CN108441515B - Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat - Google Patents
Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat Download PDFInfo
- Publication number
- CN108441515B CN108441515B CN201810361398.XA CN201810361398A CN108441515B CN 108441515 B CN108441515 B CN 108441515B CN 201810361398 A CN201810361398 A CN 201810361398A CN 108441515 B CN108441515 B CN 108441515B
- Authority
- CN
- China
- Prior art keywords
- dhcr24
- interference
- sidhcr24
- fragment sequence
- recombinant adenovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a recombinant adenovirus interference vector containing an interference fragment sequence of a targeting DHCR24 gene and application thereof in reducing blood fat. DHCR24 is an enzyme of the last step in endogenous synthesis of cholesterol, and the recombinant adenovirus interference vector Ad-SiDHCR24 can target the DHCR24 gene and interfere the expression of the DHCR24 gene, thereby reducing the biosynthesis of cellular cholesterol. The invention shows that Ad-SiDHCR24 interferes the expression of a target gene DHCR24 at the cellular and animal level, can reduce cholesterol at the cellular level, and can play a remarkable blood fat reducing effect in a mouse hyperlipidemia model of an animal experiment.
Description
Technical Field
The invention relates to a recombinant adenovirus interference vector Ad-SiDHCR24 containing an interference fragment sequence of a targeting DHCR24 gene, and application of the recombinant adenovirus interference vector in preparation of a medicament for preventing and treating hyperlipidemia diseases.
Background
Hyperlipidemia is manifested by elevated blood cholesterol, ldl, and triglyceride levels and elevated blood ldl levels relative to normal, which are important risk factors for atherosclerosis and cardiovascular disease. Thus, lowering cholesterol has been the primary treatment for this group of diseases.
Low Density Lipoprotein (LDL) is an independent risk factor for assessing hyperlipidemia, and LDL transports cholesterol in the liver or intestinal tract to tissues. Since LDL contains high levels of cholesterol, when plasma LDL levels are increased, they can accumulate in the arterial wall, leading to increased risk of coronary artery disease and heart attack. LDL is therefore considered to be "harmful cholesterol".
Statins are traditional classical cholesterol lowering drugs, which are inhibitors of the rate-limiting enzyme HMG-COA reductase in the synthesis of cholesterol by blocking the pathway for the conversion of the substrate HMG-COA to mevalonate. Although statins have been shown worldwide to reduce the risk of cardiovascular disease development, there are a number of patients who either fail to achieve the desired LDL-C (LDL cholesterol) level or who discontinue treatment due to side effects. On the other hand, traditional non-statins such as nicotinic acid, bile acid sequestrants, fibrates and omega-3 fatty acids are widely controversial for hypolipidemic therapy due to lack of strong evidence of reduced risk of cardiovascular disease. Therefore, the need for developing new cholesterol lowering drugs is still urgent.
SiRNA (Small interfering RNA) is a small RNA molecule processed from Dicer (active endonuclease specific to double-stranded RNA in RNAase III family). The siRNA binds to its complementary target mRNA, resulting in silencing of the target gene. By using the theory that siRNA interferes with its homologous target gene, the complementary DNA sequence of siRNA is often used as a tool or a drug to achieve the purpose of treating some diseases by interfering its homologous gene to down-regulate its expression. However, siRNA is directed against a single RNA target sequence of its target gene alone, which is likely to cause off-target effect of RNA interference.
There are three methods for the in vitro preparation of siRNAs, chemical synthesis, in vitro transcription and siRNA preparation by digestion of long-fragment dsRNA with RNaseIII. The chemical synthesis method is suitable for the condition that the most effective siRNA is found, and a large amount of siRNA is needed for research, but the chemical synthesis method is not suitable for long-time research such as siRNA screening due to higher price and long customization period. The in vitro transcription method takes DNA Oligo as a template, synthesizes siRNAs through in vitro transcription, has lower cost compared with the chemical synthesis method, and can obtain the siRNAs faster than the chemical synthesis method. The siRNAs obtained by the method have low toxicity, good stability and high efficiency, and the effect which can be achieved by chemically synthesizing siRNA can be achieved only by 1/10 which is the amount of chemically synthesized siRNA, so that the transfection efficiency is higher. The disadvantage is that the scale of the experiment is limited, and although one in vitro transcription synthesis can provide siRNAs sufficient for hundreds of transfections, the scale and amount of the reaction are always limited. And still requires considerable time for researchers to spend in comparison to chemical synthesis. The major advantage of dsRNA digestion is that the steps of detecting and screening for effective siRNA sequences can be skipped, saving time and money for researchers. However, the disadvantage of this approach is also apparent in that it is possible to elicit non-specific gene silencing, particularly homologous or closely related genes.
All three of the above in vitro preparation methods require specialized RNA transfection reagents to transfer siRNAs into cells. The siRNAs can be obtained by in vivo transcription from a DNA template transfected to cells by adopting the siRNA expression vector without directly operating RNA. Most siRNA expression vectors rely on one of three RNA polymerase III promoters (pol III) to manipulate the expression of a small hairpin RNA (shRNA) in mammalian cells. These three types of promoters include the well-known U6 and H1 promoters of human and murine origin. The RNA pol III promoter is used because it can express more small RNA molecules in mammalian cells and it terminates transcription by adding a string (3-6) of U. To use such vectors, 2 DNA strands encoding short hairpin RNA sequences are ordered, annealed, and cloned downstream of the pol III promoter in the corresponding vector. This process takes weeks or even months as cloning is involved, and also requires sequencing to ensure that the cloned sequence is correct. The advantage of siRNA expression vectors is that longer term studies can be performed-vectors with antibiotic markers can continue to suppress target gene expression in cells for weeks or even longer. The viral vector can also be used for siRNA expression, and has the advantages that cells can be directly infected with high efficiency to research gene silencing, various inconveniences caused by low plasmid transfection efficiency are avoided, and the transfection effect is more stable.
Adenovirus (AV) is a double-stranded DNA virus, a large molecule of about 36 kb. The modified replication-defective adenovirus can be used as a gene transfer vector, enters cells through receptor-mediated endocytosis, and the genome of the modified replication-defective adenovirus is transferred into the cell nucleus and is kept in a chromosome without being integrated into the genome of a host cell. Recombinant adenoviruses have a number of advantages as gene transfer vectors, such as: the viral vector has large capacity and is not integrated into a chromosome; homology to human genes; high gene transfer efficiency and safety to human body. Thus, recombinant adenoviral vectors are also frequently used as vectors for generating siRNA interference sequences targeted to specific sequences of interest.
Disclosure of Invention
24-dehydrocholesterol reductase (3 β -Hydroxysterol Δ 24-reductase, DHCR24) is an enzyme required for the last step in cholesterol biosynthesis. DHCR24 catalyzes the reduction of all lanosterol and desmosterol intermediates Δ 24 bonds, in particular the reduction of lanosterol to dihydrolanosterol and desmosterol to cholesterol. Therefore, the interference of the expression of DHCR24 can reduce the synthesis of endogenous cholesterol, thereby reducing the cholesterol level in blood plasma and achieving the effect of preventing and treating hyperlipidemia.
The invention aims to provide four SiRNA recombinant adenoviruses targeting DHCR24 genes so as to interfere the expression of DHCR 24.
The technical scheme adopted by the invention is as follows: the recombinant adenovirus interference vector containing the interference fragment sequence of the targeting DHCR24 gene is prepared by packaging the interference fragment sequence into Ad5 replication-defective adenovirus through a genetic engineering technology to construct a recombinant adenovirus interference vector Ad-siDHCR 24; the interference fragment sequence comprises a DHCR24 interference fragment sequence 1, a DHCR24 interference fragment sequence 2, a DHCR24 interference fragment sequence 3 and a DHCR24 interference fragment sequence 4.
The sequence of the DHCR24 interference fragment sequence 1 is as follows:
sense strand: AGCACAGGCATCGAGTCATCTTTT
Antisense strand: AGATGACTCGATGCCTGTGCTTTT
The sequence of the DHCR24 interference fragment sequence 2 is as follows:
sense strand: AGCACGGGTTCCAAATGTTATTTT
Antisense strand: ATAACATTTGGAACCCGTGCTTTT
The sequence of the DHCR24 interference fragment sequence 3 is as follows:
sense strand: AGCGCCTGGGTGGTGTTCAATTTT
Antisense strand: ATTGAACACCACCCAGGCGCTTTT
The sequence of the DHCR24 interference fragment sequence 4 is as follows:
sense strand: AACTCAGACTGTTCTATGCTTTT
Antisense strand: AGCATAGAACAGTCTGAGTTTTT are provided.
The recombinant adenovirus interference vector containing the interference fragment sequence of the targeting DHCR24 gene is characterized in that the Ad5 replication-defective adenovirus is an AD293 cell.
The preparation method of the recombinant adenovirus interference vector containing the interference fragment sequence targeting the DHCR24 gene comprises the following steps:
1) annealing the sense strand and the antisense strand of the DHCR24 interference fragment sequence 1, the DHCR24 interference fragment sequence 2, the DHCR24 interference fragment sequence 3 and the DHCR24 interference fragment sequence 4 respectively, and then connecting the annealed strands with a shuttle plasmid vector pSES1 by using T4 ligase to obtain four pSES1-DHCR24siRNA recombinant plasmids respectively;
2) respectively transforming the four pSES1-DHCR24siRNA recombinant plasmids into escherichia coli competent cells, selecting pSES1-DHCR24siRNA without mutation verified by sequencing, carrying out amplification and purification, and carrying out enzyme digestion by using Pme1 to respectively obtain four linearized recombinant plasmids;
3) respectively transforming the four linearized recombinant plasmids into BJ5183 competent cells by a thermal shock method, selecting positive plasmids, carrying out single enzyme digestion on the recombinant plasmids by Pac1 enzyme to obtain completely linearized plasmids, sequentially carrying out ethanol precipitation and ddH (ddH) on the completely linearized plasmids2O is dissolved and then will be completeThe linearized plasmid DNA and the Lipofectamine 2000 are mixed evenly, kept stand for 30min at room temperature, and added with the serum-free culture transfection of AD293 cells; the Lipofectamine-DNA mixture was added to the flask, the flask was gently shaken and mixed well, and the cells were incubated at 37 ℃ with 5% CO2Preserving the temperature for 5h under the condition, adding a complete culture medium for continuous culture, after 7d of transfection, collecting cell precipitates, centrifuging, collecting supernatant, storing at-80 ℃, purifying adenovirus by a cesium chloride density gradient centrifugation method, and respectively obtaining four recombinant adenovirus interference vectors Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR24-4 containing interference fragment sequences of the targeted DHCR24 gene.
The recombinant adenovirus interference vector containing the interference fragment sequence of the targeting DHCR24 gene is applied to the preparation of the drug for treating hyperlipidemia.
Preferably, four recombinant adenovirus interference vectors containing interference fragment sequences of targeted DHCR24 genes, namely Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR24-4, are singly or jointly used for preparing the medicine for treating hyperlipidemia.
More preferably, four recombinant adenovirus interference vectors containing the interference fragment sequence of the targeting DHCR24 gene, namely Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR24-4, are mixed according to the virus titer ratio of 1:1:1:1 and then are applied to the preparation of the medicament for treating hyperlipidemia.
The invention has the beneficial effects that: the invention provides four recombinant adenovirus vector interference vectors containing interference fragment sequences targeting DHCR24 genes, namely DHCR24 interference fragment sequence 1, DHCR24 interference fragment sequence 2, DHCR24 interference fragment sequence 3 and DHCR24 interference fragment sequence 4 contained in the recombinant adenovirus vector interference vectors interfere different sites of DHCR24 genes. The invention discovers that the purpose of interfering the expression of DHCR24 gene can be achieved by transfecting cells with four adenoviruses respectively or in a Mix mode of mixing 1:1:1:1, wherein the best effect can be achieved by mixing the four adenoviruses according to the proportion of 1:1:1: 1. On the other hand, the invention adopts the combined use of four siRNAs aiming at different target spots, and the effect of down-regulating the target gene expression by using any one siRNA more than singly is exerted together, thereby overcoming the defect of off-target effect of RNA interference. After the recombinant adenovirus provided by the invention transfects HepG2 cells, the intracellular cholesterol level is reduced, and the down regulation of endogenous cholesterol is realized.
Drawings
FIG. 1 is a flow chart of construction and packaging of recombinant adenovirus interference vector Ad-siDHCR 24.
FIG. 2 is a diagram showing the results of observation of recombinant adenovirus interference vectors under a phase contrast microscope and a fluorescence microscope, respectively;
wherein, a is a phase contrast microscope observation result picture of normal AD293 cells; b, a fluorescence microscope observation result picture of the normal AD293 cell; c, phase contrast microscopy of 293 cell adenovirus packaging group transfected with linearized pAdEasy-1-SES-DHCR24 siRNA-1; d, graph of fluorescence microscopy observation result of 293 cell adenovirus packaging group transfected with linearized pAdEasy-1-SES-DHCR24 siRNA-1.
FIG. 3 is a graph of the efficiency assay of different Ad-siDHCR24 to down-regulate DHCR24 in HepG2 cells;
wherein, Mix: mixing the four recombinant adenoviruses according to the virus titer ratio of 1:1:1: 1; no. 1: Ad-siDHCR 24-1; no. 2: Ad-siDHCR 24-2; no. 3: Ad-siDHCR 24-3; no. 4: Ad-siDHCR 24-4.
FIG. 4A is a fluorescence photograph of cholesterol staining for detecting cholesterol lowering by Ad-siDHCR24 using cellular cholesterol fluorescence staining (Filipin method).
FIG. 4B is a fluorescence intensity analysis of the cholesterol-lowering staining pattern of Ad-siDHCR24 examined by the cellular cholesterol fluorescent staining method (Filipin method).
FIG. 4C is a graph showing the negative correlation between red fluorescence intensity and blue fluorescence intensity in the group of cholesterol-lowering Mix examined by Ad-siDHCR24 using the cellular cholesterol fluorescent staining method (Filipin method).
FIG. 5A shows high performance liquid chromatography for cholesterol detection (1.0 mg/mL).
FIG. 5B shows high performance liquid chromatography for cholesterol assay (1.0 mg/mL).
FIG. 5C shows the detection of cholesterol and cholesterol 1 by HPLC: 1 and mixing.
FIG. 5D is a set of HPLC detection controls.
FIG. 5E shows detection of Mix group by HPLC.
FIG. 5F shows the high performance liquid chromatography method for detecting cholesterol content per unit cell.
FIG. 6A shows that Ad-siDHCR24 injection reduced total cholesterol levels in serum from C57BL/6J hyperlipidemic model mice.
FIG. 6B shows that Ad-siDHCR24 injection reduced triglyceride levels in the serum of mice in the C57BL/6J hyperlipidemia model.
FIG. 6C shows that Ad-siDHCR24 injection reduced LDL sterol levels in mice in the C57BL/6J hyperlipidemia model.
FIG. 6D shows that Ad-siDHCR24 injection reduced HDL sterol levels in the serum of C57BL/6J hyperlipidemia model mice.
FIG. 7 shows the immunohistochemical results of Ad-siDHCR24 injection to improve lipid vacuolation in liver tissue of mice model C57BL/6J hyperlipidemia.
Detailed Description
Example 1 construction of recombinant adenovirus interference vectors containing an interference fragment sequence targeting DHCR24 Gene
An interference fragment sequence targeting the DHCR24 gene, comprising a DHCR24 interference fragment sequence 1, a DHCR24 interference fragment sequence 2, a DHCR24 interference fragment sequence 3 and a DHCR24 interference fragment sequence 4.
The sequence of the DHCR24 interference fragment sequence 1 is as follows:
sense strand: AGCACAGGCATCGAGTCATCTTTT
Antisense strand: AGATGACTCGATGCCTGTGCTTTT
The sequence of the DHCR24 interference fragment sequence 2 is as follows:
sense strand: AGCACGGGTTCCAAATGTTATTTT
Antisense strand: ATAACATTTGGAACCCGTGCTTTT
The sequence of the DHCR24 interference fragment sequence 3 is as follows:
sense strand: AGCGCCTGGGTGGTGTTCAATTTT
Antisense strand: ATTGAACACCACCCAGGCGCTTTT
The sequence of the DHCR24 interference fragment sequence 4 is as follows:
sense strand: AACTCAGACTGTTCTATGCTTTT
Antisense strand: AGCATAGAACAGTCTGAGTTTTT are provided.
1) DHCR24 interference fragment sequence 1, DHCR24 interference fragment sequence 2, DHCR24 interference fragment sequence 3 and DHCR24 interference fragment sequence 4 were synthesized separately.
2) After annealing single-stranded DNA sense strand and antisense strand fragments of the DHCR24 interference fragment sequence 1, the DHCR24 interference fragment sequence 2, the DHCR24 interference fragment sequence 3 and the DHCR24 interference fragment sequence 4 respectively, the fragments are respectively connected with a shuttle plasmid vector pSES1 by using T4 ligase, and four pSES1-DHCR24siRNA recombinant plasmids are respectively obtained. The pSES1 vector is an adenovirus shuttle vector for siRNA expression, and H1 and U6 promoter sequences are respectively arranged on two sides of a multiple cloning site for inserting an exogenous DNA fragment, so that the transcription of intracellular short hairpin RNA of the inserted DNA fragment can be realized.
3) The four pSES1-DHCR24siRNA recombinant plasmids were transformed into E.coli competent cells, respectively, and the transformed strains were inoculated into LB agar plates containing penicillin and cultured overnight at 37 ℃. The bacterial strain is selected, cloned and amplified, plasmid DNA is extracted, and the cloned plasmid which is positive is verified by ECOR V enzyme digestion is sequenced. Selecting clone pSES1-DHCR24siRNA without mutation, amplifying and purifying, then carrying out enzyme digestion by using Pme1, and recovering products to respectively obtain four linearized recombinant plasmids.
4) The four linearized recombinant plasmids were transformed into BJ5183 competent cells by heat shock, and the cells were plated on kanamycin-resistant plates and cultured at 37 ℃. Single colonies growing on the plates were picked, inoculated in LB medium and cultured overnight on a shaker. The plasmid was extracted, digested with Pac1 enzyme, and confirmed by 1% agarose gel electrophoresis to show a large band of about 30kb and a small band of 4.5kb or 3kb, which was determined to be a positive plasmid. The recombinant adenovirus plasmid was digested with Pac1 enzyme by a single enzyme, and when the plasmid was completely linearized, the completely linearized plasmid was ethanol precipitated and solubilized with ddH 2O. Completely linearizing plasmid DNA and Lipofectamine 2000, mixing uniformly, standing for 30min at room temperature, and adding AD293 cells for serum-free culture transfection. The Lipofectamine-DNA mixture was added to the flask and the flask was gently shaken and mixed well. The cells were incubated at 37 ℃ for 5h with 5% CO2, and then the culture was continued by adding complete medium. After 7 days of transfection, cell pellets were collected, centrifuged, and the supernatant was collected and stored at-80 ℃. And continuously transfecting other 293 cells with the supernatant to realize amplification, purifying the adenovirus by a cesium chloride density gradient centrifugation method, and finally obtaining four siRNA recombinant adenovirus interference vectors targeting different positions of the DHCR24 gene, namely recombinant adenovirus interference vectors Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR 24-4.
FIG. 1 is a flow chart of construction and packaging of recombinant adenovirus Ad-siDHCR 24.
FIG. 2 is a diagram showing the results of observing Ad-siDHCR24-1 recombinant adenovirus packaging group and negative control group under a phase contrast microscope and a fluorescence microscope, respectively. A is a phase contrast microscope photograph of a negative control group of normal AD293 cells without linearized plasmid transfection, the fluorescence microscope observation of the b picture shows RFP expression without red fluorescence, c and d are 293 cells adenovirus packaging group transfected with linearized pAdEasy-1-SES-DHCR24siRNA-1, namely Ad-siDHCR24-1, and the fluorescence microscope of the d picture can observe that more than 90% of cells have intense red fluorescence signals in cytoplasm, indicating the successful expression of red fluorescence protein. This result demonstrates that the linear recombinant plasmid containing DHCR24siRNA sequence successfully achieves the packaging of adenovirus in 293 cells and achieves the primary amplification of adenovirus.
Example 2 use of recombinant adenovirus interference vectors containing interfering fragment sequences targeting DHCR24 Gene
The four constructed recombinant adenovirus interference vectors containing the interference fragment sequence of the targeting DHCR24 gene, namely Ad-siDHCR24-1(No.1), Ad-siDHCR24-2(No.2), Ad-siDHCR24-3(No.3) and Ad-siDHCR24-4(No.4), are respectively transfected into HepG2 cells or C57BL/6J mice after being mixed or mixed according to a certain proportion, the corresponding time is processed, then corresponding detection is carried out by different technical means, and result analysis is carried out.
Ad-siDHCR24 downregulates DHCR24 efficiency detection, determines the best interference efficiency strain and proportion
Four kinds of Ad-siDHCR24 and Ad-siControl are transfected to HepG2 cells with good growth state, RNA is extracted, and DHCR24 expression is detected by using real time PCR. HepG2 cells were transfected with 100moi of four recombinant adenoviruses, and 3 days after transfection, the cells were collected, total RNA was extracted by Trizol method, genomic DNA was removed, reverse-transcribed into cDNA, and expression of DHCR24mRNA level was detected by RealtimePCR. Blank group (-) is the control group of untransfected recombinant adenovirus, Ad-siControl is the adenovirus control group, and GAPDH is the internal reference gene. The results are shown in fig. 3(n ═ 3mean + SD,: p <0.05vs. ad-siControl,: p <0.01vs. ad-siControl).
As can be seen from FIG. 3, there was no significant change in DHCR24mRNA in the Ad-siDHCR24No.2 group compared to the Ad-siControl group, whereas DHCR24mRNA levels in HepG2 cells in the Mix, No.1, No.3 and No.4Ad-siDHCR 24-infected groups were lower, resulting in significant statistical differences with the lowest level of DHCR24mRNA in the Mix group. This result indicates that four groups of adenovirus interference vectors, Ad-siDHCR24 of Mix, No.1, No.3 and No.4, all achieved interference with the RNA expression level of the target gene DHCR24, with the Mix group having the best interference expression effect. Therefore, in subsequent experiments, Ad-siDHCR24Mix is mainly selected as a recombinant adenovirus interference vector for realizing interference of DHCR24 expression.
(II) examination of Cholesterol-lowering Effect of Ad-siDHCR24 by fluorescent staining of cellular Cholesterol (Filipin method)
HepG2 cells with good growth state are inoculated on a cell climbing sheet, the Ad-siDHCR24 recombinant adenovirus 100moi transfects the HepG2 cells, the cells are collected after 3 days, the cells are stained by a Filipin fluorescent dye, and the fluorescence intensity is observed by a fluorescence microscope. The method specifically comprises the following steps: HepG2 cells in good growth state were transfected with Mix Ad-siDHCR24 and No.3 and No.4 adenoviruses, stained with Filipin fluorescent dye, and blue fluorescence intensity was observed with a fluorescence microscope, and HepG2 cells transfected with Ad-siDHCR24 and Ad-siControl were labeled with blue fluorescence and recombinant adenovirus was labeled with red fluorescence, as shown in FIG. 4A-FIG. 4C (n is 3mean + SD; p <0.05vs. Ad-siControl; p <0.01vs. Ad-siControl).
As can be seen from FIGS. 4A to 4C, red fluorescence was observed in all four groups of cells infected with adenovirus, which confirmed that the infection with recombinant adenovirus was successful and the infection efficiency was more than 90%. The observation of blue fluorescence, which represents intracellular cholesterol levels, shows that the mean blue fluorescence intensity of the cells to which Mix, No.3 and No.4Ad-siDHCR24 were added was significantly weaker than that of the control group, compared to the Ad-siControl control group. Quantitative analysis of fluorescence intensity of three groups of cells shows that the average fluorescence intensity of cells in the cells infected with adenovirus of the three groups of cells is obviously lower than that of the control group, and the infection of Ad-siDHCR24 is proved to reduce cholesterol level in HepG2 cells (figure 4B). Further analysis of fluorescence intensity of the cells of the Mix adenovirus group revealed that the cells with stronger red fluorescence intensity showed weaker blue fluorescence, and showed a negative correlation between the red fluorescence intensity and the blue fluorescence intensity (fig. 4C). This result suggests that the more adenovirus that is infected in the cell, the lower the cellular cholesterol level, probably due to the higher interference efficiency on DHCR24 target gene expression resulting from the high MOI number of adenovirus infection.
(III) detecting the influence of Ad-siDHCR24Mix on the cholesterol synthesis of HepG2 cells by high performance liquid chromatography
Mixing four adenoviruses according to the mass ratio of 1:1:1:1 (Mix), transfecting HepG2 cells by 100moi, collecting cells after 3 days of transfection, extracting total lipid, and extracting N2Air drying, weighing, recording lipid weight, dissolving in ethanol, using methanol as mobile phase, and detecting cholesterol chromatogram peak at 210 nm. The method specifically comprises the following steps: transfecting a HepG2 cell with a good growth state with Mix Ad-siDHCR24, collecting cells, extracting total lipid, and obtaining N2Drying, dissolving in anhydrous ethanol, and detecting cholesterol chromatographic peak with high performance liquid chromatography. The results are shown in FIGS. 5A-5F (n-3 mean + SD, p<0.05vs.control，**:p<Control.) at 0.01vs. FIG. 5A: cholesterol standard (1.0mg/mL), fig. 5B: cholesterol standard (1.0mg/mL), fig. 5C: cholesterol with cholesterol 1:1 mix, FIG. 5D: control group, FIG. 5E: Mix group, FIG. 5F: unit intracellular cholesterol content.
As can be seen from FIGS. 5A to 5F, the retention time of the chromatographic peak of the cholesterol standard was 17min, the retention time of the chromatographic peak of the cholesterol standard was 22min, and the peak appearance time of the mixture of the cholesterol standard and the cholesterol standard was identical to the peak appearance time of the cholesterol standard and the cholesterol standard as shown in FIG. 5C. In the Control group shown in FIG. 5D, a certain amount of cholesterol was present in the cells (indicated by red arrows), while the chromatographic peak of cholesterol in the group to which Mix adenovirus was added was significantly smaller than that in the Control group, suggesting that the total cholesterol in the cells was significantly decreased after the addition of Ad-siDHCR24 adenovirus. Figure 5F shows the intracellular cholesterol levels per unit cell, and analysis showed significant differences in intracellular cholesterol levels in both groups, which also demonstrates Ad-siDHCR24 down-regulated HepG2 intracellular cholesterol levels. However, the high performance liquid chromatography experiments at the cellular level did not detect a peak in cholesterol due to the extremely complex cellular contents, which in turn were low in cholesterol relative to cholesterol.
(IV) Ad-siDHCR24 reduces blood lipids in C57BL/6J mice
48C 57BL/6J male mice were randomly assigned into 4 groups (n-12), a placebo (-), a High lipid model group (High fat model), an adenovirus control group (Ad-siControl) and a Mix adenovirus group (Ad-siDHCR 24). The placebo mice were fed normal chow and the remaining mice were fed high fat diet for 4 weeks. The drinking water was changed daily during the molding, and the body weight was weighed and recorded weekly. After 4 weeks of the experiment, 150ul of physiological saline was injected into the tail vein of the blank control group and the high fat model group, 150ul of glandular virus solution (virus content: 4.5X 108pfu) was injected into the Ad-siControl group, and 150ul of glandular virus solution (virus content: 5X 108pfu) was injected into the Ad-siDHCR24 group, and body weight was recorded weekly. After 3 weeks, the eye sockets of ether-anesthetized mice were bled, while the mice were sacrificed and the liver of the mice was collected and weighed. The collected blood is placed in a refrigerator at 4 ℃ for 30min, centrifuged at 4 ℃ and 3000rpm/min for 15min, and the upper serum is transferred to a new EP tube for measuring TC, TG and LDL-C, HDL-C in blood fat. Serum is tested for changes in cholesterol, triglyceride, low density lipoprotein and high density lipoprotein levels in serum using Nanjing's kit. The method specifically comprises the following steps: a hyperlipemia model is established by raising C57BL/6J mice with high-fat feed, Ad-siDHCR24 virus is injected into tail vein, serum is collected after three weeks, and indexes of total cholesterol, triglyceride, low-density lipoprotein sterol and high-density lipoprotein sterol in blood are detected. The results are shown in FIGS. 6A to 6D. (-) mice were normally fed, Normal saline indicated a saline-caudal-vein-injected Normal-saline-controlled hyperlipidemic model mouse, Ad-siControl indicated a hyperlipidemic model mouse injected with Ad-siControl adenovirus, and Ad-siDHCR24 indicated a hyperlipidemic mouse injected with Ad-siDHCR24 adenovirus.
As can be seen from fig. 6A to 6D, the serum total cholesterol level was significantly decreased and the triglyceride level was also decreased in the high-fat mice injected with Ad-siDHCR24, compared to the high-fat model group mice, and the serum low-density lipoprotein sterol level was decreased and the high-density lipoprotein level was increased. The result proves that Ad-siDHCR24 can reduce the synthesis of cholesterol by interfering the expression of DHCR24, thereby reducing the total cholesterol, triglyceride and low-density lipoprotein sterol of hyperlipidemia, reducing 'bad factors' which can cause cardiovascular diseases, simultaneously increasing the high-density lipoprotein sterol, being beneficial to relieving the hyperlipidemia and reducing the harm caused by the hyperlipidemia.
(V) Ad-siDHCR24 transfection C57BL/6J mouse liver HE staining pattern
After 3 weeks of adenovirus infection, mice were sacrificed under ether anesthesia and livers were collected and weighed. Half of the liver of a C57BL/6 mouse is fixed by 4% paraformaldehyde, embedded in paraffin, used for making animal tissue sections, and the dehydrated sections are placed into hematoxylin for staining, rinsed by distilled water, treated by hydrochloric alcohol, stained by 0.5% -1% eosin solution, and treated by 95% alcohol. And (5) carrying out xylene transparent treatment, sealing by using neutral gum and storing. The method specifically comprises the following steps: mice in a normal group and a high-fat model group and four groups of mice transfected with Ad-siControl and Ad-siDHCR24 adenovirus are sacrificed after three weeks of feeding, liver tissues of the mice are taken to be paraffin sections, and pathological changes of liver cells of the mice are observed by HE staining. The results are shown in FIG. 7.
As can be seen from FIG. 7, liver sections from left to right are shown for a normally-fed mouse, a hyperlipidemic model mouse, and four groups of mice infected with Ad-siControl and Ad-siDHCR24 adenovirus, respectively. As can be seen from the fluorescence microscope pictures, in both groups injected with adenovirus, strong red fluorescence is observed in the cells of the liver sections, which proves that the recombinant adenovirus injected from tail vein successfully infects the liver tissue cells, and the cell infection percentage reaches more than 90%. The observation result of an optical microscope shows that the histology of the livers of the mice of the high-fat normal saline group and the Ad-siControl group shows that the lipid is accumulated in the cells, the liver cells become large, and meanwhile, the lipid is dispersed in cytoplasm to extrude the cell nucleus to the edge, so that obvious vacuolation is presented, and the success of modeling of the mice fed with the high-fat feed is proved. In the experimental group of the hyperlipemia model mice, compared with the Ad-siDHCR24 group, the liver cells of the mice infected with the Ad-siDHCR24 were reduced in volume and lipid vacuolation was reduced, and part of the cytoplasm was re-stained to normal red due to the reduction of lipid in the cells, which indicates that the liver of the mice infected with the Ad-siDHCR24 adenovirus can be reduced in lipid.
Claims (1)
1. Containing a targetDHCR24The application of recombinant adenovirus interference vector containing gene interference fragment sequence in preparing medicine for treating hyperlipemia features that four kinds of recombinant adenovirus interference vectors containing target gene interference fragment sequence are usedDHCR24The recombinant adenovirus interference vectors of the gene interference fragment sequence are Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR24-4 which are mixed according to the virus titer ratio of 1:1:1:1 and then are applied to the preparation of the medicine for treating hyperlipidemia; the recombinant adenovirus interference vectors Ad-siDHCR24-1, Ad-siDHCR24-2, Ad-siDHCR24-3 and Ad-siDHCR24-4 are recombinant adenovirus interference vectors constructed by packaging a DHCR24 interference fragment sequence 1, a DHCR24 interference fragment sequence 2, a DHCR24 interference fragment sequence 3 and a DHCR24 interference fragment sequence 4 into Ad5 replication-defective adenovirus through a genetic engineering technology;
saidDHCR24The sequence of the interference fragment sequence 1 is:
sense strand: AGCACAGGCATCGAGTCATCTTTT
Antisense strand: AGATGACTCGATGCCTGTGCTTTT
SaidDHCR24The sequence of the interference fragment sequence 2 is:
sense strand: AGCACGGGTTCCAAATGTTATTTT
Antisense strand: ATAACATTTGGAACCCGTGCTTTT
SaidDHCR24The sequence of the interference fragment sequence 3 is:
sense strand: AGCGCCTGGGTGGTGTTCAATTTT
Antisense strand: ATTGAACACCACCCAGGCGCTTTT
SaidDHCR24The sequence of interference fragment sequence 4 is:
sense strand: AACTCAGACTGTTCTATGCTTTT
Antisense strand: AGCATAGAACAGTCTGAGTTTTT are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810361398.XA CN108441515B (en) | 2018-04-20 | 2018-04-20 | Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810361398.XA CN108441515B (en) | 2018-04-20 | 2018-04-20 | Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108441515A CN108441515A (en) | 2018-08-24 |
| CN108441515B true CN108441515B (en) | 2021-11-30 |
Family
ID=63201173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810361398.XA Active CN108441515B (en) | 2018-04-20 | 2018-04-20 | Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108441515B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007097461A1 (en) * | 2006-02-27 | 2007-08-30 | National University Corporation Kumamoto University | Antibody for treatment of hepatitis c |
| CN101942436A (en) * | 2010-08-06 | 2011-01-12 | 辽宁大学 | mDHCR24 interference target spot sequence and application thereof |
| CN102787101A (en) * | 2012-04-18 | 2012-11-21 | 辽宁大学 | 24-dehydrocholesterol reductase coded recombinant adenoviruses specifically expressed in tissue |
-
2018
- 2018-04-20 CN CN201810361398.XA patent/CN108441515B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007097461A1 (en) * | 2006-02-27 | 2007-08-30 | National University Corporation Kumamoto University | Antibody for treatment of hepatitis c |
| CN101942436A (en) * | 2010-08-06 | 2011-01-12 | 辽宁大学 | mDHCR24 interference target spot sequence and application thereof |
| CN102787101A (en) * | 2012-04-18 | 2012-11-21 | 辽宁大学 | 24-dehydrocholesterol reductase coded recombinant adenoviruses specifically expressed in tissue |
Non-Patent Citations (3)
| Title |
|---|
| Ad-siDHCR24降胆固醇作用的初步药效学研究;杨晓雄;《中国优秀硕士学位论文全文数据库 医药卫生科技辑》;20190115(第1期);第E079-383页 * |
| Cholesterol depletion induced by RNA interference targeting DHCR24 protects cells from liposome-induced cytotoxicity;Baoyu Yang et al.;《PREPARATIVE BIOCHEMISTRY AND BIOTECHNOLOGY》;20190321;第49卷(第5期);第453–458页 * |
| Recombinant adenovirus-mediated overexpression of 3β-hydroxysteroid-Δ24 reductase;Xiuli Lu et al.;《NEURAL REGENERATION RESEARCH》;20140331;第9卷(第5期);第509页图5、第510右栏第4段-511左栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108441515A (en) | 2018-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981155B (en) | The structure method of liver cancer targeting oncolytic adenovirus and application | |
| CN113476618B (en) | Application of miR-199a-3p in preparation of medicine for treating nasopharyngeal carcinoma | |
| CN112251421B (en) | EZH2 variable shear body and application thereof | |
| JP5645044B2 (en) | Novel Ad vector containing gene expression control mechanism | |
| CN105754999B (en) | Oligonucleotide sequence for inhibiting hsa-miR-221-3p, recombinant adenovirus and preparation method and application thereof | |
| CN108441515B (en) | Recombinant adenovirus interference vector containing interference fragment sequence of targeting DHCR24 gene and application of recombinant adenovirus interference vector in reducing blood fat | |
| CN112190712A (en) | Application of combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of drugs for treating liver cancer cells | |
| CN110075122B (en) | Liver cancer therapeutic exosome medicine | |
| CN115161321B (en) | Application of ssc-miR-30c-3p in preparation of PDCoV proliferation-resistant medicine | |
| Weng et al. | Improvement of muscular atrophy by AAV–SaCas9-mediated myostatin gene editing in aged mice | |
| CN115068611B (en) | Application of ssc-miR-374b-3p in preparation of PDCoV proliferation resistant medicine | |
| CN113528528B (en) | shRNA for promoting apoptosis of imatinib-resistant chronic myelocytic leukemia cell K562/G01 and application thereof | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN116019935A (en) | Application of Ago2 in preparing medicines for treating heart failure or diabetic cardiomyopathy and protein, gene and transformant thereof | |
| JP2024506040A (en) | sgRNA targeting Aqp1 RNA and its use with vectors | |
| KR102289661B1 (en) | Composition for preventing or treating Gout comprising stem cells overexpressing Uricase | |
| CN105296600A (en) | Application of Med23 genes and medicine related to Med23 genes | |
| Chattopadhyay et al. | Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles | |
| CN103981185B (en) | Liver cancer-specific GP73 core promoter and screening construction process thereof | |
| CN110964727A (en) | shRNA lentiviral expression vector construction method for specifically inhibiting c-myc gene expression and application thereof | |
| CN113694058B (en) | Application of SERPINE1 inhibitor in preparation of medicine for resisting recurrence and metastasis after hepatocellular carcinoma microwave ablation | |
| CN114788865B (en) | Application of miR-378 as cholesterol steady-state regulation target point | |
| CN111808954B (en) | lncRNA and application thereof in diseases | |
| CN109097399A (en) | The expression vector of long-chain non-coding RNA H19, the cell strain for expressing H19 and its application | |
| CN108866099A (en) | Specificity inhibits the recombined lentivirus vector and its construction method of lung adenocarcinoma cell miRNA-21-5p expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |