CN118286434A

CN118286434A - Use of YTHDF inhibitor in preparation of medicine for preventing and treating pathological myocardial hypertrophy and ventricular remodeling

Info

Publication number: CN118286434A
Application number: CN202410425058.4A
Authority: CN
Inventors: 肖俊杰; 王丽君; 张爽; 王睿; 王佳琪; 崔欣欣; 万雯思; 崔彩月
Original assignee: University of Shanghai for Science and Technology
Current assignee: University of Shanghai for Science and Technology
Priority date: 2024-04-09
Filing date: 2024-04-09
Publication date: 2024-07-05

Abstract

The invention provides an application of YTHDF inhibitor in preparing medicines for preventing and treating pathological myocardial hypertrophy and ventricular remodeling, and relates to the technical field of biological medicines. The invention can inhibit the pathological hypertrophy of myocardial cells, improve the heart contraction function and resist the pathological ventricular remodeling caused by pressure overload by interfering YTHDF expression in myocardial tissues. The invention also provides YTHDF targeted shRNA and viruses comprising the shRNA that are capable of delivering an artificially designed YTHDF targeted shRNA into myocardial tissue and interfering with YTHDF3 expression in myocardial tissue.

Description

Use of YTHDF inhibitor in preparation of medicine for preventing and treating pathological myocardial hypertrophy and ventricular remodeling

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of YTHDF inhibitor in preparation of medicines for preventing and treating pathological myocardial hypertrophy and ventricular remodeling.

Background

Heart failure (abbreviated heart failure) is a complex clinical syndrome caused by abnormal heart structure or function, and is the end stage of various cardiovascular diseases. According to the related research report, the prevalence of the full-sphere heart failure is about 1-3%, and although the prevalence of the heart failure in developed countries tends to be stable and decreases gradually, the prevalence of the heart failure is continuously increasing due to aging of population and prolongation of survival period of heart failure patients. Pathologic cardiac hypertrophy refers to a traumatic change of heart caused by pressure load increase, myocardial injury and the like, and is common pathophysiological manifestation in the progress of various cardiovascular diseases. If pathological stimulus or injury persists, the pathological hypertrophy will progress to pathological ventricular remodeling or even heart failure. Along with the continuous stimulation of pathological factors, hypertrophic cardiac muscle cannot balance ventricular wall stress and shifts to a maladaptive stage, so that heart structure disorder, heart contraction and relaxation dysfunction are caused, and heart failure, malignant arrhythmia and even sudden death are finally caused. Because of extremely complex regulatory networks in pathological cardiac hypertrophy and heart failure, slow and sustained deterioration of heart structure and function is still driven, resulting in poor long-term prognosis for heart failure patients. Therefore, it is necessary to find a gene with strong targeting and definite protective function, and to perform targeted intervention to effectively achieve the treatment of pathological cardiac hypertrophy and ventricular remodeling.

Disclosure of Invention

The object of the present invention is to provide new targets for the treatment of pathological cardiac hypertrophy and ventricular remodeling.

In order to achieve the above object, the present invention provides the following technical solutions:

Use of a YTHDF inhibitor in the manufacture of a medicament for preventing and treating pathological myocardial hypertrophy and ventricular remodeling, said YTHDF inhibitor comprising a small molecule compound, polymer, polypeptide, protein, nucleic acid substance or virus capable of modulating the expression profile of YTHDF in a subject, wherein said nucleic acid substance further comprises a substance associated with YTHDF that is silenced, knocked out or partially knocked out based on genetic engineering.

Preferably, the genetically engineered silencing is the use of shRNA to silence YTHDF genes.

More preferably, the nucleotide sequence of the sense strand of the shRNA is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand of the shRNA is shown as SEQ ID NO. 2.

The nucleotide sequence of the sense strand of the shRNA is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand of the shRNA is shown as SEQ ID NO. 2.

A virus which is an adenovirus expressing the shRNA described above.

Preferably, the adenovirus is an AAV9 virus.

Preferably, the viral titer of the AAV9 virus-packaged shRNA working solution is 1.8X10 ¹³ vg/mL.

A nucleic acid medicine for treating pathologic cardiac hypertrophy and ventricular remodeling caused by pressure load comprises the shRNA or virus and pharmaceutically acceptable auxiliary materials.

Preferably, the dosage form of the above-mentioned medicine includes intravenous injection.

An application of YTHDF as target in screening medicines for preventing and treating pathological cardiac hypertrophy and ventricular remodeling is provided.

The invention has the beneficial effects that:

(1) Experiments show that the expression of YTHDF in myocardial tissue is closely related to the occurrence and development of pathological cardiac hypertrophy and ventricular remodeling disease course caused by pressure load, and the pathological hypertrophy of myocardial cells can be inhibited, the cardiac contraction function can be improved, and the pathological ventricular remodeling caused by pressure overload can be resisted through the intervention of YTHDF expression in myocardial tissue.

(2) The invention also provides shRNA which can effectively inhibit YTHDF expression in myocardial cells. According to the invention, AAV9 virus packed with shRNA is acted on a mouse individual in an intravenous injection mode, and as a result, after the injection, the treatment aims of pathologic myocardial hypertrophy and ventricular remodeling caused by pressure load can be achieved by improving myocardial cell pathologic hypertrophy and heart function decline caused by aortic arch constriction surgery.

(3) The invention is based on the finding that YTHDF can be used as a target for screening drugs for preventing and treating pathological myocardial hypertrophy and ventricular remodeling.

Drawings

Fig. 1: detecting that the expression of YTHDF3 in myocardial tissue is obviously reduced after carrying out intravenous injection on SHRNAYTHDF of AAV9 package by fluorescent quantitative PCR; a: tail vein injection of AAV 9-packaged empty virus; b: tail vein injection AAV9 packaged SHRNAYTHDF; tail vein injection of AAV 9-packaged SHRNAYTHDF3 can significantly reduce YTHDF3 expression in cardiac tissue;

Fig. 2: detecting SHRNAYTHDF packed with intravenous AAV9 for echocardiography to ameliorate aortic arch constriction-induced cardiac insufficiency; a: tail vein injection AAV9 packed empty virus is performed with false operation; b: performing a pseudo-surgery simultaneously with tail vein injection of AAV9 packaged SHRNAYTHDF; c: tail vein injection of AAV9 packed empty-load virus is carried out simultaneously with aortic arch constriction operation; d: tail vein injection AAV9 packaged SHRNAYTHDF was performed simultaneously with aortic arch constriction surgery group; the tail vein injection of the SHRNAYTHDF3 packed by AAV9 can obviously improve the heart ejection fraction reduction induced by the aortic arch constriction operation; ejection fraction, ejection fraction; fractional shortening short axis shortening;

Fig. 3: detection of SHRNAYTHDF of intravenous AAV9 packages for WGA staining improved cardiac hypertrophy due to pressure loading; a: tail vein injection AAV9 packed empty virus is performed with false operation; b: performing a pseudo-surgery simultaneously with tail vein injection of AAV9 packaged SHRNAYTHDF; c: tail vein injection of AAV9 packed empty-load virus is carried out simultaneously with aortic arch constriction operation; d: tail vein injection AAV9 packaged SHRNAYTHDF was performed simultaneously with aortic arch constriction surgery group; the myocardial cell area of mice surrounding the aortic arch constriction operation is increased, and the SHRNAYTHDF packaged by the tail vein injection AAV9 can obviously reduce the pathological hypertrophy effect caused by the aortic arch constriction operation.

Fig. 4: detection of SHRNAYTHDF of intravenous AAV9 packages for masson staining improved cardiac fibrosis due to pressure loading. A: tail vein injection AAV9 packed empty virus is performed with false operation; b: performing a pseudo-surgery simultaneously with tail vein injection of AAV9 packaged SHRNAYTHDF; c: tail vein injection of AAV9 packed empty-load virus is carried out simultaneously with aortic arch constriction operation; d: the tail vein injection AAV9 packaged SHRNAYTHDF3 was performed simultaneously with the aortic arch constriction surgery group. The heart of the mice around the aortic arch constriction surgery is fibrosed, and the tail vein injection of the SHRNAYTHDF packaged by AAV9 can obviously reduce the heart fibrosis degree caused by the aortic arch constriction surgery.

Detailed Description

Use of a YTHDF inhibitor in the manufacture of a medicament for preventing and treating pathological myocardial hypertrophy and ventricular remodeling, said YTHDF inhibitor comprising a small molecule compound, polymer, polypeptide, protein, nucleic acid substance or virus capable of modulating the expression profile of YTHDF in a subject, wherein said nucleic acid substance further comprises a substance associated with YTHDF that is silenced, knocked out or partially knocked out based on genetic engineering; preferably, the pathological cardiac hypertrophy and ventricular remodeling are caused by pressure loading.

Specific: SEQ ID NO.1:5'-GATC GGCCGGATTTGGCAATGATAC TTCAAGAGA GTATCATTGCCAAATCCGGCC TTTTTG-3'.

SEQ ID NO.2：5’-AATTCAAAAA GGCCGGATTTGGCAATGATAC TCTCTTGAA GTATCATTGCCAAATCCGGCC-3’

A virus which is an adenovirus expressing the shRNA described above.

Preferably, the adenovirus is an AAV9 virus.

Preferably, the dosage form of the medicament preferably comprises intravenous injection.

In the present invention, all raw material components are commercially available products well known to those skilled in the art unless specified otherwise.

The technical solutions of the present invention will be clearly and completely described in the following in connection with the embodiments of the present invention. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

1. YTHDF3 construction of shRNA:

YTHDF3 shRNA was designed based on YTHDF Gene sequences (Gene ID: 229096) for shRNA:

Forward primer(SEQ ID NO.1)：5’-GATC GGCCGGATTTGGCAATGATAC TTCAAGAGA GTATCATTGCCAAATCCGGCC TTTTTG-3’

Reverse primer(SEQ ID NO.2)：5’-AATTCAAAAA GGCCGGATTTGGCAATGATAC TCTCTTGAA GTATCATTGCCAAATCCGGCC-3’

The resulting shRNA sequence was annealed and ligated into pEEN vector (full name: pENN. AAV. U6. Shrlicc. CMV. EGFP. SV40 (p 1867)) after double cleavage with BamHI-EcoRI.

ShRNA annealing system (50 μl): forward oligo (1. Mu.g/. Mu.L) 5. Mu.L, REVERSE PRIMER (1. Mu.g/. Mu.L) 5. Mu.L, 10x NEB buffer 25. Mu.L and ddH ₂ O35. Mu.L; annealing at 95 ℃ for 4min, and naturally cooling to room temperature.

The connection system is as follows: 50ng of annealed gene, 100ng of pEEN, 10xT4 Buffer 2 mu L, T4 Ligase2 mu L and the balance of ddH ₂ O; incubate overnight at 16 ℃.

After successful ligation, the plasmid was transformed into E.coli competent cells, and after Sanger sequencing was correct, the plasmid was extracted and virus-packaged.

Packaging, isolation and purification of AAV9 Virus

293T cells were seeded in 10cm cell culture dishes at a density of 400 ten thousand cells per dish. After 24 hours, 1mL of serum-free DMEM medium containing 10. Mu. gAAV9, 9-shYTHDF, 10. Mu. gAAV capsid plasmid, 10. Mu.g Helper plasmid, 90. Mu.L PEI MAX was added to each dish.

After 12 hours of transfection, fresh DMEM complete medium was replaced and after 48 hours the cells and virus in culture were collected.

Virus was collected in medium: 25mL of 40% PEG-8000 was added to each 100mL of the cell supernatant, centrifuged at 2800g at 4℃overnight, and centrifuged at 15℃for 15min. 1mL of cell lysis buffer was added to the virus particles and resuspended.

Virus collection in cells: cells collected by the scraping method were resuspended in 5mL of cell lysis buffer and freeze-thawed three times repeatedly in a-80 ℃ refrigerator and 37 ℃ water bath.

The virus suspension in the medium was mixed with the freeze-thaw cell suspension, 1mol/L magnesium chloride was added to a final concentration of 1mmol/L, and the benzoate enzyme (merck) was added to a final concentration of 250U/mL, and incubated at 37℃for 45min. After centrifugation at 4000rpm for 4min at 4℃the supernatant was taken. Viruses were purified using iodixanol gradient density centrifugation.

The detection method of the virus titer comprises the following steps: the viral vector plasmid was diluted to 1 ng/. Mu.L and the plasmid copy number concentration at this time was calculated as: 1.8X10 ¹³ vg/mL. The plasmid was diluted twice in gradient 13 times to obtain standards 1 to 14, and Standard DNAdilution diluted 2 times was used to prepare a standard curve.

Taking 5 mu L of the prepared purified virus AAV9-shRNA-YTHDF, extracting virus gDNA by using a tissue genomic DNA extraction kit according to instruction, eluting the gDNA by 50 mu LddH ₂ O finally, diluting the virus gDNA by 100 times, and detecting the virus titer by adopting a qPCR method.

QPCR reaction System (10. Mu.L): SYBR Green 5. Mu.L, upstream primer F and downstream primer R (10. Mu.M) each 0.5. Mu. L, ddH ₂ O2.5. Mu.L, standard DNA dilutions or 2. Mu.L of viral genomic DNA;

the sequences of the upstream primer F and the downstream primer R for qPCR reaction are as follows:

Upstream primer F (SEQ ID NO. 3): 5'-AAGTACGCCCCCTATTGACG-3';

downstream primer R (SEQ ID NO. 4): 5'-CACGCCCATTGATGTACTGC-3'.

QPCR reaction procedure was as follows: pre-denaturation at 95℃for 10min; denaturation at 95℃for 15sec, annealing at 60℃for 30sec,40 cycles. The virus titer was determined by linear fitting, since the number of cycles and the logarithm of Standard DNAdilution concentration were linear. AAV9 virus after titer determination can be used directly in animal experiments or frozen at-80 ℃.

Example 2

1. Aortic arch constriction operation induced mouse pathological myocardial hypertrophy and ventricular remodeling model establishment

C57BL/6J wild type male mice (purchased from Experimental animal technologies Co., ltd., beijing) of 8-10 weeks old were equally divided into an aortic arch constriction surgery (TAC) group (experimental group) and a Sham surgery (Sham) group (control group).

The surgical field was prepared and sterilized by wiping with 75% alcohol, setting the temperature of the blanket at 34 ℃, the small animal ventilator frequency at 110-120 times/minute, the tidal volume at 2.0ml, and the surgical instruments were autoclaved at high temperature prior to surgery. 8-week-old C57BL/6 male mice are selected, the weight of the mice is weighed, 4% chloral hydrate is used for injecting the anesthetized mice into the abdominal cavity according to the weight standard of 10 mu L/g, and the mice are fixed on a constant temperature pad in a supine position by a medical adhesive tape. The cotton swab is dipped in the depilatory cream and is coated on the skin of the neck and chest of the mouse, the hair is scraped off by the blade after 1 minute to expose the skin, and the skin at the exposed part is disinfected by 75% alcohol.

A small opening of 0.5cm is cut longitudinally on the neck of the mouse under the body view mirror, and muscles and tissues covered on the trachea are separated to expose the air outlet pipe.

And (3) inserting an endotracheal tube between two tracheal cartilage rings below the glottis, fixing the endotracheal tube, and checking that the thoracic relief of the mice accords with the frequency of a breathing machine to ensure smooth breathing of the mice.

Under the stereoscopic vision, an opening with the length of 0.8cm is longitudinally cut on the middle of a mouse sternum, then the sternum is cut to a second rib, the left side and the right side of a drag hook pull the sternum apart, micro forceps separate thymus, slowly separate adipose tissues to find an aortic arch, 7-0 silk threads are used for penetrating the aortic arch between a left common carotid artery and a right brachiocephalic artery, a 27G syringe needle is placed beside the aortic arch in parallel, the 7-0 silk threads are knotted and ligature the aortic arch and the needle by micro forceps, knotting and fixing are carried out again, and then the needle is rapidly extracted.

Ribs, muscles and skin were sutured layer by layer and the wound was iodine sterilized.

After the mice breathe spontaneously, the breathing machine is turned off, and the mice are transferred to a constant temperature blanket for recovery.

After the gunpowder of the mice is completely dispersed and recovered, the gunpowder is put back into a squirrel cage for continuous feeding.

The procedure of the sham operation is identical to the above except that the ligation portion is not performed.

AAV9-sh-YTHDF injection

The 5.4X10 ¹¹ vg/dose of virus was injected into mice by tail vein injection, and 1 week later, the cardiotoxic damage model was constructed. Where vg represents vector genome. The specific experimental process is as follows:

First, experimental mice were divided into 4 groups, which were control virus+sham group, control virus+tac4 week group, AAV9-shRNA-YTHDF3+sham group, AAV9-shRNA-YTHDF3 +tac4 week group, respectively.

Starting 1 week before aortic arch constriction surgery induced pathologic myocardial hypertrophy and ventricular remodeling model modeling, treating mice by tail vein injection with a disposable 1mL sterile syringe, and specifically comprises the following steps:

Group 1 control virus+sham surgery group, mice were given control virus by intravenous injection at 5.4X10 ¹¹ vg/mouse, sham surgery after 1 week;

AAV9-shRNA-YTHDF3+ sham operation group 2, according to 5.4X10 ¹¹ vg/mouse, performing sham operation after 1 week by intravenous injection of AAV9-shRNA-YTHDF to the tail of mouse;

Group 3 control virus+aortic arch constriction surgery group, the mice tail vein was injected with control virus according to 5.4X10 ¹¹ vg/mouse, and aortic arch constriction surgery was performed after 1 week;

AAV9-shRNA-YTHDF3 +aortic arch constriction surgery group 4 the mouse tail vein was injected with AAV9-shRNA-YTHDF3 according to 5.4X10 ¹¹ vg/mouse, and after 1 week, aortic arch constriction surgery was performed.

After 4 weeks of aortic arch constriction surgery or sham surgery, heart color Doppler ultrasonic detection is carried out on the mice, the mice are euthanized after the detection is finished, the heart of the mice is obtained through dissection, and Wheat Germ Agglutinin (WGA) staining and masson staining are carried out on myocardial tissue section samples.

QPCR detection YTHDF expression Change

Mice were sacrificed 4 weeks after aortic arch constriction surgery or sham surgery, hearts of the mice were dissected, total RNA in heart tissue was extracted using Trizol lysate, and cDNA was obtained using a reverse transcription kit. YTHDF3 expression was detected by qPCR and the change in expression of YTHDF was analyzed by calculation using 2 ^{^-ΔCT}. qPCR reaction System (10. Mu.L): SYBR Green 5. Mu.L, upstream primer F and downstream primer R (10. Mu.M) each 0.5. Mu. L, ddH ₂ O2.5. Mu. L, cDNA dilution 2. Mu.L;

upstream primer F (SEQ ID NO. 5): 5'-GGAGAGCAAAACAGTTGTTTCAT-3';

Downstream primer R (SEQ ID NO. 6): 5'-CCTAATGCCCCTGGTTGACT-3'.

QPCR reaction procedure was as follows: pre-denaturation at 95 ℃ for 30sec; denaturation at 95℃for 15sec, annealing at 60℃for 30sec and extension 40 times.

As a result, as shown in FIG. 1, a total of 6 mouse hearts were examined for YTHDF expression, 3 of which were derived from the first group, and their relative expression amounts of YTHDF3 were 1.054579, 0.997692, 0.950439, respectively; of these 3 were from the second group, their YTHDF relative expressions were 0.400998, 0.355191, 0.452712, respectively. The results of the AAV9-shYTHDF test are shown in fig. 1, SHRNAYTHDF3 was effective in knocking down YTHDF3 expression in the heart (< 0.001).

4. Mouse heart ultrasound detection

After dehairing and wiping the chest of the mice clean, the mice were anesthetized with isoflurane and their heart rate stabilized at 450-500 beats/min. The contractile function of the mice was examined using a small animal cardiac ultrasound detection system (Visual Sonics, vevo 2100), and long axis images of the left ventricle B-mode of the mice were acquired and M-mode images were acquired where the left ventricle diameter was greatest. Finally, LVtrace tools were used to calculate left ventricular Ejection Fraction (EF) and left ventricular short axis shortening (FS). As a result, as shown in FIG. 2, a total of 29 mice were subjected to cardiac ultrasound examination, 8 of which were from the first group, had EF of 65.49726%, 63.90507%, 64.54801%, 69.11499%, 67.42393%, 61.09579%, 65.86862%, 64.5457%, and FS of 35.52751%, 34.43098%, 34.9159%, 38.07923%, 36.98395%, 32.28335%, 35.63865%, 34.89128%, respectively; of which 8 were from the second group, their EF was 66.47693%, 62.96808%, 69.28619%, 66.45984%, 62.78048%, 68.93984%, 60.64301%, 69.74592%, respectively; FS is 35.78995%, 33.51418%, 38.13042%, 36.01787%, 33.46206%, 37.73634%, 32.02642%, 38.39959%, respectively; of which 6 were from the third group, their EF was 43.89065%, 32.04567%, 34.47252%, 42.485%, 42.59374%, 35.94862%, respectively; FS is 21.27322%, 14.98645%, 16.13629%, 20.2526%, 20.63329%, 16.72363%, respectively; 7 from the fourth group had EF 57.66045%, 56.11568%, 60.10776%, 58.17121%, 62.07099%, 67.90395%, 57.93947%, respectively; FS is 30.01667%, 28.91189%, 31.58174%, 30.44308%, 32.79695%, 37.08425%, 30.10002%, respectively.

5. WGA staining of mouse myocardial tissue

Tissue sections generated after frozen tissue sections of mouse myocardial tissue were attached to slides, which were stored at-80 ℃.

The specific dyeing method is as follows:

After sealing with 50% glycerol under light-shielding conditions, the samples were observed under a laser confocal microscope (Carl Zeiss, thuringia, germany) and counted using Image J.

As a result, as shown in FIG. 3, a total of 24 heart tissue sections were WGA stained, and 24 heart tissue sections were obtained from the above-mentioned 4 groups of mice, and 4 pieces of each group were obtained from different individual mice in the group. The relative areas of the myocardial cells counted by the first group of heart tissue sections are 1.068336, 0.997652, 0.999579, 1.002156, 0.996595 and 0.935683 respectively; the relative areas of the myocardial cells obtained by statistics of the second group of heart tissue sections are 1.033897, 0.99496, 0.998531, 0.995546, 1.000554 and 0.9666 respectively; the third group of heart tissue sections are counted to obtain the relative areas of myocardial cells which are 1.512706, 1.573257, 1.579039, 1.606207, 1.626292 and 1.579868 respectively; the fourth set of heart tissue sections counted the relative areas of cardiomyocytes as 1.122406, 1.229877, 1.222039, 1.221781, 1.224949, 1.130671, respectively.

6. Marsonian staining of mouse myocardial tissue

Tissue sections generated after paraffin sections of mouse myocardial tissues are adhered to a glass slide and stored at room temperature.

The specific dyeing method is as follows:

after encapsulation with neutral resin, the sheet was observed under a bright field microscope.

As a result, as shown in FIG. 4, 24 heart tissue sections were subjected to Marsonian staining, and 24 heart tissue sections were obtained from the above-mentioned 4 groups of mice, and 6 pieces each were obtained from different individual mice in the group. The fibrosis ratio obtained by statistics of the first group of heart tissue sections is 0.73%, 1.3%, 0.85%, 0.81%, 1.11% and 1.15% respectively; the fibrosis ratio obtained by statistics of the second group of heart tissue sections is 1.28%, 1.11%, 1.82%, 1.65%, 1.52% and 1.55% respectively; the third group of heart tissue sections are counted to obtain fibrosis proportions of 10.68%, 7.44%, 11.65%, 9.03%, 8.57% and 9.6% respectively; the fourth group of heart tissue sections were counted to have fibrosis ratios of 5.47%, 4.81%, 4.41%, 4.01%, 4.84% and 3.76%, respectively.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

Use of an inhibitor of ythdf3 in the manufacture of a medicament for preventing and treating pathological myocardial hypertrophy and ventricular remodeling, wherein said inhibitor YTHDF comprises a small molecule compound, a high molecular polymer, a polypeptide, a protein, a nucleic acid substance or a virus capable of modulating the expression profile of a subject YTHDF, wherein said nucleic acid substance further comprises a substance involved in silencing, knocking out or partial knocking out YTHDF based on genetic engineering.
2. The use of claim 1, wherein the genetically engineered silencing is silencing YTHDF genes using shRNA.
3. The use of claim 2, wherein the shRNA has a sense strand nucleotide sequence shown in SEQ ID No.1 and the shRNA has an antisense strand nucleotide sequence shown in SEQ ID No. 2.
4. The shRNA is characterized in that the nucleotide sequence of the sense strand of the shRNA is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense strand of the shRNA is shown as SEQ ID NO. 2.
5. A virus, wherein the virus is an adenovirus expressing the shRNA of claim 4.
6. The virus of claim 5, wherein the adenovirus is an AAV9 virus.
7. The virus of claim 6, wherein the AAV9 virus packaged shRNA working solution has a viral titer of 1.8 x 10 ¹³ vg/mL.
8. A nucleic acid medicament for the treatment of pathological cardiac hypertrophy and ventricular remodeling caused by pressure loading, the active ingredients of which comprise shRNA according to claim 4 or a virus according to any one of claims 6 to 8, and pharmaceutically acceptable excipients.
9. The medicament of claim 8, wherein the dosage form of the medicament comprises an intravenous solution.
10. An application of YTHDF as target in screening medicines for preventing and treating pathological cardiac hypertrophy and ventricular remodeling is provided.