as the reference. Enough PCR product was added to make the total amount of DNA in each well between 70 and 90 ng (for 300-500bp PCR products). Distilled water was added to make the volume up to 5 or 10 μΙ_Λ βΙΙ. Importantly, the amount of DNA per well was kept constant within the same 96-well plate. For purification, ExoSAP-IT® was added at a ratio of 2 μΙ ExoSAP-IT® to 5 μΙ of PCR product, and the plate containing PCR product was sealed by placing a sheet of heat sealing foil on the plate and using a manual microplate heat sealer (ABgene Thermo). The PCR products were then incubated at 37°C for 15 min followed by heating at 80°C for 15 min to inactivate the ExoSAP-IT enzymes (exonuclease I and shrimp alkaline phosphatase). The plate was centrifuged at 1 ,000 rpm for 1 min prior to removing the foil. Subsequently, 1.5 μΙ_ of 3.2 μΜ of the appropriate primer was added to each well, and the final volume was adjusted to 15 μΙ_Λ βΙΙ. Sequencing analysis was carried out using the same primers as were used for the PCR at the Child and Family Research Institute core DNA sequencing facility.

[00126] Table 5. Reagents used for preparing the PCR reaction mixture.

Distilled H₂0 2.00

Genomic DNA template 8 ng/μΙ. 6.25 2 ng/L L

Total volume 25.0

[00127] To further demonstrate that mutations in EZH2 are causative of Weaver syndrome, EZH2 was then analyzed in a third trio, proband 3 and both parents, using Sanger sequencing. A sample from Proband 3 had not been previously tested using the exome sequencing procedures described above. Using the Sanger sequencing technique, a c.394C>T (p.Pro132Ser) mutation was identified in Proband 3 (Figure 5C). This variant was not seen in either of the parents of Proband 3, indicating that this was a de novo mutation (Figure 5C). Sanger confirmation of a heterozygous c.394C>T (p.Pro132Ser) mutation in exon 5 of Proband 3's EZH2 gene was as follows, with the nucleotide and amino acid substitution indicated in bold:

Reference DNA sequence (SEQ ID NO: 31):

364 GTGGAAGATG AAACTGTTTT ACATAACATT CCTTATATGG GAGATGAAGT 413 Patient DNA sequence (SEQ ID NO: 32):

364 GTGGAAGATG AAACTGTTTT ACATAACATT TCTTGTATGG GAGATGAAGT 413

Reference amino acid sequence (SEQ ID NO: 33): 122 V E D E T V L H N I P Y M G D E V 138

Patient amino acid sequence (SEQ ID NO: 34): 122 V E D E T V L H N I S C M G D E V 138

[00128] To further demonstrate that mutations in EZH2 are causative of Weaver syndrome, EZH2 was then analyzed in a fourth trio, proband 4 and both parents, using Sanger sequencing. A sample from Proband 4 had not been previously tested using the exome sequencing procedures described above. Using the Sanger sequencing technique, a heterozygous c.398A>G (p.Tyr133Cys) mutation was identified in Proband 4. This variant was not seen in either of the parents of Proband 4, indicating that this was a de novo mutation. Results of the Sanger sequencing are as follows, with the nucleotide and amino acid substitution indicated in bold: Reference DNA sequence (SEQ ID NO: 31):

364 GTGGAAGATG AAACTGTTTT ACATAACATT CCTTATATGG GAGATGAAGT 413 Patient DNA sequence (SEQ ID NO: 35):

364 GTGGAAGATG AAACTGTTTT ACATAACATT CCTTGTATGG GAGATGAAGT 413

Reference amino acid sequence (SEQ ID NO: 33): 122VEDETVLH N I PYMG DEV 138

Patient amino acid sequence (SEQ ID NO: 36): 122VEDETVLH N I PCMG DEV 138

[00129] To further demonstrate that mutations in EZH2 are causative of Weaver syndrome, EZH2 was then analyzed in a fifth trio, proband 5 and both parents, using Sanger sequencing. Proband 5 had previously been published as having the clinical diagnosis of Weaver syndrome (36). A sample from Proband 5 had not been previously tested using the exome sequencing procedures described above. Using the well known Sanger sequencing technique, a heterozygous c.394C>T (p.Pro132Ser) mutation was identified in Proband 5. This variant was not seen in either of the parents of Proband 5, indicative that this was a de novo mutation. Although unrelated to proband 3, this patient has the same EZH2 mutation and also has Weaver syndrome. Results of the Sanger sequencing was as follows:

Reference DNA sequence (SEQ ID NO: 31):

364 GTGGAAGATG AAACTGTTTT ACATAACATT TCTTGTATGG GAGATGAAGT 413

Reference amino acid sequence (SEQ ID NO: 33): 122VEDETVLH N I PYMG DEV 138

Patient amino acid sequence (SEQ ID NO:34): 122VEDETVLH N ISCMG DEV 138

[00130] Example 3: Analysis of identified mutations

[00131] Deletions [00132] The c.457_459del (p.Tyr153del) mutation in Proband 1 lies 6 amino acid residues from the N-terminus of the SMART (Simple Modular Architecture Research Tool (15)) -predicted SANT (Switching-defective protein 3 (Swi3), Adaptor 2(Ada2), Nuclear receptor co-repressor (N-CoR), Transcription factor (TF)IIIB') domain illustrated in Figure 6 and annotated using the integrative protein signature database (16). The deletion of an entire amino acid (p.Tyr153del) in EZH2 removes a bulky polar residue near the putative SANT DNA-binding domain and causes functional consequences for the protein.

[00133] A phyloP (17) analysis was conducted to measure interspecies conservation at each variant position. The deleted codon, c.457_459, was found to be evolutionarily conserved. The placental mammalian genome-wide alignment-based phyloP score averaged across the three codon sites (chr7: 148, 157,778-80) was 1.59. This value was taken from the UCSC Genome Browser (18) conservation track for the hg18 assembly. A positive phyloP score is interpreted as a signature of evolutionary conservation, which is consistent with functional importance.

[00134] Substitutions

[00135] A Sorting Intolerant From Tolerant (SIFT) analysis (19, 20) was conducted to distinguish mutations involved in disease from neutral polymorphisms. The SIFT scores for the p.Pro132Ser, p.Tyr133Cys and p.His694Tyr mutations were all 0.00. Values of ≤0.05 are interpreted as "damaging" mutations. Using Polymorphism Phenotyping 2 (PolyPhen2 (21)) trained on the HumDiv dataset, the p.Pro132Ser and p.His694Tyr mutations were both predicted to be "probably damaging", and the p.Tyr133Cys mutation was predicted to be "possibly damaging," from the three possible outcomes of "benign", "possibly damaging", and "probably damaging".

[00136] The nucleotide site where Pro132 occurs (chr7: 148, 157,843 (build hg18) or chr7:148,526,910 (build hg19)) has a placental mammalian phyloP score of 3.17. The nucleotide site where Tyr133 occurs (chr7: 148,157,839 (build hg18) or chr7: 148,526,906 (build hg19)) has a placental mammalian phyloP score of 2.17. The nucleotide site

(chr7: 148, 137,365 (build hg18) or chr7: 148,506,432 (build hg19)) where His694 occurs has a score of 2.90. The positive phyloP scores are based on 46-way placental mammalian phylogeny, and suggest that these nucleotide sites are evolutionarily conserved, whereas a score near 0 suggests neutral selection.

[00137] The p.His694Tyr residue is located in the Su(var)3,9, Enhancer of zeste, Trithorax (SET) domain of EZH2. This residue is located within the "knot substructure" of the active site of the SET domain (22) and may form part of the binding domain for the enzymatic cofactor S-adenosyl-L-methionine (AdoMet). A three-dimensional model of human EZH2 p.His694Tyr was constructed using SWISS-MODEL (23) and ICM software (Molsoft(24)), based on the structure of the related protein euchromatic histone-lysine N-methyltransferase 1 , which was selected because of its lack of gaps and high resolution crystal structure (1.6 Angstroms; 25) as illustrated in Figure 7. The wild type histidine residue is shown as a dark gray pentagon, with the bulkier tyrosine depicted as a white hexagon immediately

underneath, for the purposes of comparison. The nearby binding site of the S- Adenosylmethionine cofactor is also shown. The conformation of the conserved histidine is highly similar across known crystal structures for the SET domain. Without being bound to any particular theory, because of the proximity of the histidine residue to the AdoMet binding site, the replacement of this histidine residue with a bulkier tyrosine side chain may interfere with cofactor binding and methyltransferase activity of the mutant molecule. [00138] Example 4: In vitro analysis of identified mutations

[00139] The p.His694Tyr mutation may affect the affinity of EZH2 for AdoMet. In turn, mutations in the protein coding region of the EZH2 gene, for example any of the four mutations described above, may affect the polycomb protein group (PcG)-dependent trimethylation on H3K27. In vitro studies have been conducted to demonstrate the effects of mutations in the protein coding region of the EZH2 gene.

[00140] Similar batches of active PRC2 complexes containing wild type EZH2 or mutant EZH2 were purchased from BPS Biosciences (CA, USA). Methytransferase assays were performed using a kit (17-330, Millipore) as per the manufacturer's instructions except where biotinylated peptides were used as substrates as previously published (38). Individual PRC2 complexes were separately incubated with 0.67 μΜ ³H-S-Adenosyl-methionine (SAM) (Perkin Elmer, MA, USA), 1 μΜ biotinylated peptide in 50mM Tris-HCI pH 9.0 and 0.5mM DTT for 30 min at 30°C in a 10 μΙ volume. Five microlitres was spotted on a P81 square paper (Millipore), washed (twice with 10% tricholoracetic acid and once with 100% ethanol) to remove unincorporated SAM, air-dried and placed in a glass scintillation vial with 5 ml of scintillation fluid (ScintiSafe Econol , Fisher Chemical) and counted on a 1900TR Liquid Scintillation Analyzer (Perkin Elmer, ON, CA).

[00141] Figure 8 shows in vitro functional studies of normal and mutant EZH2 proteins from patients with Weaver syndrome. The assay measures incorporation of radiolabeled methyl groups into core histones by G9a methylase (positive methylation control), wild-type EZH2 protein pre-assembled into the PRC2 complex (WT: normal activity control) and by three mutant forms of EZH2. Mutant EZH2 proteins show reduced enzymatic activity.

Artificially-produced EZH2 proteins P132S, delY153 and H694Y containing the same mutations as those identified in the three original probands with a clinical diagnosis of

Weaver syndrome show reduced enzymatic activity relative to the normal "wild-type" EZH2 protein.

[00142] Figures 9A-D show in vitro functional studies of normal (wild-type) and mutant EZH2 proteins from patients with Weaver syndrome. The assay measures the methylation activity of Weaver syndrome-associated EZH2 mutants preassembled into PRC2 complexes on peptide substrate 1-13(21-44). This peptide substrate is composed of amino acid residues 21-44 from human Histone H3 protein, which is the native target of EZH2 activity. Here, "meO" refers to the addition of the first methyl group on to the unmethylated peptide, "me1" refers to the conversion of monomethylated 1-13(21-44) to dimethylated 1-13(21-44) and "me2" refers to the conversion of dimethylated 1-13(21-44) to a trimethylated state. Weaver syndrome mutants show impaired activity on histone peptides (i.e. meO and me1) when compared with WT EZH2. WT EZH2 primarily adds the first and second methyl groups, but does not trimethylate the substrate in this assay. The P132S mutant retains a near-normal ability to add the first methyl group, but cannot add the second or third methyl groups. The dely153 and H694Y mutants show impaired ability to add the first methyl group, and cannot add the second or third methyl groups.

[00143] Figures 10A-D show in vitro functional studies of normal (wild-type) and mutant EZH2 proteins from patients with leukemia (9, 28). Leukemia-associated EZH2 mutants show constitutive methylation activity on peptide substrate 1-13(21-44), when preassembled into PRC2 complexes. Three different mutations of the tyrosine residue at position 641 (Y641 F, Y641 H and Y641S) abolish the methylation activity of EZH2 toward unmethylated and monomethylated 1-13(21-44), but create a novel activity not present in the wild-type protein. These mutations enhance the protein's ability to add a third methyl group on to a dimethylated substrate, such that the me2-to-me3 reaction proceeds more easily. These data demonstrate that the assay can detect differences in methylation activity of the EZH2 protein, and can correctly classify functional variants into those consistent with constitutive Weaver syndrome mutations versus those consistent with somatic leukemia mutations. [00144] Figures 11 A-E shows in vitro functional studies of normal (wild-type) and other reported mutant EZH2 proteins (37, 38). Weaver syndrome-associated EZH2 mutants preassembled into PRC2 complexes have diminished methylation activity on peptide substrate 1-13(21-44). Weaver syndrome mutants R684C (identified in multiple cases of Weaver syndrome), A682T and E745K (identified in Weaver syndrome patients with cancer) show impaired activity on histone peptides when compared with WT EZH2. The F672I mutant was chosen as a negative control (37).

[00145] Example 5: Analysis of EZH2 mutations

[00146] It is clear from the resulting phenotypes that EZH2 mutations and structural EZH2 variants may affect developmentally-important pathways. Several patients with deletions and duplications encompassing EZH2 are reported in the DECIPHER database (30). One patient having a duplication (DECIPHER patient 250841) manifests

macrocephaly. There is little other concordance between the DECIPHER phenotypes, apart from intellectual disability, and Probands 1 , 2 3, 4 and 5. This lack of concordance is likely attributable to the multiple other genes that are affected by these structural variants of EZH2. Furthermore, EZH2 protein variants expressed in Probands 1 , 2 3, 4 and 5 may act through molecular mechanisms other than haploinsufficiency; subtle but important changes in specific subfunctions of EZH2 are known to occur in association with specific protein variants.

[00147] The de novo mutations in EZH2 in each of the five families, including one of the original families that led to the definition of the disorder, taught in the present disclosure are indicative of the Applicant's surprising discovery that mutations in the protein-coding region of the EZH2 gene are indicative of a propensity toward a diagnosis of Weaver syndrome.

[00148] Example 5: SET-domain properties of EZH2

[00149] SET-domain proteins in molecular networks may, when perturbed, cause intellectual disability syndromes and/or cancer. Mutations in NSD1 are known to cause Sotos syndrome and have been linked to Weaver syndrome (4, 5, 6) and mutations in MLL2, which also bears a SET domain, are known to cause Kabuki syndrome (34). For example, NSD1 mutations in Weaver syndrome appear to cluster toward the C-terminus of the molecule, 5' of the SET domain, though one frameshift mutation in exon 5 and one mutation within the SET domain itself have been reported.

[00150] Histone-modifying proteins such as NSD1 , EZH2 and MLL2 appear repeatedly as targets of somatic mutation in hematological malignancies (35) and are emerging as a related cause of neurodevelopmental disorders. Detailed study of larger cohorts of well- phenotyped probands may assist in the determination of the prevalence of mutations in other SET-domain proteins in Weaver syndrome as well as other syndromes. In turn, the prevalence of mutations in EZH2 may assist in determination of the consequences on metabolism and cancer risk.

[00151] Example 6: Analysis of Weaver syndrome

[00152] Routine surveillance in subjects having Weaver syndrome for potential metabolic and neoplastic complications related to this rare disorder may identify treatable comorbidities that respond to treatments that improve the activity of EZH2. For example, screening for diabetes, cancer or myopathy, beyond what would ordinarily be performed in pediatric and adult practice may be useful in Weaver syndrome. Data compiled from long- term follow-up of adult individuals having Weaver syndrome may assist physicians in deciding the optimal time to screen for potential metabolic and neoplastic complications. Dietary supplementation with methionine (or with other methyl donors such as betaine and choline) is useful to improve the activity of EZH2 variants.

[00153] In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required.

[00154] The above-described embodiments are intended to be examples only.

Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art without departing from the scope, which is defined solely by the claims appended hereto.

REFERENCES:

[00155] 1. Weaver, D.D., Graham, C.B., Thomas, IT., and Smith, D.W. (1974). A new overgrowth syndrome with accelerated skeletal maturation, unusual fades, and

camptodactyly. J Pediatr 84, 547-552. [00156] 2. Fryer, A., Smith, C, Rosenbloom, L, and Cole, T. (1997). Autosomal dominant inheritance of Weaver syndrome. J Med Genet 34, 418-419.

[00157] 3. Proud, V.K., Braddock, S.R., Cook, L, and Weaver, D.D. (1998). Weaver syndrome: autosomal dominant inheritance of the disorder. Am J Med Genet 79, 305-310.

[00158] 4. Douglas, J., Hanks, S., Temple, I.K., Davies, S., Murray, A., Upadhyaya, M., Tomkins, S., Hughes, H.E. , Cole, T.R., and Rahman, N. (2003). NSD1 mutations are the major cause of Sotos syndrome and occur in some cases of Weaver syndrome but are rare in other overgrowth phenotypes. Am J Hum Genet 72, 132-143.

[00159] 5. Rio, M., Clech, L, Amiel, J., Faivre, L, Lyonnet, S., Le Merrer, M., Odent, S., Lacombe, D., Edery, P., Brauner, R., et al. (2003). Spectrum of NSD1 mutations in Sotos and Weaver syndromes. J Med Genet 40, 436-440.

[00160] 6. Baujat, G., Rio, M., Rossignol, S., Sanlaville, D., Lyonnet, S., Le Merrer, M., Munnich, A., Gicquel, C, Colleaux, L., and Cormier-Daire, V. (2005). Clinical and molecular overlap in overgrowth syndromes. Am J Med Genet C Semin Med Genet 137C, 4-1 1.

[00161] 7. Bamshad, M.J., Ng, S.B., Bigham, A.W., Tabor, H.K., Emond, M.J., Nickerson, D.A., and Shendure, J. (201 1). Exome sequencing as a tool for Mendelian disease gene discovery. Nat Rev Genet 12, 745-755.

[00162] 8. lafrate, A.J., Feuk, L, Rivera, M.N., Listewnik, M.L., Donahoe, P.K., Qi, Y., Scherer, S.W., and Lee, C. (2004). Detection of large-scale variation in the human genome. Nat Genet 36, 949-951.

[00163] 9. Morin, R.D., Johnson, N.A., Severson, T.M., Mungall, A.J., An, J., Goya, R., Paul, J.E., Boyle, M., Woolcock, B.W., Kuchenbauer, F., et al. (2010). Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nat Genet 42, 181-185.

[00164] 10. Li, H., and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760.

[00165] 1 1. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., and Durbin, R. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079.

[00166] 12. Fejes, A.P., Khodabakhshi, A.H., Birol, I., and Jones, S.J. (201 1). Human variation database: an open-source database template for genomic discovery. Bioinformatics 27, 1155-1 156. [00167] 13. Sherry, ST., Ward, M.H. , Kholodov, M., Baker, J., Phan, L, Smigielski, E.M., and Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic acids research 29, 308-31 1.

[00168] 14. Marth, G.T., Yu, F., Indap, A.R., Garimella, K., Gravel, S., Leong, W.F., Tyler-Smith, C, Bainbridge, M., Blackwell, T., Zheng-Bradley, X., et al. (2011). The functional spectrum of low-frequency coding variation. Genome Biol 12, R84.

[00169] 15. Letunic, I., Doerks, T., and Bork, P. (201 1). SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res.

[00170] 16. Hunter, S., Apweiler, R., Attwood, T.K., Bairoch, A., Bateman, A. , Binns, D., Bork, P., Das, U., Daugherty, L , Duquenne, L, et al. (2009). InterPro: the integrative protein signature database. Nucleic Acids Res 37, D211-215.

[00171] 17. Pollard, K.S., Hubisz, M.J., Rosenbloom, K.R., and Siepel, A. (2010). Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res 20, 1 10- 121.

[00172] 18. Fujita, P.A., Rhead, B., Zweig, A.S., Hinrichs, A.S., Karolchik, D., Cline, M.S., Goldman, M., Barber, G.P., Clawson, H., Coelho, A., et al. (2011). The UCSC Genome Browser database: update 201 1. Nucleic Acids Res 39, D876-882.

[00173] 19. Kumar, P., Henikoff, S., and Ng, P.C. (2009). Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 4, 1073-1081.

[00174] 20. Ng, P.C, and Henikoff, S. (2003). SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res 31 , 3812-3814.

[00175] 21. Adzhubei, I.A., Schmidt, S., Peshkin, L, Ramensky, V.E., Gerasimova, A., Bork, P., Kondrashov, A.S., and Sunyaev, S.R. (2010). A method and server for predicting damaging missense mutations. Nat Methods 7, 248-249.

[00176] 22. Jacobs, S.A., Harp, J.M., Devarakonda, S., Kim, Y. , Rastinejad, F., and Khorasanizadeh, S. (2002). The active site of the SET domain is constructed on a knot. Nat Struct Biol 9, 833-838.

[00177] 23. Arnold, K., Bordoli, L, Kopp, J., and Schwede, T. (2006). The SWISS- MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195-201. [00178] 24. Abagyan, R.A., Totrov, M.M., and Kuznetsov, D.A. (1994). ICM: A New Method For Protein Modeling and Design: Applications To Docking and Structure Prediction From The Distorted Native Conformation. J Comp Chem 15, 488-506.

[00179] 25. Wu, H., Min, J., Lunin, V.V., Antoshenko, T., Dombrovski, L, Zeng, H., Allali-Hassani, A., Campagna-Slater, V., Vedadi, M., Arrowsmith, C.H., et al. (2010).

Structural biology of human H3K9 methyltransferases. PLoS One 5, e8570.

[00180] 26. Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B.D., Sun, Z.W., Schmid, M., Opravil, S., Mechtler, K., Ponting, CP., Allis, CD., et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406, 593-599.

[00181] 27. Makishima, H., Jankowska, A.M., Tiu, R.V., Szpurka, H., Sugimoto, Y., Hu, Z., Saunthararajah, Y., Guinta, K., Keddache, M.A., Putnam, P., et al. (2010). Novel homo- and hemizygous mutations in EZH2 in myeloid malignancies. Leukemia 24, 1799- 1804.

[00182] 28. Yap, D.B., Chu, J., Berg, T., Schapira, M., Cheng, S.W., Moradian, A., Morin, R.D., Mungall, A.J., Meissner, B., Boyle, M., et al. (201 1). Somatic mutations at EZH2 Y641 act dominantly through a mechanism of selectively altered PRC2 catalytic activity, to increase H3K27 trimethylation. Blood 1 17, 2451-2459.

[00183] 29. Basel-Vanagaite, L. (2010). Acute lymphoblastic leukemia in Weaver syndrome. Am J Med Genet A 152A, 383-386.

[00184] 30. Firth, H.V., Richards, S.M., Bevan, A. P., Clayton, S., Corpas, M., Rajan, D., Van Vooren, S., Moreau, Y., Pettett, R.M., and Carter, N.P. (2009). DECIPHER:

Database of Chromosomal Imbalance and Phenotype in Humans Using EnsembI Resources. Am J Hum Genet 84, 524-533.

[00185] 31. Wyngaarden, L.A., Delgado-Olguin, P., Su, I.H. , Bruneau, B.G., and Hopyan, S. (201 1). Ezh2 regulates anteroposterior axis specification and proximodistal axis elongation in the developing limb. Development 138, 3759-3767.

[00186] 32. Chen, H., Gu, X., Su, I.H., Bottino, R., Contreras, J.L., Tarakhovsky, A., and Kim, S.K. (2009). Polycomb protein Ezh2 regulates pancreatic beta-cell Ink4a/Arf expression and regeneration in diabetes mellitus. Genes Dev 23, 975-985.

[00187] 33. Juan, A. H. , Derfoul, A., Feng, X., Ryall, J.G., Dell'Orso, S., Pasut, A., Zare, H., Simone, J.M., Rudnicki, M.A., and Sartorelli, V. (201 1). Polycomb EZH2 controls self-renewal and safeguards the transcriptional identity of skeletal muscle stem cells. Genes Dev 25, 789-794. [00188] 34. Ng, S.B., Bigham, A.W., Buckingham, K.J., Hannibal, M.C., McMillin, M.J., Gildersleeve, H.I., Beck, A.E., Tabor, H.K., Cooper, G.M., Mefford, H.C., et al. (2010). Exome sequencing identifies MLL2 mutations as a cause of Kabuki syndrome. Nat Genet 42, 790- 793.

[00189] 35. Morin, R.D., Mendez-Lago, M., Mungall, A. J., Goya, R., Mungall, K.L., Corbett, R.D., Johnson, N.A., Severson, T.M., Chiu, R., Field, M. , et al. (201 1). Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma. Nature 476, 298-303.

[00190] 36. Huffman C, McCandless D, Jasty R, Matloub J, Robinson HB, Weaver DD, Cohen MM Jr. Weaver syndrome with neuroblastoma and cardiovascular anomalies. Am J Med Genet. 2001 Mar 15;99(3):252-5.

[00191] 37. Joshi et al., Dominant alleles identify SET domain residues required for histone methyltransferase of Polycomb repressive complex 2. J. Biol. Chem. 283(41) Oct 2008 pp 27757-27766

[00192] 38. Tatton-Brown et al., Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height Oncotarget vol 2, pp 1 127-1 133, Dec 21 , 201 1)

[00193] 39. Tan J, Yang X, Zhuang L, Jiang X, Chen W, Lee PL, Karuturi RK, Tan PB, Liu ET, Yu Q. Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells. Genes Dev. 2007 May

1 ;21 (9): 1050-63. Epub 2007 Apr 16.

[00194]

[00195] 40. Croonquist and Van Ness (2005) Oncogene (2005) 24, 6269-6280, and Kuzmichev A, Nishioka K, Erdjument-Bromage H, Tempst P & Reinberg D. (2002) Genes Dev. 16: 2893-2905.

[00196] 41. Tonini T, D'Andrilli G, Fucito A, Gaspa L, Bagella L. Importance of Ezh2 polycomb protein in tumorigenesis process interfering with the pathway of growth

suppressive key elements. J Cell Physiol. 2008 Feb;214(2):295-300.

[00197] 42. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 2003,

Claims

What is claimed is:

1. A method of diagnosing Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject, the method comprising:

providing a test sample comprising an EZH2 nucleic acid molecule from the subject; assaying the test sample for at least one mutation in the EZH2 nucleic acid molecule; and

detecting at least one rare, non-conservative mutation in the EZH2 nucleic acid molecule, wherein the presence of at least one detected mutation in the EZH2 nucleic acid molecule is diagnostic for Weaver syndrome or a genetic predisposition for developing Weaver syndrome in the subject.

2. A method of screening a subject for risk of Weaver syndrome, the method comprising:

providing a test sample comprising an EZH2 nucleic acid molecule from the subject; detecting the presence or absence of at least one rare, non-conservative mutation in the EZH2 nucleic acid molecule in the test sample; and

determining that the subject is at an increased risk of Weaver syndrome due to the presence of the detected mutation in the EZH2 nucleic acid molecule.

3. The method of claim 1 or 2 wherein the detected mutation is a de novo mutation or a nonsynonymous mutation.

4. The method of any one of claims 1 to 3 wherein the detected mutation is selected from one or more of the group consisting of:

a deletion of at least three or more bases wherein the deletion includes nucleotides

457 to 459 of the coding region of the EZH2 gene or a homologous region thereof;

a deletion of a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the coding region of the EZH2 gene or a homologous region thereof and the deletion is at about amino acid 153;

a missense variant in a knot substructure of the active site of the coding region of the

EZH2 gene or a homologous region thereof;

a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide; a substitution of a HIS amino acid with a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 694 or a homologous region thereof;

a missense variant at about nucleotide 394 of the coding region of the EZH2 gene or a homologous region thereof;

a substitution of a PRO amino acid with a SER amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 132 or a homologous region thereof;

a missense variant at about nucleotide 398 of the coding region of the EZH2 gene or a homologous region thereof;

a substitution of a TYR amino acid with a CYS amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 133 or a homologous region thereof;

a modification of an amino acid involved in histone methylation activity;

a deletion of three bases at positions 457-459 of SEQ ID NO: 2;

a deletion of one amino acid at position 153 of SEQ ID NO: 3;

a substitution of one nucleotide at position 2080 of SEQ ID NO: 2;

a substitution of one amino acid at position 694 of SEQ ID NO: 3;

a substitution of one nucleotide at position 394 of SEQ ID NO: 2;

a substitution of one amino acid at position 132 of SEQ ID NO: 3;

a substitution of one nucleotide at position 398 of SEQ ID NO: 2; and

a substitution of one amino acid at position 133 of SEQ ID NO: 3.

5. The method of any one of claims 1 to 3 wherein the detected mutation is in the SET domain or is adjacent to the SANT domain of an EZH2 polypeptide.

6. The method of any one of claims 1 to 3 wherein the detected mutation is in exon 5 or exon 18 of the EZH2 gene.

7. The method of any one of claims 1 to 6 wherein the test sample comprises genomic DNA.

8. The method of any one of claims 1 to 7 wherein the test sample comprises chromosomal DNA.

9. The method of any one of claims 1 to 7 wherein the test sample comprises the EZH2 gene or fragment thereof.

10 The method of any one of claims 1 to 8 wherein assaying the test sample comprises amplifying all or a fragment of the EZH2 nucleic acid molecule sequence to produce an amplification product.

1 1. The method of claim 10 wherein assaying the test sample comprises analysing the amplification product to detect the presence of a mutation in the EZH2 nucleic acid molecule sequence

12. The method of claim 1 1 wherein the analysing the amplification product comprises digesting the amplification product with a restriction enzyme and sequencing a restriction fragment.

13. The method of claim 1 1 wherein the analysing the amplification product comprises sequencing the amplification product.

14. The method of any one of claims 1 to 9 wherein the detecting comprises direct sequence analysis.

15. The method of any one of claims 1 to 14 wherein said detecting comprises detecting the rare, non-conservative mutation in at least one genomic copy of the EZH2 gene.

16. The method of any one of claims 1 to 15 wherein said detecting further comprises detecting whether the subject is homozygous for the detected mutation

17. The method of any one of claims 1 to 15 wherein said detecting further comprises detecting whether the subject is heterozygous for the detected mutation.

18. The method of any one of claims 1 to 17 wherein the subject is a human.

19. A kit for diagnosing Weaver syndrome, the kit comprising an oligonucleotide that specifically hybridizes to or adjacent to a site of mutation of an EZH2 gene and instructions for use.

20. The kit of claim 19 wherein the site of mutation is selected from one or more of the group consisting of:

a deletion of at least three or more bases wherein the deletion includes nucleotides 457 to 459 of the coding region of the EZH2 gene or a homologous region thereof;

a missense variant in a knot substructure of the active site of the coding region of the EZH2 gene or a homologous region thereof; a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide;

a substitution of a HIS amino acid with a TYR amino acid in a polypeptide sequence corresponding to the nucleotide sequence of the protein coding region of the EZH2 gene at about amino acid 694 or a homologous region thereof;

a modification of an amino acid involved in histone methylation activity;

a deletion of three bases at positions 457-459 of SEQ ID NO: 2;

a deletion of one amino acid at position 153 of SEQ ID NO: 3;

a substitution of one nucleotide at position 2080 of SEQ ID NO: 2;

a substitution of one amino acid at position 694 of SEQ ID NO: 3;

a substitution of one nucleotide at position 394 of SEQ ID NO: 2;

a substitution of one amino acid at position 132 of SEQ ID NO: 3;

a substitution of one nucleotide at position 398 of SEQ ID NO: 2; and

a substitution of one amino acid at position 133 of SEQ ID NO: 3.

21. The kit of claim 19 or 20 comprising at least one oligonucleotide comprising the site of mutation.

22. The kit of claim 19 comprising a first oligonucleotide primer comprising at least fifteen (15) oligonucleotides of SEQ ID NOs: 1 or 2 and a second oligonucleotide primer comprising at least fifteen (15) oligonucleotides of a sequence complementary to SEQ ID NOs: 1 or 2.

23. The kit of claim 19 comprising an oligonucleotide primer pair as set forth in Table 3.

24. The kit of any one of claims 19 to 23, further comprising an oligonucleotide that specifically hybridizes to or adjacent to a site of mutation of an NSD1 gene and instructions for use.

25. The kit of claim 24 comprising an oligonucleotide primer pair as set forth in Table 2.

26. A method of diagnosing Weaver syndrome or a genetic predisposition for developing

Weaver syndrome in a subject, the method comprising:

providing a test sample comprising an EZH2 polypeptide from the subject;

assaying the test sample for at least one mutation in the EZH2 polypeptide; and detecting at least one mutation in the EZH2 polypeptide, wherein the detected mutation affects the function of an EZH2 polypeptide, and wherein the presence of at least one detected mutation in the EZH2 polypeptide is diagnostic for Weaver syndrome or a genetic predisposition for developing Weaver syndrome in the subject.

27. The method of claim 26 wherein the mutation is of an amino acid involved in histone methylation activity.

28. The method of claim 26 or 27 wherein the mutated EZH2 polypeptide has an altered methylation activity compared to a basal level of activity of an EZH2 polypeptide of SEQ ID NO:3.

29. The method of any one of claims 26 to 28 wherein the mutation in the EZH2 polypeptide is selected from one or more of the group consisting of:

a deletion of a TYR amino acid at about amino acid 153;

a substitution of a HIS amino acid at about amino acid 694;

a substitution of a PRO amino acid at about amino acid 132;

a substitution of a TYR amino acid at about amino acid 133;

a deletion of one amino acid at position 153 of SEQ ID NO: 3;

a substitution of one amino acid at position 694 of SEQ ID NO: 3;

a substitution of one amino acid at position 132 of SEQ ID NO: 3; and

a substitution of one amino acid at position 133 of SEQ ID NO: 3.

30. The method of any one of claims 26 to 29 wherein the assaying the test sample comprises a histone methylation assay.

31. The method of any one of claims 26 to 30 wherein the detecting comprises detecting methylation activity.

32. The method of any one of claims 26 to 31 wherein the detecting comprises an antibody that specifically binds the site of mutation.

33. The method of any one of claims 26 to 32 wherein the subject is a human.

34. A kit for diagnosing Weaver syndrome, comprising an antibody that specifically recognizes a mutation in an EZH2 polypeptide that correlates to Weaver syndrome; and instructions for use.

35. An isolated EZH2 polypeptide variant, or an isolated nucleic acid encoding the isolated EZH2 polypeptide variant, comprising a mutation correlated to Weaver syndrome, wherein the mutation is selected from one or more of the group consisting of:

a missense variant in a knot substructure of the active site of the coding region of the EZH2 gene or a homologous region thereof;

a missense variant at about nucleotide 2080 of the coding region of the EZH2 gene or a homologous region thereof and corresponding to the substitution of a C nucleotide with a T nucleotide;

a modification of an amino acid involved in histone methylation activity;

a deletion of three bases at positions 457-459 of SEQ ID NO: 2;

a deletion of one amino acid at position 153 of SEQ ID NO: 3; a substitution of one nucleotide at position 2080 of SEQ ID NO: 2;

a substitution of one amino acid at position 694 of SEQ ID NO: 3;

a substitution of one nucleotide at position 394 of SEQ ID NO: 2;

a substitution of one amino acid at position 132 of SEQ ID NO: 3;

a substitution of one nucleotide at position 398 of SEQ ID NO: 2; and

a substitution of one amino acid at position 133 of SEQ ID NO: 3.

36. A host cell, comprising an expression vector, wherein the vector comprises a nucleic acid molecule operably linked to an expression control sequence, wherein the nucleic acid molecule encodes an isolated EZH2 polypeptide variant according to claim 33.

37. A method of treating a subject diagnosed with Weaver syndrome or at risk for Weaver syndrome, the method comprising administering an effective amount of methionine, S-Adenosyl-L-methionine, S-adenosyl-L-homocysteine, betaine, choline, or combinations thereof to the subject, wherein the subject has a mutation in an EZH2 polypeptide and wherein the mutation affects methylation activity.

38. A method of treating a subject diagnosed with Weaver syndrome or at risk for Weaver syndrome, the method comprising administering an effective amount of an agent that modulates the activity of a mutated EZH2 polypeptide to the subject, wherein the subject has a mutation in the EZH2 nucleic acid molecule that encodes a mutated EZH2 polypeptide.

39. The method of claim 37 or 38 wherein the subject is a human.

40. A method for screening for a candidate compound for treating Weaver syndrome, the method comprising:

providing a mutated EZH2 polypeptide, or a nucleic acid molecule encoding the mutated EZH2 polypeptide, wherein the mutation correlates to Weaver syndrome;

contacting the mutated EZH2 polypeptide, or the nucleic acid molecule encoding the mutated EZH2 polypeptide, with a test compound; and

determining whether the test compound specifically binds the site of mutation or modulates the activity of the mutated EZH2 polypeptide, when compared to the binding or activity of a wild type EZH2 polypeptide,

wherein the test compound is a candidate compound for treating Weaver syndrome if the test compound specifically binds the site of mutation or exhibits an altered activity when compared to the wild type EZH2 polypeptide.

41. The method of claim 40 wherein the test compound is an antisense oligonucleotide or siRNA.

42. The method of claim 40 wherein the test compound is an antibody or fragment thereof.

43. The method of claim 40 wherein the test compound increases the activity of the EZH2 polypeptide.

44. Use of the isolated EZH2 polypeptide variant, or an isolated nucleic acid encoding the isolated EZH2 polypeptide variant, of claim 35 for diagnosis of Weaver syndrome or a genetic predisposition for developing Weaver syndrome in a subject in need thereof.