CN101805750B - Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector - Google Patents
Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector Download PDFInfo
- Publication number
- CN101805750B CN101805750B CN2009101566097A CN200910156609A CN101805750B CN 101805750 B CN101805750 B CN 101805750B CN 2009101566097 A CN2009101566097 A CN 2009101566097A CN 200910156609 A CN200910156609 A CN 200910156609A CN 101805750 B CN101805750 B CN 101805750B
- Authority
- CN
- China
- Prior art keywords
- fds
- interference
- rna
- recombinant
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides the construction for a farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector, which comprises the following steps of: sieving the most effective target sequence of an FDS (farnesyl diphosphate synthase) gene RNAi (RNA interference) in a tool cell 293T cell, synthesizing the double-stranded DNA of the most effective target sequence, connecting to a pGCSIL-GFP vector and successfully constructing the recombinant vector through enzyme cutting, sequencing and identification. Researches indicate that the constructed RNA interference vector LV-sh-FDS can downwards modulate the expression of an FDS mRNA (Messenger RNA) level in a neonatal rat cardiac myocyte, simultaneously can downwards modulate the expression of myocardial hypertrophy markers such as cell areas and marker genes beta-MHC (Myosin Heavy Chain) and BNP (Brain Natriuretic Peptide), additionally can effectively inhabit the activity of RhoA while downwards modulating the FDS, can be applied in preparing medicaments for treating myocardial hypertrophy diseases and also can be applied in preparing medicaments for cholesterol metabolic control.
Description
Technical field
The invention belongs to molecular biology, biological medicine and gene engineering technology field, relate generally at farnesyl pyrophosphoric acid synthetase (Farnesylpyrophosphate synthase, FDS) structure and the application in myocardial hypertrophy and cholesterol metabolic regulation thereof of the RNA interference recombinant lentivirus vector (LV-sh-FDS) of gene.
Background technology
Studies show that at present small G-protein participates in the generation of myocardial hypertrophy.RhoA belongs to the superfamily member of small G-protein, and the nonactive attitude of GDP bonded and two kinds of forms of GTP bonded activated state are arranged.Studies show that much at present that RhoA participates in the generation such as Angiotensin II (Ang II) the inductive myocardial hypertrophy of myocardial hypertrophy.Discovered that expression Rho-GDI (Rho-GDP separates and suppresses body) and Rho inhibitor C 3exeoezyme can obviously suppress Ang II inductive myocardial hypertrophy.
(Farnesylpyrophosphate synthase FDS) is key enzyme in the mevalonate pathway to farnesyl pyrophosphoric acid synthetase, and mevalonate pathway is a mammalian body inner cholesterol synthetic unique channel.FDS also is the key enzyme in the isoprene approach simultaneously, and the isoprenoid intermediate product that decomposes generation activates and then bring into play function for RhoA provide important substrate.The experiment in our early stage shows that at the neonatal rat myocardial cell of cultivating with 1 μ M Ang II inductive myocardial hypertrophy model and spontaneous hypertensive rat (SHRs) hypertrophic cardiomyopathy (the Ang II that contains high density in this model cardiac muscle), FDS inhibitor Allan sodium phosphate can suppress myocardial hypertrophy by obvious inhibition RhoA activity.These have shown that fully FDS regulates the active and possible vital role in myocardial hypertrophy of RhoA in cardiac muscle.Our research also shows in the neonatal rat myocardial cell of cultivating and hatches 12-48h with 1 μ M Ang II in addition, and the FDS gene obtains rise, and is especially obvious at 24h.In 18 all spontaneous hypertensive rats (SHRs) hypertrophic cardiomyopathies, also found simultaneously the rise of FDS gene.These early-stage Study have shown FDS possible vital role in myocardial hypertrophy.
FDS also shows suitable importance in the research of other field.Biological study shows that the parasite speed of growth descends until last death by suppressing the expression of FDS.Also there are some researches show in addition and find the FDS high expression level in the rat prostate cancer cells.Other studies show that the expression of downward modulation FDS can come the targeted therapy tumour cell by the cell-mediated immunosurveillance of V γ 9V δ 2T.
All these evidences show that suppressing the FDS expression of gene may stop the plump reaction of the relevant myocardial cell of Ang II/tissue.
(RNA interference, RNAi) technology is the conventional means of inhibition of gene expression, is gene silencing again in the RNA interference.RNA interferential principle is when importing with endogenous mRNA coding region homologous double-stranded RNA in the cell, and this mRNA degraded takes place and causes the phenomenon of genetic expression silence.
The RNA interfering process mainly contains two steps: one, double-stranded RNA is cut into the short dsrna of 21-23 base pair by the specific nuclease of cell source double-stranded RNA, be siRNA (smallinterference RNA, siRNA) two, antisense strand and the nuclease of siRNA have formed reticent mixture (RNA-induced silencing complex, RISC), this complex body has identification in conjunction with siRNA the mRNA of homologous sequence being arranged, and at specific site this mRNA is cut off.The RNA perturbation technique has obtained using widely at present in gene therapy and research, and those proof effective siRNA/shRNA in the target experiment itself can be developed further into the medicine into RNAi simultaneously.ShRNA is that short hairpin RNA (short hairpin RNA) comprises two short inverted repeats (one of them and goal gene complementation), and middle loop sequence is separated and formed hairpin structure.ShRNA is processed to the siRNA goal gene of effectively degrading and suppresses its expression in vivo.But this technology to be applied to clinical treatment, need to solve the RNA interference fragment and express major issues such as continuing to reach expression efficiency.
Vectors in Gene Therapy mainly contains non-virus carrier and virus vector at present, yet non-virus carrier can't satisfy long expression, and this defective is filled up by virus vector undoubtedly.The RNA perturbation technique of slow virus mediation has in recent years been obtained good start under study for action.Lentiviral vectors is retroviral a kind of, has retroviral basic structure, but different retroviral component characteristics are arranged, and this virus not only can the transfection somatoblast but also can the transfection Unseparated Cell.Viral genome can be integrated among the host, makes the expression that the gene length time is stable, and slow virus has lower immunogenicity, and this makes slow virus become RNA interferential optimum carrier, is widely used in fields such as gene expression regulation, gene therapy at present.What we selected for use is that third generation replication defect type lentiviral vectors is a suicide venereal disease poison (SIN), in vivo can longer expression and safe.Therefore RNA interference effect long-term existence in target cell of lentiviral vectors mediation can be better performance interference effect and creates conditions.
Summary of the invention
An object of the present invention is to provide a kind of interference carrier, i.e. farnesyl pyrophosphoric acid synthetase (Farnesylpyrophosphate synthase, FDS) gene RNA interference recombinant lentivirus vector (LV-sh-FDS).Described carrier contains slow virus skeleton plasmid recombinant vectors pGCSIL-sh-FDS, described recombinant vectors is the double chain DNA fragment that has connected in the MCS of p-GCSIL-GFP skeleton plasmid carrier at shRNA, at target sequence be: 1#-GACAGCTTTCTACTCTTTC, synthetic dna fragmentation information is:
1#-1：5’-CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTg-3’，
1#-2：5’-aattcaaaaaaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAGTAGAAAGCTGTCtt-3’。
This carrier is transfectional cell or tissue back specificity reduction FDS expression of gene effectively, thereby is applied to gene therapy or gene functional research.LV-sh-FDS most important characteristics provided by the invention is to provide target FDS retarding effect, and with recombined lentivirus vector as carrier, make interference effect obtain the persistence effect.Whole process of preparation is all used plasmid, avoids the traditional method adenovirus to pollute.Among the present invention at target gene FDS be key enzyme in the mevalonate pathway, also be the key enzyme in the isoprene approach, the isoprenylation intermediate product of generation provides important substrate for small G-protein family comprises RhoA activation and function assessment.Mevalonate pathway is a mammalian body inner cholesterol synthetic unique channel.By expression that suppresses FDS and then the activity that reduces RhoA, thereby effectively suppress the relevant myocardial hypertrophy of Ang II.Express by reducing FDS in addition, also reduced the generation of cholesterol in the mevalonate pathway.The present invention is by the most effective FDS interference sequence of screening, and synthetic its double-stranded DNA is connected in the slow virus skeleton plasmid carrier, prepares FDS interference recombinant lentivirus vector: LV-sh-FDS with helper plasmid cotransfection instrument cell (293T cell).
Another object of the present invention provides the preparation method of described carrier, realizes by following steps:
(1) disturbs synthesizing, screen and identifying of ordered sequence at the FDS gene;
(2) the FDS gene disturbs structure and the evaluation of slow virus skeleton plasmid recombinant vectors pGCSIL-sh-FDS;
(3) packing, collection, purifying, evaluation and the titer determination of FDS gene interference recombinant lentivirus vector LV-sh-FDS.
The screening of the effective interference sequence of FDS gene in the step (1), the main branch following several steps: (a), (imaGenes Germany), cuts order-checking by enzyme and successfully clones GFP-FDS-FLAG fusion rotein plasmid to buy FDS cDNA; (b) according to RNA interference sequence principle of design, design four four RNA and disturb (RNAi) target spot at FDS, target sequence (Target Seq) is respectively 1#:5 '-GACAGCTTTCTACTCTTTC-3; 2#:5 '-CACGCTAATGCCCTGAAGA-3 '; 3#:5 '-CTGTAGGAGGCAAGTACAA-3; 4#:5 '-CTGGTGGAAC CAAG GAAAC-3 ' (FDS mRNA NM_031840 GenBank GI:13929205), and synthetic respectively its double-stranded DNA, sequence is respectively:
1#-1：5’-GATCCCaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTGGAT-3’
1#-2：5’-AGCTATCCAAAAAaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAGTAGAAAGCTGTCttGG-3’
2#-1：5’-GATCCC-aaCACGCTAATGCCCTGAAGATTCAAGAGATCTTCAGGGCATTAGCGTGttTTTTTGGAT-3’
2#-2：5’-AGCTATCCAAAAAaaCACGCTAATGCCCTGAAGATCTCTTGAATCTTCAGGGCATTAGCGTGttGG-3’
3#-1：5’-GATCCCaCTGTAGGAGGCAAGTACAATTCAAGAGATTGTACTTGCCTCCTACAGtTTTTTGGAT-3’
3#-2：5’-AGCTATCCAAAAAaCTGTAGGAGGCAAGTACAATCTCTTGAATTGTACTTGCCTCCTACAGtGG-3’
4#-1：5’-GATCCCaaCTGGTGGAACCAAGGAAACTTCAAGAGAGTTTCCTTGGTTCCACCAGttTTTTTGGAT-3’
4#-2:5 '-AGCTATCCAAAAAaaCTGGTGGAACCAAGGAAACTCTCTTGAAGTTTCCTTGGTTC CACCAGttGG-3 '; And synthetic negative control (NC), dna fragmentation information is as follows:
NC-1：5’-GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT-3’；
NC-2：5’-AGCTAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAGGG-3’。Plasmid pGC-U6/Neo/DsRed after being connected to enzyme then and cutting (plasmid vector contains RFP red fluorescence mark, is convenient to observe).PGC-U6/Neo/DsRed construction of recombinant vector framework
NO. 5’ STEMP Loop STEMP
1#-1?GATCCC aaGACAGCTTTCTACTCTTTC TTCAAGAGA GAAAGAGTAGAAAGCTGTCtt TTTTTGGAT
1#-2?AGCTATCCAAAAA?aaGACAGCTTTCTACTCTTTC TCTCTTGAA GAAAGAGTAGAAAGCTGTCtt GG
2#-1?GATCCC aaCACGCTAATGCCCTGAAGA TTCAAGAGA TCTTCAGGGCATTAGCGTGtt TTTTTGGAT
2#-2?AGCTATCCAAAAA?aaCACGCTAATGCCCTGAAGA TCTCTTGAA TCTTCAGGGCATTAGCGTGtt GG
3#-1?GATCCC aCTGTAGGAGGCAAGTACAA TTCAAGAGA TTGTACTTGCCTCCTACAGt TTTTTGGAT
3#-2?AGCTATCCAAAAA?aCTGTAGGAGGCAAGTACAA TCTCTTGAA TTGTACTTGCCTCCTACAGt GG
4#-1?GATCCC aaCTGGTGGAACCAAGGAAAC TTCAAGAGA GTTTCCTTGGTTCCACCAGtt TTTTTGGAT
3#-2?AGCTATCCAAAAA?aaCTGGTGGAACCAAGGAAAC TCTCTTGAA GTTTCCTTGGTTCCACCAGtt GG
NC-1?GATCCCC TTCTCCGAACGTGTCACGT TTCAAGAGA ACGTGACACGTTCGGAGAA TTTTTT
NC-2?AGCTAAAAAA TTCTCCGAACGTGTCACGT TCTCTTGAA ACGTGACACGTTCGGAGAA GGG
(c) with the FDS fusion rotein that builds and the RNAi vector plasmid or the negative control plasmid (NS of four different target spots; the unordered sequence of encoding; noiseless effect); the common good instrument cell 293T cell of transfection growth conditions; adopt the method for immunofluorescence and immunoblotting to observe the GFP/RFP expression and detect the proteic expression of FLAG after 36 to 48 hours respectively, judge the interference effect of different target spots.
In the step (2), lentiviral vectors constructing system (the Ji Kai that the present invention adopts, Shanghai) by skeleton plasmid pGCSIL-GFP, carry viral gag, pol, and the helper plasmid pHelper 1.0 of rev gene and the helper plasmid pHelper 2.0 that contains VSV-G form.The structure of FDS interference plasmid pGCSIL-sh-FDS and authentication step obtain ordered sequence in preceding (1) external source sieve target result be the double-stranded DNA that 1# designs and synthesizes its shRNA.1:5 '-CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttT TTTTg-3 '; 2:5 '-aattcaaaaaaaGACAGCTT TCTAC TCTTTCTCTCTTGAAGAAAGAGTAGAAAGCTGTCtt-3 ' is connected with pGCSIL-GFP slow virus skeleton plasmid carrier.(Shanghai Mei Ji company) identified in PCR and order-checking behind the connection after product conversion DH5 intestinal bacteria.PCR identifies that the primer of positive colony is Primer:Up:5 '-CCTATTTCCCATGATTCCTTCATA-3 '; Down:5 '-GTAATACGGTTATCCACGCG-3.Slow virus skeleton plasmid construction of recombinant vector framework:
| NO. | 5’ | STEMP | Loop | STEMP | 3’ |
| 1 | Ccgg | aaGACAGCTTTCTACTCTTTC | TTCAAGAGA | GAAAGAGTAGAAAGCTGTCtt | TTTTTg |
| 2 | aattcaaaaa | aaGACAGCTTTCTACTCTTTC | TCTCTTGAA | GAAAGAGTAGAAAGCTGTCtt |
Connect product P CR and identify cycling condition:
Packing, collection, purifying, evaluation and the titer determination of step (3) FDS interference recombinant lentivirus vector LV-sh-FDS.High purity does not have three kinds of plasmid pGCSIL-GFP of intracellular toxin extracting, pHelper 1.0 and pHelper 2.0, prepare three kinds of dna solutions and draw pGCSIL-sh-FDS (20 μ g), pHelper 1.0 (15 μ g) and pHelper 2.0 (10 μ g) carry out cotransfection 293T cell by Invitrogen company Lipofectamine 2000 operation instructions, set up the positive control of recombinant virus simultaneously.8h is replaced by perfect medium after the transfection, in 37 ℃, 5%CO
2After continuing in the incubator to cultivate 48h, collect and be rich in slow virus particulate cell conditioned medium liquid.
A further object of the present invention provides the application of this genomic medicine LV-sh-FDS in myocardial hypertrophy.In Ang II (1 μ M) inductive myocardial cell hypertrophy model, LV-sh-FDS is applied in effective inhibition FDS when expressing, effectively reversed the myocardial cell myocardial hypertrophy due to the Angiotensin II has been reacted (comprising that specifically cell area reduces, the minimizing of plump marker gene such as β-MHC, BNP etc.).In spontaneous hypertensive rat, pass through myocardial injection LV-sh-FDS, the expression that when reducing the FDS of cardiac muscular tissue expression level, has also alleviated plump marker gene such as β-MHC, BNP, and part reverses cardiac index and comprises whole-heartedly/body weight (HW/BW), left chamber weight/body weight (LVW/BW), improved heart IVSD beyond target in various degree, EF, FS%.
LV-sh-FDS is except being applied to gene therapy, can also be used for the relevant research of small G-protein, for example: detect by western and Rho active agent box, LV-sh-FDS preincubate myocardial cell can effectively suppress the active increase of Ang II (1 μ M) inductive RhoA, total proteic expression amount of RhoA does not change, and then disclosed in Ang II (1 μ M) inductive myocardial hypertrophy the relation between FDS and the RhoA.
LV-sh-FDS also can be used for studying the function of the key enzyme FDS of mevalonate pathway, for example by the total cholesterol level (TC) in the commercial kit discovery spontaneous hypertensive rat serum, low-density lipoprotein (LDL-C) obtains descending, and FDS has also obtained inhibition in the liver organization simultaneously.
Carrier of the present invention is transfectional cell or tissue back specificity reduction FDS expression of gene effectively, thereby is applied to gene therapy or gene functional research.LV-sh-FDS most important characteristics provided by the invention is to provide target FDS retarding effect, and with recombined lentivirus vector as carrier, make interference effect obtain the persistence effect.Whole process of preparation is all used plasmid, avoids the traditional method adenovirus to pollute.Among the present invention at target gene FDS be key enzyme in the mevalonate pathway, also be the key enzyme in the isoprene approach, the isoprenylation intermediate product of generation provides important substrate for small G-protein family comprises RhoA activation and function assessment.Mevalonate pathway is a mammalian body inner cholesterol synthetic unique channel.By expression that suppresses FDS and then the activity that reduces RhoA, thereby effectively suppress the relevant myocardial hypertrophy of Ang II.Express by reducing FDS in addition, also reduced the generation of cholesterol in the mevalonate pathway.
While LV-sh-FDS of the present invention has fluorescent mark EGFP and is convenient to detect transfection efficiency.Experiment shows that LV-sh-FDS is transfection myocardial cell and cardiac muscular tissue effectively, and the cell levels transfection experiment shows that MOI is at 20 o'clock, and myocardial cell's transfection efficiency can reach more than 80%.Simultaneously but route of administration can adopt also multiple mode such as intravenously administrable coronary artery administration of direct myocardial injection.
Effect experiment of the present invention shows that LV-sh-FDS can effectively suppress FDS expression of gene in myocardial cell and the cardiac muscular tissue.
Usefulness of the present invention is:
1 the present invention is directed to the FDS target gene designs four effective interference sequences according to online principle, for overcoming the low and target gene commercial-free antibody of primary cell transfection efficiency, construct four FDS interference plasmids and FDS fusion gene plasmid by cotransfection 293T cell, go out the most effective interference fragment by the certification mark protein screening, and in target cell, be verified, for further establishing good experiment basis about the FDS gene studies.
2. constructing the slow virus interference carrier constructing system that further passes through reorganization on the most effective FDS interference plasmid basis among the present invention; make up packing and obtain LV-sh-FDS; not only overcome the low transfection efficiency of non-virus carrier; the immunogenicity of also having avoided recombinant adenovirus to produce; shortcomings such as expression time is short; the lentiviral vectors of this reorganization is that " suicide " virus can be incorporated in host's the genome relatively safely; make interference effect more lasting, can be widely used in vivo gene treatment and gene functional research.
3. the LV-sh-FDS among the present invention itself has EGFP and is marked at that to express the detection that " enhancing fluorescin " be convenient to after the transfection after the transfection efficient and convenient.
4. the LV-sh-FDS that makes up of the present invention can effectively transfection cardiac muscle cells, and the mRNA level of FDS is obviously suppressed (78.56%), and the myocardial cell has obtained obvious suppression to plump reaction of Ang II (1 μ M) inductive.After 11 weeks of spontaneous hypertensive rat myocardial injection LV-sh-FDS, when the mRNA level of FDS is inhibited (37.25%), plump gene β-MHC, BNP are obviously suppressed, cardiac index (HW/BW, LVW/BW) part reverses, (IVSD, EF FS%) obtain part and improve the heart beyond target simultaneously.Indicate that this carrier provides important experimental resources for the research of myocardial hypertrophy.
5. the effective transfection of LV-sh-FDS myocardial injection of the present invention cardiac muscular tissue, when plump reaction improves, serum TC LDL-C also has in various degree and alleviates, liver organization FDS level also can effectively suppress, indication LV-sh-FDS may influence the expression of liver F DS by blood circulation, and then the regulation and control cholesterol metabolic, indicate that this carrier can implement by multiple modes such as myocardial injection intravenous injection coronary artery injections.
6. the effective transfection myocardial cell of the present invention is 20 o'clock at MOI, and transfection efficiency can reach more than 80%, and myocardial injection LV-sh-FDS is efficiently expressed in the viviperception, is applicable to the in vivo application in field such as gene functional research and gene therapy of cell.
Description of drawings
Fig. 1 is a pGC-U6/Neo/DsRed carrier structure synoptic diagram.
Fig. 2 is a pEGFP-C1 carrier structure synoptic diagram.
Fig. 3 is a slow virus skeleton plasmid pGCSIL-GFP carrier structure synoptic diagram.
Fig. 4 is the effective target spot interference effect of external source sieve target picture.
Fig. 5 identifies figure for the pGCSIL-sh-FDS agarose gel electrophoresis.
Fig. 6 identifies figure for the pGCSIL-sh-FDS order-checking.
Fig. 7 is the transfection efficiency picture of LV-sh-FDS in myocardial cell and cardiac muscular tissue.
Fig. 8 effectively reduces FDS mRNA picture in myocardial cell/tissue for LV-sh-FDS.
Fig. 9 effectively improves the plump reaction of the relevant myocardial cell of Angiotensin II picture for LV-sh-FDS.
Figure 10 improves spontaneous hypertensive rat myocardial hypertrophy reaction picture for LV-sh-FDS.
Figure 11 influences spontaneous hypertensive rat cardiac ultrasonic picture for LV-sh-FDS.
Figure 12 influences the picture that RhoA is active and express for LV-sh-FDS.
Figure 13 influences spontaneous hypertensive rat liver F DS mRNA picture for LV-sh-FDS.
Embodiment
The present invention is further described in conjunction with the accompanying drawings and embodiments.
Embodiment 1:FDS fusion gene plasmid and interference plasmid cotransfection instrument cell screening FDS disturb the most effective target sequence siRNA:
One, according to principle of design, according to online RNAi Series Design software, design 4 disturbance target points, and to identify that correct clone carries out plasmid extraction standby in synthetic its double-stranded DNA pGC-U6/Neo/DsRed carrier (available from Shanghai JiKai Gene Chemical Technology Co., Ltd, referring to Fig. 1) back of being connected to BamHI and HindIII linearization for enzyme restriction.
(Target Seq) is as follows for target sequence:
1#：GACAGCTTTCTACTCTTTC
2#：CACGCTAATGCCCTGAAGA
3#：CTGTAGGAGGCAAGTACAA
4#：CTGGTGGAACCAAGGAAAC
DNA answer print segment information separately is as follows simultaneously:
1#-1：5’-GATCCCaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTGGAT-3’
1#-2：5’-AGCTATCCAAAAAaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAGTAGAAAGCTGTCttGG-3’
2#-1：5’-GATCCC-aaCACGCTAATGCCCTGAAGATTCAAGAGATCTTCAGGGCATTAGCGTGttTTTTTGGAT-3’
2#-2：5’-AGCTATCCAAAAAaaCACGCTAATGCCCTGAAGATCTCTTGAATCTTCAGGGCATTAGCGTGttGG-3’
3#-1：5’-GATCCCaCTGTAGGAGGCAAGTACAATTCAAGAGATTGTACTTGCCTCCTACAGtTTTTTGGAT-3’
3#-2：5’-AGCTATCCAAAAAaCTGTAGGAGGCAAGTACAATCTCTTGAATTGTACTTGCCTCCTACAGtGG-3’
4#-1：5’-GATCCCaaCTGGTGGAACCAAGGAAACTTCAAGAGAGTTTCCTTGGTTCCACCAGttTTTTTGGAT-3’
4#-2:5 '-AGCTATCCAAAAAaaCTGGTGGAACCAAGGAAACTCTCTTGAAGTTTCCTTGGTTC CACCAGttGG-3 ', and synthetic negative control (NC), dna fragmentation information is as follows:
NC-1：5’-GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT-3’；
NC-2：5’-AGCTAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAGGG-3’。
Two, the preparation of FDS fusion rotein plasmid carrier
Buy FDS cDNA library (imaGenes, Germany), utilize PCR method to angle and get its goal gene and expression vector pEGFP-C1 Vector (clonetech, #632465, referring to Fig. 2) carry out respectively directedly behind the double digestion connecting and adding the FLAG labelled protein at the C of expression vector end, product transformed competence colibacillus cell carries out the fusion protein expression plasmid carrier pEGFP-FDS-FLAG that PCR identifies that the sequencing analysis comparison correctly successfully constructs, and carries out ultrapurely going the intracellular toxin extracting standby.
Three, the most effective target sequence of external source cotransfection 293T cell screening FDS RNAi
The instrument cell (being the 293T cell) that incubation growth is in good condition, with the FDS that builds cross expression fusion gene plasmid (1 μ g) with at the RNAi vector plasmid (1 μ g) of different target spots and negative with reference to plasmid (1 μ g), press the lipofectamine 2000 operation instruction cotransfection 293T cells of Invitrogen company, under fluorescent microscope, observe the expression of GFP/RFP behind the 36h, the preliminary interference effect of judging different target spots, transfection efficiency just can enter subsequent detection greater than the experimental group more than 70% simultaneously, adopt the method for Western blot to detect the proteic expression of FLAG simultaneously behind the 48h, and then confirm that further the most effective target spot is No. 1 (referring to Fig. 4).A among Fig. 4: immunofluorescence is observed the variation that 293 cells are crossed expression plasmid and interference plasmid cotransfection GFP/RFP, wherein a: green fluorescence (GFP), b: red fluorescence (RFP), c: zero diopter microscope; B:Western-blot detects 293 cells and crosses that FLAG albumen changes behind expression plasmid and the interference plasmid albumen cotransfection, wherein OV: cross the expression plasmid transfection group, NC: negative virus transfection group, α-Tubilin: internal reference.
Embodiment 2: structure and the evaluation of slow virus recombinant plasmid pGCSIL-sh-FDS
The most effective target sequence that external source sieve target obtains is No. 1: GACAGCTTTCTACTCTTTC, and the double-stranded DNA of synthetic its shRNA, the answer print segment information is as follows:
1：CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAAGCTGTCttTTTTTg；
2：aattcaaaaaaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAGTAGAAAGCTGTCtt。
Be connected to linear pGCSIL-GFP carrier behind AgeI and EcoRI double digestion (available from Shanghai JiKai Gene Chemical Technology Co., Ltd, referring to Fig. 3), ligation system: the carrier DNA that enzyme cuts back to close (100ng/ μ l) 1 μ l, annealed double-stranded DNA (100ng/ μ l) 1 μ l, 10 * T4 phage DNA ligase enzyme damping fluid, 1 μ l, T4 phage DNA ligase enzyme 1 μ l, dd H2O 7 μ l, behind 4 ℃ of connection 12h, 37 ℃ of cultivation 16h are transformed into the DH5 intestinal bacteria then, and performing PCR and order-checking are identified behind the extraction positive colony bacterium.PCR identifies that the primer of positive colony is Primer:Up:5 '-CCTATTTCCCATGATTCCTTCATA-3 '; Down:5 '-GTAATACGGTTATCCACGCG-3, the PCR product qualification result (Fig. 5) of bacterial clone and sequencing result (Fig. 6) have been proved conclusively the exactness of pGCSIL-sh-FDS direction of insertion and sequence.Carry out the positive colony plasmid extraction after the order-checking, the recombinant plasmid pGCSIL-sh-FDS of acquisition is used to prepare lentiviral vectors.
PCR cycling condition (table 2):
The preparation of embodiment 3:FDS gene RNA interference recombinant lentivirus vector (LV-sh-FDS)
This lentiviral vectors constructing system (purchasing in Shanghai JiKai Gene Chemical Technology Co., Ltd) is by skeleton plasmid carrier pGCSIL-GFP, carry viral gag, pol, and the helper plasmid pHelper1.0 of rev gene and the helper plasmid pHelper 2.0 that contains VSV-G form.
Preparation coding slow virus particulate recombinant virus plasmid and helper plasmid are pGCSIL-sh-FDS, and pHelper1.0 and pHelper 2.0 plasmids carry out high purity respectively and do not have the intracellular toxin extracting.Draw plasmid pGCSIL-sh-FDS, (20 μ g), pHelper 1.0, (15 μ g) and pHelper 2.0, (10 μ g), carry out cotransfection 293T cell by Invitrogen company Lipofectamine 2000 operation instructions and successfully pack FDS) the gene RNA interference recombinant lentivirus, (LV-sh-FDS), set up positive control simultaneously, be pGCSIL-NS, (negative reference), (20 μ g), pHelper 1.0, (15 μ g) and pHelper 2.0, (10 μ g) cotransfection 293T cell construction negative control recombined lentivirus vector
8h is replaced by perfect medium after the transfection, in 37 ℃, 5%CO
2After continuing in the incubator to cultivate 48h, collect and be rich in slow virus particulate cell conditioned medium liquid.4 ℃, the centrifugal 10min of 4000g removes behind the cell debris and obtains with 0.45 μ M filter filtering supernatant that slow virus is standby satisfies general test cell line.If will obtain the slow virus concentrated solution that the slow virus of higher concentration obtains high titre after can be to it further concentrated and purified, packing virus concentrated solution-80 degree prolonged preservation is got wherein one and is carried out the viral biology titer determination.
Embodiment 4:FDS gene RNA interference recombinant lentivirus vector (LV-sh-FDS) is used for the relevant myocardial hypertrophy model gene treatment research of Angiotensin II.
One, LV-sh-FDS is in the application of myocardial cell's plumpness of vitro culture
It is broken that the ventricle of getting the newborn WKYs mouse of 1-3 age in days is cut into 1mm2 left and right sides fritter, repeats to digest collecting cell behind the centrifugal 6min of 200 order steel meshes filtration 1000g, 5%CO simultaneously with 0.125% pancreatin and 0.05% collagenase II type mixture
2Behind 37 ℃ of cultivations of incubator 1h, remove attached cell, cell density is adjusted to 5 * 10E5-1 * 10E6/mL is inoculated in the cultivation of six orifice plate kinds.According to virus and cell ratio (MOI) is 20 adding LV-sh-FDS and negative virions (contrast), infect neonatal rat myocardial cell, change perfect medium behind the 24h, under fluorescent microscope, express judgement transfection efficiency (efficient is about more than 80%) after infecting 48h by observing GFP, referring to Fig. 7 A, infect to change behind the 72h to add behind the serum free medium 24h and finish experiment after Ang II (1 μ M) is hatched 24h.The result shows: LV-sh-FDS effectively suppresses the expression of FDS in the neonatal rat myocardial cell, and this restraining effect is more obvious when incubating altogether for Ang II (1 μ M), and negative virion is to the not influence of expression of FDS, referring to Fig. 8 A (i).Experimental result shows that LV-sh-FDS can effectively suppress the plumpness reaction of myocardial cell to Ang II (1 μ M), shows as the reverse of cell area and the downward modulation that plump gene BNP, β-MHC expresses simultaneously.Referring to Fig. 9; Incubate LV-sh-FDS in addition in advance and can obviously suppress the active increase of Ang II (1 μ M) (hatching 15min) inductive RhoA, the RhoA expressing quantity does not change, referring to Figure 12.
Fig. 7 A: the myocardial cell (10 *) after the transfection of immunofluorescence sem observation (MOI=20); B:Western-blot detects GFP protein expression in the cardiac muscular tissue, a:SHR rat injecting virus liquid group not wherein, and the negative virus transfection group of b:SHR rat, c:SHR rat viral interference knocks out group, d:WKY rat group.
Fig. 8 data are represented with mean ± standard error.Fig. 8 A cell levels: wherein 1: the untransfected group, 2: negative virus transfection group, 3: viral interference knocks out group, and 4: negative virus transfection myocardial hypertrophy model group (AngII is hatched), 5: viral interference transfection myocardial hypertrophy model (Ang II is hatched),
#P＜0.05and
##P＜0.01vs.2 group.
*P＜0.01 vs.4group; Fig. 8 B cardiac muscular tissue, the negative virus transfection group of b:SHR rat wherein, c:SHR rat viral interference knocks out group, d:WKY rat group,
*P＜0.05and
*P＜0.01 vs.b group.
The data of Fig. 9 are represented with mean ± standard error.A among Fig. 9: cell area, B: plump marker gene β-MHC, C: plump marker gene BNP; Wherein 1 of X-coordinate is negative infection group and viral infection group, the 2nd, and viral interference knocks out group;
##P＜0.01 vs.1 group (Ang II-) and
*P＜0.01 vs.1 group (Ang II+).
The data of Figure 12 are represented with mean ± standard error.Among the figure 1: negative virus transfection group, 2: negative virus transfection myocardial hypertrophy model group (Ang II is hatched), 3: viral interference transfection myocardial hypertrophy model group (Ang II is hatched).
#P＜0.05?vs.1?group?and?
*P＜0.05?vs.2group。
Two, LV-sh-FDS is used for the research of spontaneous hypertensive rat (SHRs) myocardial hypertrophy
7 age in week the SHR rat totally 12 only reach 7 age in week 6 of WKYs rats go into group, Chloral Hydrate (400mg/kg/mg) abdominal injection general anesthesia is got dorsal position, tracheotomy connects animal respirator, opens the thoracic cavity, expose heart, draw LV-sh-FDS or negative virion 80uL (about 5 * 10
7TU) get 3-4 point injection recombinant virus in the apex of the heart and left ventricular wall, wherein the injection of WKYs rat heart muscle with dosage physiological saline with normal control.Close the thoracic cavity, remove respirator.The clear-headed back of rat gives the cardiac ultrasonic inspection after a cleaning level environment normal diet raised for 11 weeks, dirty the weighing of coring after rat is weighed left and taken left ventricle and given the gene test that reverse transcription and real-time quantitative PCR detect FDS, BNP, β-MHC.The result shows: LV-sh-FDS can obviously reduce transcribe (Fig. 8 B) of FDS, and plump gene BNP, β-MHC reduces simultaneously, and cardiac index (HW/BW and LVW/BW) part alleviates, referring to Figure 10.The super result of the heart also has improvement in various degree in addition, referring to Figure 11.
Figure 10 data are represented with mean ± standard error.The A:HW/BW of Figure 10 (heart weight/body weight), B:LVW/BW (left chamber weight/body weight), C: plump marker gene β-MHC, D: plump marker gene BNP.The negative virus transfection group of b:SHR rat among each figure, c:SHR rat viral interference knocks out group, d:WKY rat group;
#P＜0.05 vs.d group.
*P＜0.05?and?
**P＜0.01?vs.b?group。
Figure 11 data are represented with mean ± standard error.The A:IVSD of Figure 11 (diastasis interventricular septum wall thickness), B:LVPWD (wall thickness behind the diastasis ventricle), C:FS (shortening fraction), D:EF (ejection fraction).The negative virus transfection group of b:SHR rat among each figure, c:SHR rat viral interference knocks out group, d:WKY rat negative control group.
#P＜0.05?and?
##P＜0.01?vs.d?group；
*P＜0.05?and?
**P＜0.01?vs.bgroup。
The research of embodiment 5:LV-sh-FDS in cholesterol metabolic regulation
7 age in week the SHR rat totally 12 only reach 7 age in week 6 of WKYs rats go into group, Chloral Hydrate (400mg/kg/mg) abdominal injection general anesthesia is got dorsal position, tracheotomy connects animal respirator, opens the thoracic cavity, expose heart, draw LV-sh-FDS or negative virion 80uL (about 5 * 10
7TU) get 3-4 point injection recombinant virus in the apex of the heart and left ventricular wall, wherein the injection of WKYs rat heart muscle with dosage physiological saline with normal control.Close the thoracic cavity, remove respirator.The rat whole blood is got in the clear-headed back of rat after cleaning level environment normal diet raised for 11 weeks, get serum packing postposition-80 degree behind the centrifugal 15min of 3000g and preserve.Get 500uL serum and detect rat blood serum cholesterol (TC), low-density lipoprotein (LDL-C).The result shows the effective transfection of LV-sh-FDS myocardial injection cardiac muscular tissue, when plump reaction improves, serum TC LDL-C has in various degree and alleviates, liver organization FDS mRNA level also is effectively suppressed simultaneously, referring to table 1 and Figure 13, indication LV-sh-FDS may influence the expression of liver F DS by blood circulation, and then influences cholesterol metabolic respectively, serum cholesterol concentration descends, and indicates that also this carrier may be able to implement by multiple modes such as myocardial injection intravenous injection coronary artery injections.
Table 1:LV-sh-FDS influences spontaneous hypertensive rat serum cholesterol data
Annotate: data are represented with mean ± standard error; The negative virus transfection group of b:SHR rat; C:SHR rat viral interference knocks out group; D:WKY rat negative control group.；
#P＜0.05?and?
##P＜0.01?vs.d?group?and?
*P＜0.05?vs.bgroup。
The negative virus transfection group of b:SHR rat among Figure 13, c:SHR rat viral interference knocks out group, d:WKY rat negative control group.
#P＜0.01?vs.d?group?and
*P＜0.05?vs.b?group。
The sequence that the present invention relates to
＜110〉Zhejiang University
＜120〉farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) disturbs lentiviral vectors to make up and purposes
<160>14
<210>1
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>9-27
＜223〉positive-sense strand of artificial design
<400>1
gatcccaaga?cagctttcta?ctctttcttc?aagagagaaa?gagtagaaag?ctgtcttttt?ttgga?t 66
<210>2
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>16-34
＜223〉antisense strand of artificial design
<400>2
Agctatccaa?aaaaagacag?ctttctactc?tttctctctt?gaagaaagag?tagaaagctg?tcttg?g 66
<210>3
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>9-27
＜223〉positive-sense strand of artificial design
<400>3
Gatcccaaca?cgctaatgcc?ctgaagattc?aagagatctt?cagggcatta?gcgtgttttt?ttggat 66
<210>4
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>16-34
＜223〉antisense strand of artificial design
<400>4
Agatatccaa?aaaaacacgc?taatgccctg?aagatctctt?gaatcttcag?ggcattagcg?tgttgg 66
<210>5
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>8-26
＜223〉positive-sense strand of artificial design
<400>5
Gatcccactg?taggaggcaa?gtacaattca?agagattgta?cttgcctcct?acagtttttt?ggat 64
<210>6
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>15-33
＜223〉antisense strand of artificial design
<400>6
Agctatccaa?aaaactgtag?gaggcaagtacaatctcttg?aattgtactt?gcctcctaca?gtgg 64
<210>7
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>9-27
＜223〉positive-sense strand of artificial design
<400>7
Gatcccaact?ggtggaacca?aggaaacttc?aagagagttt?ccttggttcc?accagttttt?ttggat 66
<210>8
<211>66
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>16-34
＜223〉antisense strand of artificial design
<400>8
Agctatccaa?aaaaactggt?ggaaccaagg?aaactctctt?gaagtttcct?tggttccacc?agttgg 66
<210>9
<211>60
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>8-26
＜223〉positive-sense strand of artificial design
<400>9
Gatccccttc?tccgaacgtg?tcacgtttca?agagaacgtg?acacgttcgg?agaatttttt 60
<210>10
<211>60
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>8-26
＜223〉antisense strand of artificial design
<400>10
Agctaaaaaa?ttctccgaac?gtgtcacgtt?ctcttgaaac?gtgacacgtt?cggagaaggg 60
<210>11
<211>61
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>7-25
＜223〉positive-sense strand of artificial design
<400>11
Ccggaagaca?gctttctact?ctttcttcaa?gagagaaaga?gtagaaagct?gtcttttttt?g 61
<210>12
<211>61
<212>DNA
＜213〉artificial sequence
<220>
<221>Target?seq
<222>13-31
＜223〉antisense strand of artificial design
<400>12
Aattcaaaaa?aagacagctt?tctactcttt?ctctcttgaa?gaaagagtag?aaagctgtct?t 61
<210>13
<211>24
<212>DNA
＜213〉artificial sequence
＜220〉be used for the upstream primer that PCR reacts
<400>13
Cctatttccc?atgattcctt?cata 24
<210>14
<211>20
<212>DNA
＜213〉artificial sequence
＜220〉be used for the downstream primer that PCR reacts
<400>14
Gtaatacggt?tatccacgcg 20
Claims (6)
1. one kind for farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector; It is characterized in that; Described carrier contains slow virus skeleton plasmid recombinant vector pGCSIL-sh-FDS; Described recombinant vector is the double chain DNA fragment that has connected in the MCS of p-GCSIL-GFP skeleton plasmid carrier for shRNA; For target sequence be: 1#-GACAGCTTTCTACTCTTTC; Synthetic dna fragmentation information is: 1#-1:5 '-CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGTAGAAA GCTGTCt tT TTTTg-3 '
1#-2：5’-aattcaaaaaaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAG?T?AGAAAGCTGTCtt-3’。
2. one kind at the farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector preparation method, it is characterized in that, according to FDS mRNA sequence, design has been synthesized at the double chain DNA fragment of shRNA as follows:
Positive-sense strand: 5 '-CcggaaGACAGCTTTCTACTCTTTCTTCAAGAGAGAAAGAGT AGAAA GCTGTCt tT TTTTg-3 '
Antisense strand: 5 '-aattcaaaaaaaGACAGCTTTCTACTCTTTCTCTCTTGAAGAAAGAG T A G AAA GCTGTCtt-3 '
Above-mentioned dna fragmentation is connected among the slow virus skeleton plasmid carrier pGCSIL-GFP then and builds up the pGCSIL-sh-FDS recombinant vectors among the MCS, with pGCSIL-sh-FDS recombinant vectors, pHelper 1.0, pHelper 2.0 cotransfection 293T cells, obtain described recombined lentivirus vector LV-sh-FDS again.
3. according to claim 2ly it is characterized in that, at terminal Age I and the EcoRI restriction enzyme site introduced of synthetic dna fragmentation at the farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector preparation method.
4. according to claim 2 at the farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector preparation method, it is characterized in that, with Age I and EcoRI enzyme the pGCSIL-GFP enzyme is cut digestion, after reclaiming big fragment it is connected back transformed competence colibacillus bacterium with dna fragmentation, obtains recombinant clone.
5. according to claim 1 at the application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector in preparation treatment myocardial hypertrophy medicine.
6. according to claim 1 at the application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector in preparation cholesterol metabolic regulation medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101566097A CN101805750B (en) | 2009-12-29 | 2009-12-29 | Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101566097A CN101805750B (en) | 2009-12-29 | 2009-12-29 | Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101805750A CN101805750A (en) | 2010-08-18 |
| CN101805750B true CN101805750B (en) | 2011-11-30 |
Family
ID=42607703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009101566097A Expired - Fee Related CN101805750B (en) | 2009-12-29 | 2009-12-29 | Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101805750B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017156311A3 (en) * | 2016-03-09 | 2017-10-19 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010045659A1 (en) | 2008-10-17 | 2010-04-22 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
| WO2017007994A1 (en) | 2015-07-08 | 2017-01-12 | American Gene Technologies International Inc. | Hiv pre-immunization and immunotherapy |
| US10137144B2 (en) | 2016-01-15 | 2018-11-27 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| IL310925A (en) | 2016-01-15 | 2024-04-01 | American Gene Tech Int Inc | Methods and compositons for the activation of gamma-delta t-cells |
| US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
| EP3468617A4 (en) | 2016-06-08 | 2020-01-22 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
| EP3481418A4 (en) | 2016-07-08 | 2020-03-11 | American Gene Technologies International Inc. | Hiv pre-immunization and immunotherapy |
| US11583562B2 (en) | 2016-07-21 | 2023-02-21 | American Gene Technologies International Inc. | Viral vectors for treating Parkinson's disease |
| US11820999B2 (en) | 2017-04-03 | 2023-11-21 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
| US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
| CN112980809B (en) * | 2021-03-17 | 2023-04-11 | 云南中烟工业有限责任公司 | Tobacco farnesyl pyrophosphate synthase gene and application thereof |
-
2009
- 2009-12-29 CN CN2009101566097A patent/CN101805750B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| Angela Reynolds et al.Rational siRNA design for RNA interference.《NATURE BIOTECHNOLOGY》.2004,第22卷(第3期), * |
| Patrick J. Paddison et al.A resource for large-scale RNA-interference-based screens in mammals.《Nature》.2004,第428卷 * |
| 王延洲等.Smad3基因RNAi慢病毒载体的构建与鉴定.《第三军医大学学报》.2009,第31卷(第8期), * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017156311A3 (en) * | 2016-03-09 | 2017-10-19 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101805750A (en) | 2010-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101805750B (en) | Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector | |
| CN107949424A (en) | The gene editing based on CRISPR/ endonucleases of TAT inductions | |
| JP2022506515A (en) | Vector system for expressing regulatory RNA | |
| CN105209617B (en) | Microcapsule bubble and its manufacturing method | |
| CN103114087B (en) | RNA(Ribonucleic Acid)and application thereof in diseases of cardiovascular system | |
| CN105396143A (en) | MiRNA of specificity of Ebola virus and method for inhibiting Ebola virus through miRNA | |
| CN102115787A (en) | MicroRNA (Ribose Nucleic Acid) and application of antisensenucleic acid of microRNA to diagnosis, prevention, treatment and/or prognostic evaluation of heart disease | |
| Alaee et al. | Biodistribution of LV-TSTA transduced rat bone marrow cells used for “ex-vivo” regional gene therapy for bone repair | |
| CN107988150A (en) | A kind of identification method and system of Myocytes Anoxia-reoxygenation | |
| Zhang et al. | An ALV-J isolate is responsible for spontaneous haemangiomas in layer chickens in China | |
| CN104694576B (en) | A kind of method of IFNAR1 genes in 1 cell lines of silence DF | |
| CN1418224A (en) | TCF responsive element | |
| CN112190712A (en) | Application of combination of hydrosulfuryl oxidase 1 agonist and sorafenib in preparation of drugs for treating liver cancer cells | |
| Henriques-Coelho et al. | Targeted gene transfer to fetal rat lung interstitium by ultrasound-guided intrapulmonary injection | |
| CN113528528B (en) | shRNA for promoting apoptosis of imatinib-resistant chronic myelocytic leukemia cell K562/G01 and application thereof | |
| CN112375759B (en) | miRNA related to chicken liver lipid deposition and application thereof | |
| CN105602989B (en) | A kind of recombinant vector and its application in preparation or screening Tamiflu | |
| CN105296600A (en) | Application of Med23 genes and medicine related to Med23 genes | |
| EP4140503A1 (en) | Use of ephb4 as target in screening of drugs or models for increasing insulin sensitivity | |
| CN109266684B (en) | Method for constructing animal model with pathogen infection sensitivity | |
| CN107385033A (en) | The application of piRNA 5938 and its antisensenucleic acids in diagnosis, prevention, treatment, prognosis evaluation ischemic heart disease | |
| CN103952410B (en) | The shRNA of a kind of effective suppression rat FoxO3a genetic expression and application thereof | |
| CN102443604B (en) | Safe lentivirus vector and application thereof | |
| CN108265036B (en) | T1 protein silencing recombinant virus and construction method and application thereof | |
| CN102399777B (en) | Recombinant plasmid and recombinant oncolytic virus prepared by using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111130 Termination date: 20171229 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |