CN109678967B

CN109678967B - Targeting polypeptide for treating osteosarcoma and application thereof

Info

Publication number: CN109678967B
Application number: CN201811490126.6A
Authority: CN
Inventors: 康铁邦; 廖丹; 钟理; 沈靖南; 隋建华
Original assignee: Sun Yat Sen University Cancer Center
Current assignee: Sun Yat Sen University Cancer Center
Priority date: 2018-12-06
Filing date: 2018-12-06
Publication date: 2022-01-04
Anticipated expiration: 2038-12-06
Also published as: WO2020113917A1; CN109678967A

Abstract

The invention discloses a targeting polypeptide for treating osteosarcoma and application thereof; the amino acid sequence of the polypeptide is shown as SEQ ID NO.1 or SEQ ID NO. 2; in vitro experiment results show that the polypeptide can antagonize the capability of RAB22A-NeoF1 in promoting osteosarcoma cell adhesion, migration and invasion; in vivo experiment results show that the polypeptide can antagonize the capability of RAB22A-NeoF1 in promoting osteosarcoma cell transfer, and the application prospect of the polypeptide in preparing osteosarcoma treatment medicines is large.

Description

Targeting polypeptide for treating osteosarcoma and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a targeting polypeptide for treating osteosarcoma and application thereof.

Background

Osteosarcoma (Osteosarcoma) is a relatively rare malignant primary bone tumor, and the incidence population is mainly concentrated in children and adolescents. The main reason for the occurrence of osteosarcoma is that immature bone or osteoid tissue is generated due to malignant transformation of osteoblasts, and the osteosarcoma is clinically found to be easy to generate lung metastasis, high in malignancy degree and poor in prognosis.

The osteosarcoma is treated mainly by amputation in the early stage, the five-year survival rate is only 15% -17%, since the seventies of the twentieth century, the survival rate of osteosarcoma patients is greatly improved with the clinical application of chemotherapeutic drugs, the existing treatment means mainly comprises surgical resection of in-situ tumors and auxiliary combination of chemotherapeutic drugs (adriamycin, cisplatin and high-dose methotrexate), and the five-year survival rate of the patients with in-situ osteosarcoma is increased to 70%. However, 15% to 30% of patients have pulmonary metastasis even after primary diagnosis of osteosarcoma, and the five-year survival rate of patients with recurrence or pulmonary metastasis has not been improved for about three decades, which is only about 20%, so that it is necessary and urgent to find a new drug capable of effectively treating osteosarcoma, and therefore, it is important to find a targeted drug for treating osteosarcoma by analyzing the pathogenesis, progression and prognosis of osteosarcoma on a molecular level and a genetic perspective.

A high frequency of structural, copy number, and single nucleotide variations occurs in osteosarcoma, and this variation is much higher than in other tumors. Recent whole genome sequencing results also discover a brand-new genetic information variation phenomenon: chromosome breakage (chromothripsis), i.e., the phenomenon that a cell is affected by a specific single mutation event, has hundreds of chromosome rearrangements in a certain region on a chromosome, and the probability of chromosome breakage in osteosarcoma is as high as 33%, while the probability of other tumors is only 2% -3%.

According to previous studies, the most frequent driver mutation in osteosarcoma was reported to be P53 followed by RB 1. In all sequencing results, the mutation frequency of P53 is as high as 80%, and most of the mutations occur in the structural variant segment of intron 1, and although no P53 mutation is detected in part of osteosarcoma tissues, mutations also exist in a large number of molecules involved in the regulation of the P53 pathway, such as MDM 2. While RB1 is the first high-frequency driver gene detected in osteosarcoma, although the mutation itself is not as frequent as P53, there are also a large number of mutations in its related genes, such as CDK4 and cyclin D copy number amplification. In addition, the functions of the driving genes of P53 and RB1 have been verified in a mouse model, and experiments prove that P53 knockout mice can spontaneously form various tumors, including osteosarcoma. P53 was conditionally knocked out in mice expressing Prx1, Osterix and CollA1, and the probability of spontaneous osteosarcoma formation in mice reached nearly 100%. Although the RB1 knockout in mice is embryonic lethal and the RB1 conditional knockout mice do not spontaneously form osteosarcoma, the crossing of RB1 conditional knockout mice with P53 knockout mice accelerates the rate at which mice spontaneously form osteosarcoma. Other high-frequency mutations in osteosarcoma include RECQL4, RUNX2, GRM4, ALT, ATRX, DLG2, IGF1R and the like, and further verification of the function and clinical significance of the mutations through cytology and mouse model experiments is needed.

Besides the variation of genome genetic information, the protein level and the mRNA of a plurality of key molecules for regulating the tumor growth are also abnormally and highly expressed in osteosarcoma, and the protein level comprises IGF, VEGF, HER2, PDGFR, MET and the like, so that a plurality of potential targets are provided for osteosarcoma molecular therapy. RAB22A-NeoFs is a newly identified fusion gene line in osteosarcoma and can promote the generation and development of osteosarcoma; however, at present, no report is available on the specific polypeptide of the RAB22A-NeoFs fusion gene positive osteosarcoma patient.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the defects in the prior art and provide the RAB22A-NeoFs-iRGD fusion polypeptide for treating osteosarcoma.

Another objective of the invention is to provide an application of the RAB22A-NeoFs-iRGD fusion polypeptide.

The above object of the present invention is achieved by the following technical solutions:

a polypeptide of anti-RAB 22A-NeoFs fusion protein, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO. 1:

SEQ ID NO.1：MALRELKVAL。

meanwhile, the invention also provides another RAB22A-NeoFs-iRGD fusion polypeptide of anti-RAB 22A-NeoFs fusion protein, and the amino acid sequence of the fusion polypeptide is shown in SEQ ID NO. 2:

SEQ ID NO.2：MALRELKVALGGCRGDKGPDC。

preferably, the iRGD polypeptide sequence is looped through its terminal amino acids.

The RAB22A-NeoFs-iRGD fusion polypeptide is formed by coupling a protein sequence of a targeted fusion gene system RAB22A-NeoFs and an iRGD polypeptide sequence through two glycines. Specifically, the first 10 amino acids (SEQ ID NO.1) of the protein expressed by the RAB22A-NeoFs fusion gene system are connected to the iRGD sequence through GG. The tumor targeting polypeptide iRGD is connected with a protein sequence of a targeting fusion gene system RAB22A-NeoFs, so that the targeting therapeutic effect of the polypeptide of SEQ ID NO.1 can be better exerted.

In vitro experiments prove that the polypeptides shown in SEQ ID NO.1 and SEQ ID NO.2 can antagonize the ability of RAB22A-NeoF1 in promoting osteosarcoma cell adhesion, migration and invasion; the fusion polypeptide can antagonize the ability of RAB22A-NeoF1 to promote osteosarcoma cell metastasis through in vivo experiments.

Therefore, the invention requests to protect the application of the polypeptide shown in SEQ ID NO.1 or SEQ ID NO.2 in preparing osteosarcoma treatment medicines.

Preferably, the osteosarcoma comprises the RAB22A-NeoFs fusion protein.

More preferably, the osteosarcoma comprises the RAB22A-NeoF1 fusion protein.

Also, the following applications are within the scope of the invention:

the polypeptide shown in SEQ ID NO.1 or SEQ ID NO.2 is applied to the preparation of medicines for antagonizing RAB22A-NeoF1 fusion protein to promote osteosarcoma cell adhesion, migration and invasion.

The application of the polypeptide of SEQ ID NO.1 or SEQ ID NO.2 in preparing the medicine for antagonizing RAB22A-NeoF1 fusion protein to promote osteosarcoma cell lung metastasis.

In addition, the invention also provides a medicine for treating osteosarcoma, which contains the polypeptide shown in SEQ ID NO.1 or SEQ ID NO. 2.

Preferably, the dosage of the polypeptide shown in SEQ ID NO.1 or SEQ ID NO.2 is 1-10 mg/kg.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a polypeptide of anti-RAB 22A-NeoFs fusion protein, the amino acid sequence of which is shown in SEQ ID NO.1 or SEQ ID NO. 2; in vitro experiment results show that the polypeptide can antagonize the capability of RAB22A-NeoF1 in promoting osteosarcoma cell adhesion, migration and invasion; in vivo experiment results show that the polypeptide can antagonize the capability of RAB22A-NeoF1 in promoting osteosarcoma cell transfer, and the application prospect of the polypeptide in preparing osteosarcoma treatment medicines is large.

Drawings

FIG. 1 shows the binding of RAB22A-NeoF1 to RAP1GDS1 protein through its first 10 amino acid sequences.

FIG. 2 shows that RBA22A-NoeF1 exerts its function of promoting migration and invasion of osteosarcoma through its first 10 amino acids.

FIG. 3 is a graph showing the ability of the fusion polypeptide to antagonize RAB22A-NeoF1 in promoting osteosarcoma cell adhesion; wherein Pep-wt represents the fusion polypeptide and Pep-DD represents the control polypeptide.

FIG. 4 is a graph showing that the fusion polypeptide antagonizes the ability of RAB22A-NeoF1 to promote migration and invasion of osteosarcoma cells, wherein Pep-wt represents the fusion polypeptide and Pep-DD represents the control polypeptide.

FIG. 5 is a graph showing that the fusion polypeptide is capable of antagonizing the ability of RAB22A-NeoF1 to promote osteosarcoma cell metastasis; wherein WT represents a fusion polypeptide and DD represents a control polypeptide.

Detailed Description

The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 identification of RAB22A-NeoF1 interaction region with RAP1GDS1 protein

The inventor team has found that through a large amount of previous researches, RAB22A-NeoF1 plays the functions mainly through the interaction with RAP1GDS 1. Therefore, the RAB22A-NeoF1 and RAP1GDS1 protein interaction region is identified by constructing RAB22A-NeoF1 and RAP1GDS protein expression system.

The method specifically comprises the following steps:

construction of protein expression vector

1. Construction of full-length RAB22A-NeoF1 and RAP1GDS1 and truncation expression vector

(1) The primer sequence is as follows:

①RAP1GDS1-F(SEQ ID NO.3):

CTTAAGCTTGGTACCATGGCAGATAATCTCAGTGATAC

RAP1GDS1-R(SEQ ID NO.4):

TTAAACGGGCCCTCTAGATCAAGCGTAATCTGGAACATGTATGGGTAGCTTTCCACAGTAAG

②RAB22A-NeoF1-Full-length-F(SEQ ID NO.5):

CTTAAGCTTGGTACCATGGCGCTGAGGGAGCTCAAAGT

RAB22A-NeoF1-Full-length-R(SEQ ID NO.6):

TTAAACGGGCCCTCTAGACTAGGGCTCCCGCTGGCCCTG

③RAB22A-NeoF1-de l 1-10-F(SEQ ID NO.7):

CTTAAGCTTGGTACCATGCTCGGGGATACAGGTGTAG

RAB22A-NeoF1-del 1-10-R(SEQ ID NO.8):

TTAAACGGGCCCTCTAGACTAGGGCTCCCGCTGGCCCTG

④RAB22A-NeoF1-del 1-20-F(SEQ ID NO.9):

CTTAAGCTTGGTACCATGATTGTGTGGCGGTTTGTGGA

RAB22A-NeoF1-del 1-20-R(SEQ ID NO.10):

TTAAACGGGCCCTCTAGACTAGGGCTCCCGCTGGCCCTG

⑤RAB22A-NeoF1-del 1-30-F(SEQ ID NO.11):

CTTAAGCTTGGTACCATGGATCCAAACATCAACCCAAC

RAB22A-NeoF1-del 1-30R(SEQ ID NO.12):

RTTAAACGGGCCCTCTAGACTAGGGCTCCCGCTGGCCCTG

⑥RAB22A-NeoF1-del 1-40-F(SEQ ID NO.13):

CTTAAGCTTGGTACCATGACATATGTAGGGAGCACTTG

RAB22A-NeoF1-del 1-40-R(SEQ ID NO.14):

TTAAACGGGCCCTCTAGACTAGGGCTCCCGCTGGCCCTG

⑦RAB22A-NeoF1-1-38-F(SEQ ID NO.15):

CTTAAGCTTGGTACCATGGCGCTGAGGGAGCTCAAAGT

RAB22A-NeoF1-1-38-R(SEQ ID NO.16):

TTAAACGGGCCCTCTAGACTATATTGTTGGGTTGATGTTTG

(2) sequence amplification

The sequence was amplified using the high fidelity enzyme MIX primSTAR from TAKARA and the primers described above as follows:

the mixture is evenly mixed and then placed in a PCR instrument, and the reaction conditions are as follows:

after 5min of pre-denaturation at 95 ℃, 38 cycles were performed under the following conditions:

98℃ 15s

55℃～60℃ 30s

72℃ 5kb/min

after 38 cycles, carrying out one-step extension reaction at 72 ℃ for 10min, and then recovering an amplification product;

(3) enzyme digestion (including over-expression vector PBABE and amplification product)

The cleavage reaction was carried out in a 200. mu.LPCR tube. The reaction system is as follows:

the enzyme is cut for 1h at 37 ℃, and the cut product is recovered.

(4) Connection of

The ligation reaction was carried out at room temperature, and the reaction system was as follows:

the ligation was performed at room temperature overnight.

(5) Transformation of

mu.L of the ligation product was added to competent cells (Stbl3), gently mixed, ice-cooled for 20min, heat-shocked at 42 ℃ for 60s, followed by ice-cooled for 2min, and 500. mu.L of LB medium without antibiotics added, shaker 37 ℃, 200rpm, 30 min. And (3) using sterile glass beads to plate a resistant solid LB culture plate corresponding to the plasmid to be transformed, putting the plate into a bacterial incubator at 37 ℃, culturing overnight, picking out a monoclonal colony on the next day, and sending the colony to a SANGER (sequencing and verification) to verify whether the cloning is successful or not.

2. Transient transfection of plasmids

Plasmid transient transfection was performed using Lipofectamine2000, exemplified by cell culture 6-well plates:

1) the cell inoculation density is 70%, and the medium is replaced by serum-free complete medium before transfection.

2) Adding the transfection reagent Lipofectamine2000 and the target plasmid into 500uL Opti-MEM optimized culture medium according to the volume plasmid ratio of 1:1, fully mixing uniformly, and standing for 10 min.

3) Adding the incubated transfection solution into cells, changing the cells into a 10% FBS complete culture medium after 6 hours, and continuing to culture for 48-72 hours for objective experiments.

3. Protein Co-Immunoprecipitation (Co-Immunoprecipitation)

SFB-tagged-RAB22A-NeoF1-Full-length or individual truncations (1-38/. DELTA.1-10/. DELTA.1-20/. DELTA.1-30/. DELTA.1-40) were co-transfected with HA-tagged-RAP1GDS1 at 293 t. And collecting the protein after 48 hours, adding S-beads or V5-agarose into the protein lysate, incubating for 6 hours in a shaking table at 4 ℃, performing X1 min at 10000rpm, discarding the supernatant, adding RIPA (Ripa for cleaning), centrifuging again, discarding the supernatant, repeating the steps for 5 times, adding loading buffer for denaturation, performing Western blotting, and detecting the interaction between the proteins by using an HA antibody and a Flag antibody.

Second, the detection result

Results of the experiment as shown in fig. 1, it can be seen from fig. 1 that the fusion protein RAB22A-NeoF1 interacts with RAP1GDS1 through its first 10 amino acids.

Example 2 function of the first 10 amino acids of RAB22A-NeoF1 in osteosarcoma

Method and device

1. Construction of Stable overexpression vectors

(1) Sequence amplification of full length RAB22A-NeoF1 and Del-N10 (minus the first 10 amino acids of RAB22A-NeoF1)

The full length RAB22A-NeoF1 and Del-N10 sequences were amplified using the high fidelity enzyme MIX primSTAR from TAKARA with the specific primers of example 1 as follows:

98℃ 15s

55-60℃ 30s

72℃ 5kb/min

(2) enzyme digestion (including over-expression vector PBABE and amplification product)

the enzyme is cut for 1h at 37 ℃, and the cut product is recovered.

(3) Connection of

ligation at room temperature overnight

(4) Transformation of

2. Packaging viruses

(1) 293T cells were inoculated on a 10cm diameter dish one day before transfection and cultured in 10% FBS DMEM medium;

(2) the co-transfection plasmid pBABE (vector, fusion, Del-N10) at 50% fusion of packaging cells with the packaging plasmid PIK of the virus at 6. mu.g each and 30. mu.L of the standard lipofectamine (TM) 2000;

(3) after 6h, changing the solution, and adding 10mL of fresh culture medium;

(4) and sterilizing and filtering the culture supernatant after 48-72 h by using a non-nitrocellulose filter (a filter such as cellulose acetate) with the diameter of 0.45 mu m to prevent the nitrocellulose from being combined with virus cell membrane protein to destroy viruses, removing cell debris and polluted packaging cells, and temporarily storing at 4 ℃ for a long time and storing at-80 ℃ for later use.

3. Retroviral infection of target cells

(1) One day (18-24 h) before infection, target cells are plated (six-hole plate);

(2) after the cells grow to 50% density, 2mL of virus-containing supernatant is added with 8. mu.g/mL of 1000 Xpolybrene;

(3) DMEM with 10% FBS in normal medium was changed after 6h, typically 2 infections;

(4) after 48 hours, the puromycin with the concentration of 0.5-1.0 mu g/mL (the range is 500-1000 mu g/mL, and the concentration is decreased by 100 mu g/mL each time) is used for screening;

(5) changing the culture medium every 1-2 days, wherein each culture medium contains the same puromycin concentration in the culture process, and adjusting the puromycin concentration according to the cell death condition;

(6) cell construction was successful after about 1 week.

4. Cell migration and invasion assay

(1) Transwell cell preparation: preparation of Transwell coated matrigel Chamber

Coating a basement membrane: the upper side of the bottom membrane of the Transwell cell was coated with 50mg/L Matrigel 1:8 dilution and air dried at 4 deg.C (or overnight in a refrigerator at 4 deg.C).

Hydration of basement membrane: mu.L of serum-free medium containing 10g/L BSA was added to each well, and the mixture was incubated at 37 ℃ for 30 min.

(2) Preparation of cell suspensions

Digesting the over-expression cell line successfully constructed, centrifuging after terminating digestion, discarding the culture solution, washing for 1-2 times by PBS (phosphate buffer solution), re-suspending by a serum-free or low-serum culture medium, and adjusting the cell density to 1 × 10⁵～10×10⁵。

(3) Seeding cells

Firstly, sucking out residual liquid in a culture plate, taking 100-200 mu L of cell suspension, and adding the cell suspension into an upper chamber of a Transwell;

② 500 mu L of culture medium containing FBS or chemotactic factor is generally added into the lower chamber of the 24-pore plate;

③ culturing the cells: and culturing for 24h conventionally.

5. And (4) counting results: the ability to invade and migrate was compared by counting the number of cells that crossed the membrane.

(1) The matrigel and cells in the upper chamber were wiped off with a cotton swab.

(2) 0.1% crystal violet staining by the following method: 1) fixing 4% paraformaldehyde for 15min, and washing; 2) soaking, and dyeing by 0.05% crystal violet for 15-30 min; 3) and washing with PBS for 2-3 times.

(3) Cell counting: counting the number of cells in a plurality of visual fields, and randomly selecting 3-10 visual fields.

Second, the detection result

The experimental results are shown in fig. 2, and it can be seen from fig. 2 that the fusion protein RAB22A-NeoF1 exerts its function of promoting migration and invasion of osteosarcoma cells through its first 10 amino acids.

EXAMPLE 3 therapeutic value of fusion Polypeptides

1. Synthesis of fusion polypeptides

The fusion polypeptide is synthesized by medium peptide biochemistry company Limited, and the sequence of the fusion polypeptide is as follows: MALRELKVALGGCRGDKGPDC, prepared by connecting the first 10 amino acids MALRELKVAL of the protein expressed by RAB22A-NeoFs fusion gene system to iRGD sequence (CRGDKGPDC) through GG. The iRGD polypeptide sequence is looped through the terminal amino acid thereof.

2. Cell adhesion experiment

(1) Coating of the substrate: adding LN and FN 50 μ L (2 μ g) to 96-well culture plate, and placing in refrigerator at 4 deg.C overnight, with BSA as control substrate;

(2) washing with PBS twice, rehydrating, adding 10% BSA 50 μ L/well to block binding site, incubating for 60min, and rinsing with PBS three times and 5 min;

(3) preparing the well-grown cells into single cell suspension with the concentration of 8 multiplied by 10⁴200. mu.L/mL of each of the cells were added to a 96-well plate coated with different substrates (Fn or Ln) at 37 ℃ with 5% CO₂Incubating for 60 min;

(4) discarding the culture medium, adding PBS to gently wash off non-adhered cells for 3 times;

(5) adding 4% paraformaldehyde for fixing for 10 minutes;

(6) discarding 4% paraformaldehyde, and adding crystal violet for dyeing for 30 minutes;

(7) discarding crystal violet, washing with PBS for 3 times, taking pictures under a microscope and counting;

the results are shown in fig. 3, and indicate that the fusion polypeptide can antagonize the ability of RAB22A-NeoF1 to promote osteosarcoma cell adhesion.

3. Cell migration and invasion assay

The operation and conditions of this experiment were essentially the same as in step 4 of example 2, except that the matrigel was not coated.

The detection results are shown in figure 4, and the results show that the fusion polypeptide can antagonize the ability of RAB22A-NeoF1 to promote migration and invasion of osteosarcoma cells.

4. Animal experiments

A mouse model of RAB22A-NeoF1 positive osteosarcoma was constructed. Osteosarcoma cells (143B-Vec and 143B-RAB22A-NeoF1) were digested and collected by centrifugation, washed twice with PBS, and then resuspended in PBS to a final cell density of 8X 10⁵mu.L of cell suspension was injected into the proximal femur of the tibia and the distal femur of the tibia. The amino acid sequence of the fusion polypeptide is MALRELKVALGGCRGDKGPDC; the amino acid sequence of the control polypeptide is MALDELDVALGGCRGDKGPDC (amino acid D has been mutated at amino acid R at position 4 and amino acid K at position 7 of the fusion polypeptide sequence);

mice were divided into the following ten groups:

group A: negative control group 143B-Vec;

group B: positive control group 143B-RAB22A-NeoF 1;

group C: tail vein injection of fusion polypeptide (1 mg/kg);

group D: tail vein injection of control polypeptide (1 mg/kg);

group C: tail vein injection of fusion polypeptide (5 mg/kg);

group D: tail vein injection of control polypeptide (5 mg/kg);

group C: tail vein injection of fusion polypeptide (10 mg/kg);

group D: tail vein injection of control polypeptide (10 mg/kg);

group C: tail vein injection of fusion polypeptide (20 mg/kg);

group D: tail vein injection of control polypeptide (20 mg/kg);

the injection frequency is 1 time every other day, the injection lasts for 3 weeks, and the lung transfer fluorescence intensity of tumor-bearing mice is observed after 3 weeks.

The experimental result is shown in figure 5, and therefore, the fusion polypeptide can antagonize the capability of RAB22A-NeoF1 in promoting osteosarcoma cell transfer, and the fusion polypeptide can be further used for preparing osteosarcoma treatment medicines.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Zhongshan university tumor prevention and treatment center (Zhongshan university affiliated tumor hospital, Zhongshan university tumor research institute)

<120> a targeting polypeptide for treating osteosarcoma and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10

<212> PRT

<213> Human (Human)

<400> 1

Met Ala Leu Arg Glu Leu Lys Val Ala Leu

1 5 10

<210> 2

<211> 21

<212> PRT

<213> Human (Human)

<400> 2

Met Ala Leu Arg Glu Leu Lys Val Ala Leu Gly Gly Cys Arg Gly Asp

1 5 10 15

Lys Gly Pro Asp Cys

20

<210> 3

<211> 38

<212> DNA

<213> Human (Human)

<400> 3

cttaagcttg gtaccatggc agataatctc agtgatac 38

<210> 4

<211> 62

<212> DNA

<213> Human (Human)

<400> 4

ttaaacgggc cctctagatc aagcgtaatc tggaacatgt atgggtagct ttccacagta 60

ag 62

<210> 5

<211> 38

<212> DNA

<213> Human (Human)

<400> 5

cttaagcttg gtaccatggc gctgagggag ctcaaagt 38

<210> 6

<211> 39

<212> DNA

<213> Human (Human)

<400> 6

ttaaacgggc cctctagact agggctcccg ctggccctg 39

<210> 7

<211> 37

<212> DNA

<213> Human (Human)

<400> 7

cttaagcttg gtaccatgct cggggataca ggtgtag 37

<210> 8

<211> 39

<212> DNA

<213> Human (Human)

<400> 8

ttaaacgggc cctctagact agggctcccg ctggccctg 39

<210> 9

<211> 38

<212> DNA

<213> Human (Human)

<400> 9

cttaagcttg gtaccatgat tgtgtggcgg tttgtgga 38

<210> 10

<211> 39

<212> DNA

<213> Human (Human)

<400> 10

ttaaacgggc cctctagact agggctcccg ctggccctg 39

<210> 11

<211> 38

<212> DNA

<213> Human (Human)

<400> 11

cttaagcttg gtaccatgga tccaaacatc aacccaac 38

<210> 12

<211> 40

<212> DNA

<213> Human (Human)

<400> 12

rttaaacggg ccctctagac tagggctccc gctggccctg 40

<210> 13

<211> 38

<212> DNA

<213> Human (Human)

<400> 13

cttaagcttg gtaccatgac atatgtaggg agcacttg 38

<210> 14

<211> 39

<212> DNA

<213> Human (Human)

<400> 14

ttaaacgggc cctctagact agggctcccg ctggccctg 39

<210> 15

<211> 38

<212> DNA

<213> Human (Human)

<400> 15

cttaagcttg gtaccatggc gctgagggag ctcaaagt 38

<210> 16

<211> 41

<212> DNA

<213> Human (Human)

<400> 16

ttaaacgggc cctctagact atattgttgg gttgatgttt g 41

<210> 17

<211> 9

<212> PRT

<213> Human (Human)

<400> 17

Cys Arg Gly Asp Lys Gly Pro Asp Cys

1 5

<210> 18

<211> 21

<212> PRT

<213> Human (Human)

<400> 18

Met Ala Leu Asp Glu Leu Asp Val Ala Leu Gly Gly Cys Arg Gly Asp

1 5 10 15

Lys Gly Pro Asp Cys

20

Claims

1. A polypeptide of anti-RAB 22A-NeoF1 fusion protein is characterized in that the amino acid sequence of the polypeptide is shown in SEQ ID NO. 1.

2. An anti-RAB 22A-NeoF1 fusion protein RAB22A-NeoF1-iRGD fusion polypeptide, which is characterized in that the amino acid sequence of the fusion polypeptide is shown in SEQ ID NO. 2.

3. The fusion polypeptide of claim 2, wherein the iRGD polypeptide sequence in the RAB22A-NeoF1-iRGD fusion polypeptide is looped through its terminal amino acids.

4. Use of a polypeptide according to claim 1 or 2 for the manufacture of a medicament for the treatment of osteosarcoma.

5. The use of claim 4, wherein the osteosarcoma comprises RAB22A-NeoF1 fusion protein.

6. Use of the polypeptide of claim 1 or 2 for the preparation of a medicament for antagonizing RAB22A-NeoF1 fusion protein to promote osteosarcoma cell adhesion, migration and invasion.

7. Use of a polypeptide according to claim 1 or 2 for the manufacture of a medicament for antagonizing RAB22A-NeoF1 fusion protein in promoting lung metastasis of osteosarcoma cells.

8. A medicine for treating osteosarcoma, which is characterized by comprising polypeptide shown in SEQ ID NO.1 or SEQ ID NO. 2.