CN114134211A

CN114134211A - Application of USP30 gene as target in inhibiting replication of Seneca Valley virus

Info

Publication number: CN114134211A
Application number: CN202111489506.XA
Authority: CN
Inventors: 郑海学; 朱紫祥; 赵振翔; 齐晓兰; 杨帆; 曹伟军; 张向乐; 陈淑莹; 刘湘涛
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2021-12-07
Filing date: 2021-12-07
Publication date: 2022-03-04
Anticipated expiration: 2041-12-07
Also published as: CN114134211B

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to application of a USP30 gene as a target point in inhibiting replication of Seneca Valley virus. (1) The invention discovers that the suppression or silencing of a host USP30 gene can suppress the replication of the Seneca Valley virus, namely USP30 can be used as a target spot for screening the drugs for suppressing the replication of the Seneca Valley virus; (2) the invention provides a small interfering RNA for interfering replication of Seneca Valley virus, which can inhibit replication of Seneca Valley virus; (3) the invention provides sgRNA of a specific target USP30 gene, which combines with CRISPR-Cas9 technology to realize complete knockout of USP30 gene, and the obtained monoclonal cell line USP30-KOs has resistance phenotype to SVA, can obviously inhibit replication of SVA in cells, and provides research tools and materials for further researching the molecular mechanism of USP30 gene for regulating replication of pathogenic microorganisms in cells.

Description

Application of USP30 gene as target in inhibiting replication of Seneca Valley virus

Technical Field

The invention belongs to the technical field of biological genetic engineering, and particularly relates to application of a USP30 gene as a target spot in inhibiting replication of Seneca Valley virus.

Background

Seneca valley virus (SVA) belongs to the genus Seneca virus of the picornaviridae family, belongs to the single-stranded positive-strand RNA virus, and primarily infects pigs. The vesiculopathy caused by SVA infection is very similar to the pathological changes caused by Foot and Mouth Disease (FMD), Swine Vesicular Disease (SVD) and Vesicular Stomatitis (VS), and is particularly characterized in that the nasal and nasal rhynchophorus of the sick livestock and the coronal girdle of the hoofs have obvious blisters and are accompanied with symptoms of lameness, anorexia, lethargy, fever and the like. How to make effective diagnosis and prevention strategies and measures to prevent the continuous prevalence and spread of the disease is a problem to be solved urgently at present. However, no commercial vaccine or drug is available because the mechanisms of SVA infection and pathogenesis are still unclear. Therefore, the mechanism of host protein for inhibiting SVA replication is deeply understood, and the construction of the cell line for inhibiting SVA virus replication by the CRISPR-Cas9 technology has great significance for the production of Seneca Valley vaccine.

The emergence of RNA interference technology provides possibility for selective toxicity and provides a new idea for antiviral research. RNA interference is an RNA sequence-specific post-transcriptional gene silencing phenomenon. Compared with the traditional means of antiviral treatment, the RNA interference mediated antiviral effect has high specificity and almost has no influence on the expression of non-homologous genes, so that the adverse reaction can be reduced to the minimum; RNA interference can effectively inhibit virus replication, and a small amount of siRNA can achieve the effect of reducing virus expression products; RN a interference may act against conserved regions of the viral genome, limiting to some extent the ability of the virus to produce escape mutants. Therefore, designing synthetic siRNAs targeting the genome of seneca valley virus would likely be an effective way to inhibit seneca valley virus infection.

USP30(ubiquitin specific peptidases 30) is a transmembrane deubiquitinating enzyme (DUBs) located on the outer membrane of mitochondria, and can inhibit mitochondrial autophagy mediated by ubiquitin ligase PARK2 and protein kinase PINK1 and regulate dynamic changes of mitochondria. Previous studies showed that USP30 primarily reverses ubiquitination of the Parkin substrate on mitochondria. In neurons, overexpression of USP30 greatly attenuated the mitochondrial clearing effect of mitochondrial autophagy caused by CCCP induced mitochondrial depolarization; while decreasing activity of USP30 enhanced mitochondrial degradation. Knock-down of USP30 relieves mitochondrial autophagy dysfunction caused by mutations in pathological activity of Parkin and enhances mitochondrial integrity in drosophila deficient in Parkin or PINK 1.

The invention discovers that the replication of SVA can be inhibited by inhibiting or silencing a host USP30 gene, and the SVA can be used as a target for preparing a medicament for inhibiting the replication of Seneca Valley virus. Based on the method, the USP30 gene is used as a target point, and the small interfering RNA is designed, can interfere the replication of SVA, and can be used for preparing the medicine for inhibiting the replication of SVA. In order to further research the molecular mechanism of USP30 gene for regulating the replication of pathogenic microorganisms in cells, the invention designs the sgRNA of the specific targeting USP30 gene, the sgRNA can specifically target the USP30 gene, the complete knockout of the USP30 gene is realized by combining the CRISPR-Cas9 technology, the obtained monoclonal cell line USP30-KOs has a resistance phenotype to SVA, the replication of SVA in cells can be obviously inhibited, research tools and materials are provided for researching the molecular mechanism of USP30 gene for regulating the replication of pathogenic microorganisms in cells, and the sgRNA can also be used for breeding SVA-resistant animals.

Disclosure of Invention

Aiming at the technical problems, the invention firstly discovers that the replication of the Seneca Valley virus can be inhibited by inhibiting or silencing a host USP30 gene, and the Seneca Valley virus can be used as a target point for preparing a medicament for inhibiting the replication of the Seneca Valley virus; secondly, with USP30 gene as a target, the invention designs small interfering RNA which can interfere replication of the Seneca Valley virus and can be used for preparing a medicament for inhibiting replication of the Seneca Valley virus; moreover, the sgRNA specifically targeting the USP30 gene can specifically target the USP30 gene, the complete knockout of the USP30 gene is realized by combining the CRISPR-Cas9 technology, the obtained monoclonal cell line USP30-KOs has a resistance phenotype to SVA, the replication of SVA in cells can be remarkably inhibited, and research tools and materials are provided for further researching a molecular mechanism of the USP30 gene for regulating and controlling the replication of pathogenic microorganisms in the cells. The method specifically comprises the following steps:

in a first aspect, the invention provides an application of USP30 gene/protein as a target in screening a medicine for preventing or treating Seneca Valley virus infection, wherein the medicine takes USP30 gene/protein as a target and inhibits or silences the expression of USP30 gene/protein.

In a second aspect, the invention provides the use of an agent or medicament for inhibiting USP30 gene/protein expression in the manufacture of a medicament for the prevention or treatment of senegaviras infection.

Preferably, the agent or drug is a small interfering RNA designed to target the USP30 gene/protein.

Preferably, the sequence of the small interfering RNA is:

USP30-siRNA-F:5’-GGAGUACAAGUCUGAAGAATT-3’；

USP30-siRNA-R:5’-UUCUUCAGACUUGUACUCCTT-3’。

preferably, the agent or medicament comprises sgRNA targeted to knock-out the USP30 gene,

preferably, the agent or medicament further comprises an mRNA sequence of the Cas9 protein.

Preferably, the drug delivers the m RNA sequence carrying sgRNA targeting the USP30 gene and Cas9 protein to an animal through a drug delivery vehicle to inhibit USP30 gene expression.

Preferably, the drug delivery vehicle is a liposomal nanoparticle.

Preferably, the sgRNA comprises at least one of USP30-sgRNA1 and USP30-sgRNA2, and the nucleotide sequence of the sgRNA A is as follows:

USP30-sgRNA1-F：5’-CACCGTCGCTCATCTTCCAATGACG-3’；

USP30-sgRNA1-R：5’-AAACCGTCATTGGAAGATGAGCGAC-3’；

USP30-sgRNA2-F：5’-CACCGCTCACCCTACATCCAATCAC-3’；

USP30-sgRNA2-R：5’-AAACGTGATTGGATGTAGGGTGAGC-3’。

in a third aspect, the invention provides a sgRNA specifically targeting to knock-out a USP30 gene, the sgRNA including at least one of USP30-sgRNA1 and USP30-sgRNA2, the nucleotide sequence of the sgRNA being:

USP30-sgRNA1-F：5’-CACCGTCGCTCATCTTCCAATGACG-3’；

USP30-sgRNA1-R：5’-AAACCGTCATTGGAAGATGAGCGAC-3’；

USP30-sgRNA2-F：5’-CACCGCTCACCCTACATCCAATCAC-3’；

USP30-sgRNA2-R：5’-AAACGTGATTGGATGTAGGGTGAGC-3’。

in a fourth aspect, the invention provides a use of the sgRNA of the third aspect in preparing a USP30 knockout cell line.

In a fifth aspect, the invention provides a method for constructing a USP30 gene knockout cell line, wherein the function of USP30 gene-encoded protein in a host cell is lost through a gene targeting technology.

Preferably, the method is a CRISPR-Cas9 technique.

Preferably, the method comprises the steps of:

(1) preparing the sgRNA specifically targeting the USP30 gene according to the third aspect, adding a CACC cohesive end at the 5 'end of the forward sequence of the sgRNA fragment, and adding an AAAC cohesive end at the 5' end of the reverse sequence to serve as a sgRNA oligonucleotide targeting the USP30 gene;

(2) inserting the double-stranded fragment prepared in the step (1) into a multiple cloning site of a PX459 expression plasmid vector to obtain a recombinant vector for simultaneously expressing a Cas9 protein gene and a targeting sgRNA sequence;

(3) transfecting the host cell with the recombinant vector prepared in the step (2), screening and killing negative cells by puromycin (puromycin) antibiotics, selecting single cells, inoculating and culturing to obtain a USP30 gene function-deleted cell line.

In a sixth aspect, the present invention provides a USP30 knock-out cell line constructed according to the method of the fifth aspect above.

In a seventh aspect, the present invention provides a use of the USP30 gene knockout cell line of the above sixth aspect in the detection of non-diagnostic therapeutic purposes.

In an eighth aspect, the present invention provides a use of the protein dysfunction-encoding cell line of USP30 as described in the sixth aspect above in breeding of anti-seneca valley virus in animals.

The invention has the beneficial effects that: the invention finds that the replication of the Seneca Valley virus can be inhibited by inhibiting or silencing a host USP30 gene, and the Seneca Valley virus can be used as a target point for preparing a medicament for inhibiting the replication of the Seneca Valley virus; the invention uses USP30 gene as target, designs small interfering RNA, which can interfere replication of Seneca Valley virus and can be used to prepare drug for inhibiting replication of Seneca Valley virus; the invention provides sgRNA of a targeted USP30 gene, which can specifically target the USP30 gene and can realize complete knockout of the USP30 gene in a host cell by combining with a CRISPR-Cas9 technology; the sgRNA targeting the USP30 gene is delivered into an animal body through a drug carrier, so that the inhibition of the USP30 gene can be realized, and the replication of the Seneca Valley virus can be inhibited; the invention provides a method for transfecting sgRNA to host cells by using a CRISPR-Cas9 technology to construct a USP30 gene encoding protein loss cell line, and the cell line with SVA resistance phenotype is obtained by losing the function of USP30 gene encoding protein, so that the replication of SVA can be obviously inhibited, research tools and materials are provided for further researching the molecular mechanism of USP30 gene for regulating and controlling the replication of pathogenic microorganisms in cells, and the method can also be used for breeding SVA-resistant animals.

Drawings

FIG. 1 results of expression of the USP30 gene in HEK293T cells following small interfering RNA interference;

FIG. 2 results of SVA virus expression in HEK293T cells following small interfering RNA interference;

FIG. 3 construction sequencing alignment results of PX459-USP30-sgRNA recombinant plasmid;

FIG. 4 shows the result of PCR amplification of DNA check primers of HEK293T cells after PX459-USP30-sgRNA plasmid transfection;

FIG. 5 sequencing map of DNA check primer amplified fragment of HEK293T cell after PX459-USP30-sgRNA1 plasmid transfection;

FIG. 6 shows Western blotting detection results of candidate cells USP30 protein of HEK293T knocked-out gene of USP 30;

FIG. 7 shows the result of intracellular virus replication of HEK293T cells after SVA challenge by gene-knockout of USP 30.

FIG. 8 shows Western blotting detection results of intracellular viral protein replication levels of HEK293T cells knocked out by USP30 gene after SVA virus challenge;

FIG. 9 shows the qPCR detection results of viral mRNA levels in cells of HEK293T cells after SVA challenge by USP30 gene knock-out.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in detail below with reference to the accompanying drawings. However, it will be appreciated by those of ordinary skill in the art that in various embodiments of the invention, numerous technical details are set forth in order to provide a better understanding of the present application. However, the technical solution claimed in the present application can be implemented without these technical details and various changes and modifications based on the following embodiments.

Definition of

The term "gene silencing" refers to the phenomenon of making a gene under-or not under-expressed without damaging the original DNA, and mainly includes two aspects, namely, gene silencing at the transcription level due to DNA methylation, heterochromatosis, position effect and the like; the second is post-transcriptional gene silencing, which is the inactivation of genes by specific inhibition of target RNA at the post-transcriptional level of the gene, including antisense RNA, co-suppression, gene suppression, RNA interference, and microrna-mediated translation suppression. The invention can inhibit the expression of USP30 gene in host cells through gene silencing technology, thereby inhibiting virus replication after SVA infection and being used for preventing or treating SVA infection.

The term "gene targeting" refers to a directional transgenic technology for directionally changing the genetic information of cells or biological individuals by using DNA site-directed homologous recombination, and mainly comprises gene knockout, gene inactivation, gene knock-in, point mutation, deletion of large segments of chromosome groups and the like. Wherein "gene knockout" refers to inactivation of a specific target gene by homologous recombination. According to the invention, through a gene knockout technology, the USP30 gene in the host cell is knocked out, and the obtained single clone cell line with USP30 gene coding protein loss of function can inhibit virus replication after SVA infection; the invention also can successfully construct a monoclonal cell line with USP30 gene coding protein loss function by mutating the USP30 gene in the host cell or deleting the gene segment to cause the frame shift mutation of the USP30 gene coding protein.

The term "sgRNA" is a guide RNA that directs the insertion or deletion of uridine residues into the kinetoplast (kinetoplastid) during RNA editing, and is a small non-coding RNA.

The sgRNA of the targeted USP30 gene is artificially synthesized, a CACC cohesive end is further added to the 5 'end of the forward sequence of the sgRNA fragment, an AAAC cohesive end is added to the 5' end of the reverse sequence to prepare the sgRNA oligonucleotide of the targeted USP30 gene, and the sgRNA oligonucleotide is annealed into a double-stranded fragment;

on the basis of direct targeted splicing of the USP30 gene, the USP30 gene knockout is carried out by using a method of specifically knocking out the USP30 gene by using CRISPR/Cas9 in combination and taking human embryonic kidney cell 293T as an example (the amino acid sequence of the USP30 gene is shown as SEQ ID No.1, and the nucleotide sequence is shown as SEQ ID No. 2), so that a strategy is provided for prevention or treatment of SVA. Although the invention only knocks out the USP30 gene in the human embryonic kidney cell 293T to obtain the gene knocked-out cell with SVA resistance, the method can be deduced and expanded to knock out the USP30 gene in other animal cells to construct the gene knocked-out cell with SVA resistance.

The CRISPR/Cas9 system realizes the directional recognition and shearing of genes by sgRNA and Cas9, and the sgRNA determines the targeting property of Cas9 and also determines the cutting activity of Cas 9. The invention aims to realize accurate and efficient knockout of a USP30 gene by screening a sgRNA sequence aiming at a USP30 gene in vitro and in vivo by applying a CRISPR/Cas9 gene editing technology and obtain a USP30 gene knockout monoclonal cell line capable of inhibiting SVA virus replication, thereby providing a new strategy for prevention or treatment of SVA infection.

By using a CRISPR/Cas9 gene editing technology, a Cas9 protein is guided to be combined to a specific sequence position of a USP30 gene by sgRNA of a targeted USP30 gene to cut a DNA double strand, so that the gene double strand is broken, random mutation is generated under the action of a cell self-repair mechanism, the reading frame of the gene is changed due to mutation such as nucleotide deletion or insertion, the purpose of losing the function of a gene coding protein is finally achieved, and a gene coding protein function-losing cell line is obtained.

The experimental methods in the following examples are all conventional methods unless otherwise specified; the test materials used in the following examples were all purchased from conventional biochemicals, unless otherwise specified.

The plasmid sources referred to in the following examples: purchased from the vast plasmid platform.

Cell culture: HEK293T cells were derived from human embryonic kidney cells; DMEM medium containing 10% Fetal Bovine Serum (FBS) and 1% double antibody was placed in a medium containing 5% CO₂The culture was carried out in an incubator (37 ℃).

The virus source is as follows: SVA-eGFP strains are stored in foot-and-mouth disease and new disease epidemiology teams and national foot-and-mouth disease reference laboratories of Lanzhou veterinary research institute of Chinese agricultural academy of sciences.

Example 1 replication results of SVA Virus after USP30 Gene silencing

1. Design of Small interfering RNAs (siRNAs)

The RNA interference target sequence of USP30 gene USP30 siRNA (SEQ ID NO.3-4) and NC siRNA (SEQ ID NO.5-6) are designed, and the specific sequences are as follows:

USP30-siRNA-F:5’-GGAGUACAAGUCUGAAGAATT-3’(SEQ ID NO.3)；

USP30-siRNA-R:5’-UUCUUCAGACUUGUACUCCTT-3’(SEQ ID NO.4)；

NC siRNA-F:5’-UUCUCCGAACGUGUCACGUTT-3’(SEQ ID NO.5)；

NC siRNA-R:5’-ACGUGACACGUUCGGAGAATT-3’(SEQ ID NO.6)。

construction of USP30 gene silencing cell line:

(1) preparation of USP30 gene silencing siRNA Oligo: sending the designed interference RNA sequence to Gima corporation for synthesis to obtain corresponding siRNA Oligo, and using DEPC H₂O resuspend 1OD siRNA to a final concentration of 20 μm. Centrifuging at 10000rpm for 2min before dissolving, slowly opening the tube cover, adding enough DEPC water during dissolving, and fully oscillating to dissolve. Control siRNA (NC) was dissolved in the same manner for use.

(2) Construction of USP30 gene silencing cell line: HEK293T cells were counted and plated in a six-well plate, and when the cell fusion degree reached 70% -80%, 6. mu.L of the solubilized siRNA and Lipofectamine 20006. mu.L were added to 100. mu.L of Opti-MEM, and the two were mixed after resting for 5 min. The liposome-siRNA mixture was left to stand for 20min and added directly to the cell culture medium. The cells were again incubated at 37 ℃ with 5% CO₂Culture boxAnd (3) changing the culture solution after culturing for 6h, detecting mR NA expression after 24-36h, and detecting protein expression after 36-48 h.

Detection of the expression level of USP30 Gene

HEK293T cells are respectively transfected with NC siRNA and USP30 siRNA, the cells are harvested after 24h transfection, and the USP30 protein and gene expression level is detected by using a Westernblotting and fluorescent quantitative PCR method. The detection results are shown in fig. 1, compared with NC siRNA, the expression level of USP30 protein in HEK293T cells is significantly reduced and the transcription level of USP30 gene is significantly reduced after USP30 siRNA transfection, which indicates that USP30 siRNA can inhibit the expression of USP30 gene.

SVA Virus results after SVA Virus infection

Cell transfection and infection methods As described in 3 above, after 12h of SVA infection, cells were harvested and expression levels of SVA virus were detected by Western blotting g and by fluorescent quantitative PCR. The results are shown in fig. 2, compared with the HEK293T cell transfected by NC siRNA, the HEK293T cell transfected by USP30 siRNA can significantly inhibit the expression of SVA VP2 protein and the replication of SVA virus after SVA infection.

The results show that the small interfering RNA taking USP30 as a target can obviously inhibit the expression of the USP30 gene, and further inhibit the replication of SVA virus. Therefore, USP30 as a target can be used to screen or design drugs for inhibiting SVA virus replication, and thus for preventing or treating Seneca Valley virus infection.

Example 2 USP30 Gene knockout HEK293T cell line

1. Design of sgRNA targeting USP30 gene

The sequence of the USP30 gene is queried by using an Ensemble database, and the first exon segment of different transcript overlapping regions of the USP30 in a genome is positioned for target design.

Logging in a CRISPR online design website http:// crispor.tefor.net/designing sg RNA according to a CRISPR/Cas9 design principle, and respectively naming the steps as follows: USP30-sgRNAsp1, USP30-sgRNAsp 2; a CACC cohesive end was added to the 5 'end of the forward sequence and an AAAC cohesive end was added to the 5' end of the reverse sequence of the sgRNA fragment as a sgRNA oligonucleotide targeting the USP30 gene (sgRNA 1-oligo). The sgRNA1-oligo was synthesized by Kingzhi Biotechnology, Inc., and the detailed sequence is shown in Table 1.

Table 1 sgRNA oligonucleotides targeting USP30 gene

Note: the underlined sequences denote the added cleavage sites, the non-underlined sequences are the sgRNA sequences (S EQ ID No. 7-10).

Construction of sgRNA recombinant plasmid PX459-sgRNA

Obtaining double-stranded sgRNA-oligo: the synthesized sgRNA-oligo was diluted to 100. mu. mol/L to formulate a total of 10. mu.L reaction system: 4.5 mu L of upstream primer; downstream primer, 4.5 μ L; 10 × LA PCR Buffer, 1 μ L, gently mix. And (3) annealing procedure: at 95 ℃ for 10 min; and taking out from the PCR instrument for natural cooling.

Enzyme digestion of PX459 vector plasmid: utilizing Bbs I restriction enzyme to cut PX459 vector, and preparing 20 mu L of enzyme cutting system as follows: PX459 vector, 5 μ L; BbsI, 1 μ L; 10 × Buffer, 2 μ L; ddH₂O, 12. mu.L. The mixture was incubated at 37 ℃ for 3 hours for cleavage. Then, nucleic acid electrophoresis was performed, and the linearized PX459 vector fragment containing a sticky end was purified and recovered by using a DNA purification and recovery kit from Promega.

Construction of PX459-sgRNA recombinant plasmid: performing a connection reaction on the purified and recovered PX459 linearization fragment product and a double-chain sgRNA-oligo, wherein the reaction system comprises: t4Ligase, 0.5. mu.L; 10 XT 4Ligase Buffer, 0.5. mu.L; PX459 enzyme digestion purified fragment, 0.5 mu L; double stranded sgRNA-oligo, 3.5. mu.L, for a 5. mu.L system. The ligation product was transformed into Tran 5. alpha. E.coli competent cells at 16 ℃ overnight, and the recombinant plasmid was clonally amplified. Transformation procedure: 50 μ L of Trans5 α competent cells were mixed with 500ng of ligation product and placed on ice for 30 min. The heat shock in the water bath was carried out at 42 ℃ for 45 seconds, and the ice bath was taken out for 2 minutes. To the mixture was added 500mL of non-resistant LB medium, and the mixture was shaken at 37 ℃ and 220rpm for 60 minutes. And centrifuging the recovered bacterial liquid at 4000rpm for 5min at room temperature. After sucking 400. mu.L of the supernatant, the remaining supernatant and the precipitated cells were sufficiently suspended, and the transformed E.coli was spread on an LB plate having ampicillin resistance by means of a smear stick, incubated at 37 ℃ in an incubator for 12 hours, and the growth was observed.

Picking monoclonal colony, shaking with LB liquid culture medium containing ampicillin resistance for 12h, and using

The plasmid extraction kit extracts and performs sequencing verification, the sequencing result is shown in figure 3, and the sequence obtained by detecting the constructed plasmid by using the TRC universal primer is compared with the original vector and is consistent with the expected result. The construction of plasmids PX459-USP30-sg RNA1, PX459-USP30-sgRNA2 expressing sgRNA is shown to be successful; wherein A is PX459-USP30-sgRNA1, and B is PX459-US P30-sgRNA 2.

3. Cell transfection

The HEK293T cells are recovered in a T25 cell bottle before transfection, DME M medium containing 10% FBS and 1% double antibody is used for culture, when the cell passage is stable and the state is good for 2-3 times, the cells are digested and then paved in a cell six-well plate, when the cell fusion degree is 70% -80%, 2 mu g of successfully constructed recombinant plasmid and Lipofectamine2000 are respectively added into 50 mu L of Opti-MEM according to the proportion of 1 mu g: 2 mu L, and the two are mixed after standing for 5 min. The liposome-plasmid DNA mixture was allowed to stand for 20min and added directly to the cell culture medium. The cells were again incubated at 37 ℃ with 5% CO₂After 24 hours of incubation in an incubator, cells were treated with puromycin at a concentration of 8. mu.g/mL for 2-3 days and cells positive for transfection were selected. Subsequently, 100 positive cells were plated in a 96-well plate by cell counting to obtain a single cell clone.

(1) Extracting cell DNA and detecting gene targeting efficiency:

extracting the genome of the single cell clone according to the operation instruction of the trace DNA extraction kit, and further amplifying a USP30 gene fragment containing the targeting site segment by using DNA check primers which are:

USP30-check-F：GTAGGGTGTCTGCCCGAGGTGGGTAGTT(SEQ ID NO.15)；

USP30-check-R：TATCAAGTGTTGGTATTGTATTTACCTG(SEQ ID NO.16)。

the results are shown in FIG. 4, and all single cell clones amplified a fragment of about 2000 bp size, consistent with the expected designed fragment size, in comparison to wild type HEK293T cells. And then, the nucleic acid gel at the target position is subjected to gel cutting, purification and recovery, and then is sent to be sequenced, a sequencing map is shown in figure 5, and a large number of nested peaks appear in a sequencing peak map, which indicates that effective gene editing occurs in an amplified fragment.

(2) USP30-KOs Western blotting validation

HEK293T cells (wild type cells) without gene editing were used as negative controls. Culturing wild type cell (WT) strain and 3 knock-out candidate cell strains (KO 1-KO3), collecting cells, and placing on ice. Adding a proper amount of 1 xSDS loading Buffer, fully stirring and cracking, sucking the cells into an EP tube after the cells completely fall off, and marking; after denaturation in a metal bath for 15 minutes and centrifugation, the supernatant was subjected to SDS-PAGE. Transferring to an NC membrane by a wet transfer method after electrophoresis, sealing by using 5% skimmed milk powder after transfer, detecting an antigen-antibody complex by using purchased 60kDa USP30 rabbit antibody as a primary antibody and goat anti rabbit IgG (IgG-HRP) as a secondary antibody, and verifying the protein expression level of the HEK293T monoclonal cell line knocked out by the USP30 gene.

The experimental result is shown in fig. 6, a clear USP30 protein band is detected by WT, and a USP30 protein band is not detected in 3 candidate cell strains, which indicates that the USP30 gene targeting in three candidate strains of KO1, KO2 and KO3 is successful, and indicates that the complete knockout of the USP30 gene in the host cell is realized by using the sgRNA provided by the invention and the CRISPR-Cas9 technology.

Example 3 USP30 knock-out of the HEK293T cell line on SVA replication

HEK293T cells and wild type HEK293T cells are knocked out by USP30 gene, after normal subculture, the cells are paved on a 35mm cell culture dish, SVA-eGFP virus is inoculated, and the SVA replication condition is detected by Western blotting and qPCR methods respectively.

The fluorescence detection result is shown in fig. 7, and the result shows that the replication result of SVA in USP30 gene knockout HEK293T cells is obviously reduced. The Western blotting detection result is shown in FIG. 8, and the result shows that the expression level of VP2 protein of SVA in USP30 gene knockout HEK293T cells is obviously reduced.

The qPCR detection result is shown in FIG. 9, and the mRNA level of the virus is significantly reduced compared with that of wild cells after USP30 gene knockout HEK293T cells are inoculated with SVA.

The results show that the USP30 gene knockout HEK293T cell obtained by the gene editing technology can obviously inhibit the replication of SV A and has SVA resistance. Therefore, the constructed function-losing cells of the protein coded by the USP30 gene can be used for breeding animals against SVA virus.

In conclusion, the cell line with the function loss of the protein coded by the USP30 gene is successfully constructed by the CRISPR-Cas9 technology. However, the invention is not limited to the CRISPR-Cas9 technology, and on the basis of the invention, the cell line with the USP30 gene encoding protein loss can also be obtained by losing the U SP30 gene encoding protein function through other technical means. Other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principles of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> application of USP30 gene as target point in inhibiting replication of Seneca Valley virus

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 517

<212> PRT

<213> human (human)

<400> 1

Met Leu Ser Ser Arg Ala Glu Ala Ala Met Thr Ala Ala Asp Arg Ala

1 5 10 15

Ile Gln Arg Phe Leu Arg Thr Gly Ala Ala Val Arg Tyr Lys Val Met

20 25 30

Lys Asn Trp Gly Val Ile Gly Gly Ile Ala Ala Ala Leu Ala Ala Gly

35 40 45

Ile Tyr Val Ile Trp Gly Pro Ile Thr Glu Arg Lys Lys Arg Arg Lys

50 55 60

Gly Leu Val Pro Gly Leu Val Asn Leu Gly Asn Thr Cys Phe Met Asn

65 70 75 80

Ser Leu Leu Gln Gly Leu Ser Ala Cys Pro Ala Phe Ile Arg Trp Leu

85 90 95

Glu Glu Phe Thr Ser Gln Tyr Ser Arg Asp Gln Lys Glu Pro Pro Ser

100 105 110

His Gln Tyr Leu Ser Leu Thr Leu Leu His Leu Leu Lys Ala Leu Ser

115 120 125

Cys Gln Glu Val Thr Asp Asp Glu Val Leu Asp Ala Ser Cys Leu Leu

130 135 140

Asp Val Leu Arg Met Tyr Arg Trp Gln Ile Ser Ser Phe Glu Glu Gln

145 150 155 160

Asp Ala His Glu Leu Phe His Val Ile Thr Ser Ser Leu Glu Asp Glu

165 170 175

Arg Asp Arg Gln Pro Arg Val Thr His Leu Phe Asp Val His Ser Leu

180 185 190

Glu Gln Gln Ser Glu Ile Thr Pro Lys Gln Ile Thr Cys Arg Thr Arg

195 200 205

Gly Ser Pro His Pro Thr Ser Asn His Trp Lys Ser Gln His Pro Phe

210 215 220

His Gly Arg Leu Thr Ser Asn Met Val Cys Lys His Cys Glu His Gln

225 230 235 240

Ser Pro Val Arg Phe Asp Thr Phe Asp Ser Leu Ser Leu Ser Ile Pro

245 250 255

Ala Ala Thr Trp Gly His Pro Leu Thr Leu Asp His Cys Leu His His

260 265 270

Phe Ile Ser Ser Glu Ser Val Arg Asp Val Val Cys Asp Asn Cys Thr

275 280 285

Lys Ile Glu Ala Lys Gly Thr Leu Asn Gly Glu Lys Val Glu His Gln

290 295 300

Arg Thr Thr Phe Val Lys Gln Leu Lys Leu Gly Lys Leu Pro Gln Cys

305 310 315 320

Leu Cys Ile His Leu Gln Arg Leu Ser Trp Ser Ser His Gly Thr Pro

325 330 335

Leu Lys Arg His Glu His Val Gln Phe Asn Glu Phe Leu Met Met Asp

340 345 350

Ile Tyr Lys Tyr His Leu Leu Gly His Lys Pro Ser Gln His Asn Pro

355 360 365

Lys Leu Asn Lys Asn Pro Gly Pro Thr Leu Glu Leu Gln Asp Gly Pro

370 375 380

Gly Ala Pro Thr Pro Val Leu Asn Gln Pro Gly Ala Pro Lys Thr Gln

385 390 395 400

Ile Phe Met Asn Gly Ala Cys Ser Pro Ser Leu Leu Pro Thr Leu Ser

405 410 415

Ala Pro Met Pro Phe Pro Leu Pro Val Val Pro Asp Tyr Ser Ser Ser

420 425 430

Thr Tyr Leu Phe Arg Leu Met Ala Val Val Val His His Gly Asp Met

435 440 445

His Ser Gly His Phe Val Thr Tyr Arg Arg Ser Pro Pro Ser Ala Arg

450 455 460

Asn Pro Leu Ser Thr Ser Asn Gln Trp Leu Trp Val Ser Asp Asp Thr

465 470 475 480

Val Arg Lys Ala Ser Leu Gln Glu Val Leu Ser Ser Ser Ala Tyr Leu

485 490 495

Leu Phe Tyr Glu Arg Val Leu Ser Arg Met Gln His Gln Ser Gln Glu

500 505 510

Cys Lys Ser Glu Glu

515

<210> 2

<211> 1554

<212> DNA

<213> human (human)

<400> 2

atgctgagct cccgggccga ggcggcgatg accgcggccg acagggccat ccagcgcttc 60

ctgcggaccg gggcggccgt cagatataaa gtcatgaaga actggggagt tataggtgga 120

attgctgctg ctcttgcagc aggaatatat gttatttggg gtcccattac agaaagaaag 180

aagcgtagaa aagggcttgt gcctggcctt gttaatttag ggaacacctg cttcatgaac 240

tccctgctac aaggcctgtc tgcctgtcct gctttcatca ggtggctgga agagttcacc 300

tcccagtact ccagggatca gaaggagccc ccctcacacc agtatttatc cttaacactc 360

ttgcaccttc tgaaagcctt gtcctgccaa gaagttactg atgatgaggt cttagatgca 420

agctgcttgt tggatgtctt aagaatgtac agatggcaga tctcatcatt tgaagaacag 480

gatgctcacg aattattcca tgtcattacc tcgtcattgg aagatgagcg agaccgccag 540

cctcgggtca cacatttgtt tgatgtgcat tccctggagc agcagtcaga aataactccc 600

aaacaaatta cctgccgcac aagagggtca cctcacccta catccaatca ctggaagtct 660

caacatcctt ttcatggaag actcactagt aatatggtct gcaaacactg tgaacaccag 720

agtcctgttc gatttgatac ctttgatagc ctttcactaa gtattccagc cgccacatgg 780

ggtcacccat tgaccctgga ccactgcctt caccacttca tctcatcaga atcagtgcgg 840

gatgttgtgt gtgacaactg tacaaagatt gaagccaagg gaacgttgaa cggggaaaag 900

gtggaacacc agaggaccac ttttgttaaa cagttaaaac tagggaagct ccctcagtgt 960

ctctgcatcc acctacagcg gctgagctgg tccagccacg gcacgcctct gaagcggcat 1020

gagcacgtgc agttcaatga gttcctgatg atggacattt acaagtacca cctccttgga 1080

cataaaccta gtcaacacaa ccctaaactg aacaagaacc cagggcctac actggagctg 1140

caggatgggc cgggagcccc cacaccagtt ctgaatcagc caggggcccc caaaacacag 1200

atttttatga atggcgcctg ctccccatct ttattgccaa cgctgtcagc gccgatgccc 1260

ttccctctcc cagttgttcc cgactacagc tcctccacat acctcttccg gctgatggca 1320

gttgtcgtcc accatggaga catgcactct ggacactttg tcacttaccg acggtcccca 1380

ccttctgcca ggaaccctct ctcaactagc aatcagtggc tgtgggtctc cgatgacact 1440

gtccgcaagg ccagcctgca ggaggtcctg tcctccagcg cctacctgct gttctacgag 1500

cgcgtccttt ccaggatgca gcaccagagc caggagtgca agtctgaaga atga 1554

<210> 3

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggaguacaag ucugaagaat t 21

<210> 4

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

uucuucagac uuguacucct t 21

<210> 5

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uucuccgaac gugucacgut t 21

<210> 6

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acgugacacg uucggagaat t 21

<210> 7

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caccgtcgct catcttccaa tgacg 25

<210> 8

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaaccgtcat tggaagatga gcgac 25

<210> 9

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caccgctcac cctacatcca atcac 25

<210> 10

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaacgtgatt ggatgtaggg tgagc 25

<210> 11

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

caccgtcgct catcttccaa tgacg 25

<210> 12

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aaaccgtcat tggaagatga gcga 24

<210> 13

<211> 25

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caccgctcac cctacatcca atcac 25

<210> 14

<211> 24

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaacgtgatt ggatgtaggg tgag 24

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtagggtgtc tgcccgaggt gggtagtt 28

<210> 16

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tatcaagtgt tggtattgta tttacctg 28

Claims

The application of USP30 gene/protein as a target point in screening drugs for preventing or treating Seneca Valley virus infection is characterized in that the drugs use USP30 gene/protein as a target point to inhibit or silence the expression of USP30 gene/protein.
2. Use of an agent or medicament for inhibiting the expression of the gene/protein of USP30 in the manufacture of a medicament for the prevention or treatment of senegavirus infection.
3. The use of claim 2, wherein the agent or drug is a small interfering RNA targeted to the USP30 gene/protein.
4. The use of claim 3, wherein the small interfering RNA has the sequence:

USP30-siRNA-F:5’-GGAGUACAAGUCUGAAGAATT-3’；

USP30-siRNA-R:5’-UUCUUCAGACUUGUACUCCTT-3’。
5. the use of claim 2, wherein the agent or medicament comprises mRNA sequences of sgRNA and Cas9 protein targeted for knock-out of the USP30 gene.
6. The use of claim 5, wherein the sgRNA includes at least one of USP30-sgRNA1, USP30-sgRNA2, and the nucleotide sequence of the sgRNA is:

USP30-sgRNA1-F：5’-CACCGTCGCTCATCTTCCAATGACG-3’；

USP30-sgRNA1-R：5’-AAACCGTCATTGGAAGATGAGCGAC-3’；

USP30-sgRNA2-F：5’-CACCGCTCACCCTACATCCAATCAC-3’；

USP30-sgRNA2-R：5’-AAACGTGATTGGATGTAGGGTGAGC-3’。
7. a sgRNA for specifically targeting and knocking out a USP30 gene, wherein the sgRNA comprises at least one of USP30-sgRNA1 and USP30-sgRNA2, and the nucleotide sequence of the sgRNA is as follows:

USP30-sgRNA1-F：5’-CACCGTCGCTCATCTTCCAATGACG-3’；

USP30-sgRNA1-R：5’-AAACCGTCATTGGAAGATGAGCGAC-3’；

USP30-sgRNA2-F：5’-CACCGCTCACCCTACATCCAATCAC-3’；

USP30-sgRNA2-R：5’-AAACGTGATTGGATGTAGGGTGAGC-3’。
8. use of the sgRNA of claim 7 in the preparation of a USP30 gene knockout cell line.
9. A method for constructing a USP30 gene knockout cell line, comprising the steps of:

(1) preparing the sgRNA specifically targeting the USP30 gene according to claim 7, adding a CACC cohesive end at the 5 'end of the forward sequence of the sgRNA fragment, and adding an AAAC cohesive end at the 5' end of the reverse sequence, and using the sgRNA oligonucleotide as a sgRNA oligonucleotide targeting the USP30 gene;

(2) inserting the double-stranded fragment prepared in the step (1) into a multiple cloning site of a PX459 expression plasmid vector to obtain a recombinant vector for simultaneously expressing a Cas9 protein gene and a targeting sgRNA sequence;

(3) transfecting the host cell with the recombinant vector prepared in the step (2), screening and killing negative cells by puromycin (puromycin) antibiotics, selecting single cells, inoculating and culturing to obtain a USP30 gene function-deleted cell line.
10. A USP30 knock-out cell line constructed according to the method of claim 9.