CN114504658B

CN114504658B - Medicine for treating cardiotoxic injury induced by doxorubicin and application thereof

Info

Publication number: CN114504658B
Application number: CN202210175379.4A
Authority: CN
Inventors: 肖俊杰; 王丽君; 申可婷; 朱利云; 齐蔚僮
Original assignee: University of Shanghai for Science and Technology
Current assignee: University of Shanghai for Science and Technology
Priority date: 2022-02-25
Filing date: 2022-02-25
Publication date: 2023-07-21
Anticipated expiration: 2042-02-25
Also published as: CN114504658A

Abstract

The invention provides a medicine for treating cardiotoxic injury induced by doxorubicin and application thereof, and relates to the technical field of biological medicine. The invention provides application of an agent interfering with expression of cyclic RNAcirc-ZNF609 in myocardial tissues in preparation of a medicament for preventing and/or treating adriamycin-induced cardiotoxic damage, wherein the agent or the medicament can deliver a gene sequence of manually designed circ-ZNF609shRNA into myocardial tissues based on AAV virus and interfere with expression of the cyclic RNAcirc-ZNF609 in myocardial tissues, so that effects of inhibiting myocardial apoptosis, improving cardiac contraction function and resisting adriamycin-induced cardiotoxic damage are achieved.

Description

Medicine for treating cardiotoxic injury induced by doxorubicin and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a medicine for treating cardiotoxic injury induced by doxorubicin and application thereof.

Background

Anthracycline antitumor drugs, such as doxorubicin, daunorubicin, epirubicin, and the like, are widely applied to treatment of various blood system tumors and solid tumors, and have an unavoidable place in the current various tumor treatment guidelines, however, anthracycline drugs also have unavoidable serious adverse reactions, and the cardiac toxicity damage caused by the anthracycline drugs has serious influence on the long-term prognosis of patients. Most patients can develop myocardial damage faster after anthracycline administration and become increasingly evident as the event lengthens. Sub-clinical ultrasound examination changes in left ventricular function, including decreased contractile function and increased afterload, may occur in more than 50% of patients after years of administration. The main mechanism of toxic damage to the myocardium by anthracyclines is not completely understood, and known approaches include oxygen radical generation through enzymatic and non-enzymatic pathways to induce cardiomyocyte apoptosis, and DNA double bond cleavage through inhibition of topoisomerase ilβ to cause cardiomyocyte death. At present, most of heart injuries generated by anthracycline antitumor drugs are treated by using right-hand radson, and the right-hand radson can be competitively combined with topoisomerase II beta, so that the effect of protecting myocardial cells from injury is achieved. However, dexrazoxane also has some side effects including anemia, thrombocytopenia, etc. The use of dexrazoxane in the treatment of pediatric tumors has been reported to significantly increase the four year cumulative incidence of the second malignancy. Therefore, it is necessary to find a gene with strong targeting and definite protective function, and perform targeted intervention to effectively realize cardiotoxicity treatment of anthracycline antitumor drugs.

Disclosure of Invention

In view of the above, the present invention aims to provide a drug for treating cardiotoxic injury induced by doxorubicin and an application thereof, wherein an shRNA capable of interfering with the expression of cyclic RNA circ-ZNF609 is delivered into cardiac muscle by AAV9 virus to reduce the expression of circ-ZNF609 in cardiac muscle, thereby producing a therapeutic effect on cardiotoxic injury induced by doxorubicin.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides application of an agent interfering with expression of cyclic RNAcirc-ZNF609 in myocardial tissue in preparation of a medicament for preventing and/or treating doxorubicin-induced cardiotoxic injury.

Preferably, the reagent comprises circ-ZNF609shRNA, and the nucleotide sequence of the circ-ZNF609shRNA is shown as SEQ ID NO. 1.

Preferably, the amplification primer of the circ-ZNF609shRNA comprises an upstream primer F and a downstream primer R, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer R is shown as SEQ ID NO. 3.

Preferably, the reagent comprises circ-ZNF609shRNA packaged by AAV virus, and the nucleotide sequence of the circ-ZNF609shRNA is shown as SEQ ID NO. 1.

Preferably, the AAV virus comprises an AAV9 virus.

The invention also provides a circ-ZNF609shRNA packaged by AAV9 viruses, and the nucleotide sequence of the circ-ZNF609shRNA is shown as SEQ ID NO. 1.

Preferably, the AAV9 virus-packaged circ-ZNF609shRNA working fluid has a viral titer of 2X 10 ¹³ vg/mL。

The invention also provides a medicine for treating the cardiotoxic injury induced by the doxorubicin, and the active ingredients of the medicine comprise circ-ZNF609shRNA packaged by AAV9 virus and pharmaceutically acceptable auxiliary materials.

Preferably, the dosage form of the medicament comprises intravenous injection.

The beneficial effects are that: the invention provides application of an agent interfering with expression of circular RNA circ-ZNF609 in myocardial tissue in preparing a medicine for preventing and/or treating adriamycin-induced cardiotoxic injury. In the embodiment of the invention, the circ-ZNF609shRNA packaged by AAV9 viruses acts on a mouse individual in an intravenous injection mode, and the result shows that after the injection, the apoptosis of cardiac muscle cells induced by doxorubicin can be improved and the cardiac function can be partially recovered, so that the aim of treating the cardiac toxic injury caused by the doxorubicin is fulfilled.

Drawings

FIG. 1 is a graph of the result of screening for shRNA efficiency of circ-ZNF609, with the best effect of shRNA2 strand, and designated circ-ZNF609 shRNA;

FIG. 2 is a schematic diagram of the circ-ZNF609shRNA, with Junction Site indicated as a loop Site;

FIG. 3 shows that fluorescence quantitative PCR detects that the expression of circ-ZNF609 in myocardial tissue is significantly reduced after intravenous injection of AAV9 packaged circ-ZNF609 shRNA; red: tail vein injection AAV9 packed empty virus and physiological saline group at the same time; blue: tail vein injection AAV9 packaged circ-ZNF609shRNA and abdominal cavity injection physiological saline group; green: tail vein injection AAV9 packaged empty virus and intraperitoneal injection of doxorubicin group; purple: tail vein injection AAV9 packaged circ-ZNF609shRNA and intraperitoneal injection of doxorubicin groups; the circ-ZNF609shRNA packaged by the AAV9 is injected into the tail vein, so that the expression of the circ-ZNF609 in heart tissues can be obviously reduced;

FIG. 4 is an echocardiographic examination of the circ-ZNF609shRNA packaged with intravenous AAV9 for the amelioration of doxorubicin-induced cardiac insufficiency; red: tail vein injection AAV9 packed empty virus and physiological saline group at the same time; blue: tail vein injection AAV9 packaged circ-ZNF609shRNA and abdominal cavity injection physiological saline group; green: tail vein injection AAV9 packaged empty virus and intraperitoneal injection of doxorubicin group; purple: tail vein injection AAV9 packaged circ-ZNF609shRNA and intraperitoneal injection of doxorubicin groups; the circ-ZNF609shRNA packaged by the AAV9 is injected into the tail vein, so that the reduction of the heart ejection fraction induced by doxorubicin can be remarkably improved; ejection fraction, ejection fraction; fractional shortening short axis shortening;

FIG. 5 shows that Tunel staining detects that intravenous injection of AAV 9-packaged circ-ZNF609shRNA improved doxorubicin-induced cardiomyocyte apoptosis; blue: tail vein injection AAV9 packaged circ-ZNF609shRNA and abdominal cavity injection physiological saline group; green: tail vein injection AAV9 packaged empty virus and intraperitoneal injection of doxorubicin group; purple: tail vein injection AAV9 packaged circ-ZNF609shRNA and intraperitoneal injection of doxorubicin groups; apoptotic cells, namely Tunel positive cells, in mice myocardial cells injected with the doxorubicin intraperitoneally are obviously increased, and the number of the apoptotic myocardial cells can be obviously reduced by injecting the circ-ZNF609shRNA packaged by AAV9 into tail veins.

Detailed Description

The invention provides application of an agent interfering with expression of circular RNA circ-ZNF609 in myocardial tissue in preparing a medicine for preventing and/or treating adriamycin-induced cardiotoxic injury.

The circular RNA circle-ZNF 609 of the invention is preferably derived from human or mouse sources, wherein the human sources are: hsa_circ_0000615, mouse source: mmu_circ_0001797. The reagent for interfering the expression of the circular RNA circ-ZNF609 in the myocardial tissue preferably comprises circ-ZNF609shRNA, and the nucleotide sequence of the circ-ZNF609shRNA is preferably shown as SEQ ID NO. 1: AGTCAAGTCTGAAAAGCAATGCTCGAG CATTGCTTTTCAGACTTGACTTTTTTG, the structure of which is shown in fig. 2.

The acquisition of the circ-ZNF609shRNA preferably comprises the steps of firstly acquiring the sequence of the circZNF609 from a circBase database, crossing a reverse splice site of the circular RNA, and designing an siRNA sequence (SEQ ID NO. 4): 5'-AGTCAAGTCTGAAAAGCAATG-3'; and after the siRNA sequence is designed, sleeving an shRNA structure template: an upstream primer (SEQ ID NO. 2) 5'-GATCAGTCAAGTCTGAAAAGCAATG CTCGAGCATTGCTTTTCAGACTTGACT TTTTTG-3'; the downstream primer (SEQ ID NO. 3) 5'-AATT CAAAAA AGTCAAGTCTGAAAAGCAATG CTCGAGCATTGCTTTTCAGACTTGACT-3'. The present invention preferably ligates the above-mentioned upstream primer and downstream primer to pEEN vector (full name: pENN. AAV. U6. Shrlicc. CMV. EGFP. SV40 (p 1867)) after double cleavage after annealing. The double cleavage according to the present invention is preferably performed by BamHI and EcoRI. The annealing temperature of the invention is preferably 95 ℃, and the annealing time is preferably 4min. The invention preferably further comprises natural cooling to room temperature (18-25 ℃) after said annealing. The targeting sequence of the circ-ZNF609shRNA is preferably shown as SEQ ID NO. 8: AGTCAAGTCTGAAAAGCAATG.

The reagent preferably comprises circ-ZNF609shRNA packaged by AAV viruses, the nucleotide sequence of the circ-ZNF609shRNA is shown as SEQ ID NO.1, and the AAV viruses preferably comprise AAV9 viruses. The method for packaging the circ-ZNF609shRNA of the AAV virus is not particularly limited, and preferably comprises the steps of integrating the circ-ZNF609shRNA into an AAV9 vector, packaging the AAV9 vector into a recombinant AAV9 virus with the aid of an AAV9 capsid plasmid and a Helper plasmid, and determining the titer of the AAV9 virus after separation and purification.

The virus titer of the working solution of the circ-ZNF609shRNA packaged by the AAV9 virus is preferably 2 multiplied by 10 ¹³ vg/mL。

The dosage form of the drug preferably comprises intravenous injection, and in the embodiment, the circ-ZNF609shRNA packaged by AAV9 virus is taken as working solution and is injected into a dose of 30 mu L of each mouse by tail intravenous injection, so that the drug can improve myocardial cell apoptosis induced by doxorubicin and partially restore heart function.

The following examples are provided to illustrate in detail the use and pharmaceutical compositions for treating doxorubicin-induced cardiotoxic lesions, but are not to be construed as limiting the scope of the invention.

Example 1

1. construction of circ-ZNF609 shRNA:

the sequence of circZNF609 was first obtained from the circBase database (species human source: hsa_circ_0000615 and mouse source: mmu_circ_ 0001797). The siRNA sequence was designed across the reverse splice site of the circular RNA:

siRNA#1(SEQ ID NO.5):5’-AGTCAAGTCTGAAAAGCAATGAT-3’

siRNA#2(SEQ ID NO.4):5’-AGTCAAGTCTGAAAAGCAATG-3’

after siRNA is designed, the shRNA structure template is sleeved in:

for shRNA #1:

Forward primer(SEQ ID NO.6):5’-GATCAGTCAAGTCTGAAAAGCAATGAT CTCGAGATCATTGCTTTTCAGACTTGACT TTTTTG-3’

Reverse primer(SEQ ID NO.7):5’-AATT CAAAAAGTCAAGTCTGAAAAGCAATGAT CTCGAGATCATTGCTTTTCAGACTTGACT-3’

for shRNA #2:

Forward primer(SEQ ID NO.2):5’-GATCAGTCAAGTCTGAAAAGCAATG CTCGAGCATTGCTTTTCAGACTTGACT TTTTTG-3’

Reverse primer(SEQ ID NO.3):5’-AATT CAAAAAAGTCAAGTCTGAAAAGCAATG CTCGAGCATTGCTTTTCAGACTTGACT-3’；

the resulting shRNA sequence was annealed and ligated into the pEEN vector after BamHI and EcoRI double cleavage.

shRNA annealing system (50 μl): forward oligo (1. Mu.g/. Mu.l) 5. Mu.L, reverse primer (1. Mu.g/. Mu.l) 5. Mu.L, 10x NEB buffer 25. Mu.L and ddH ₂ O35 μl; annealing at 95 ℃ for 4min, and naturally cooling to room temperature.

The connection system is as follows: 50ng of annealed gene, 100ng of pEEN, 10xT4 Buffer 2 mu L, T4 Ligase 2 mu L and the balance of ddH ₂ O; incubate overnight at 16 ℃.

After successful connection, the plasmid is transformed into competent cells of escherichia coli, and after Sanger sequencing is correct, plasmids are extracted to obtain pENN-circ-ZNF609shRNA #1 and pENN-circ-ZNF609shRNA #2, and virus packaging can be performed. As shown in FIG. 1, the inhibition efficiency of pENN-circ-ZNF609shRNA #2 to circ-ZNF609 is lower than 50% and is superior to pENN-circ-ZNF609shRNA #1. Therefore, in the subsequent experiments, pENN-circ-ZNF609shRNA#2 is adopted for relevant research. * P <0.01; * P <0.05.

Packaging, isolation and purification of AAV9 Virus

293T cells were seeded in 10cm cell culture dishes at a density of 400 ten thousand cells per dish. After 24 hours, 1mL of serum-free DMEM medium containing 10. Mu.g pENN-circ-ZNF609shRNA #2, 10. Mu.g AAV capsid plasmid, 10. Mu.g Helper plasmid, 90. Mu.l PEI MAX was added to each dish.

After 12 hours of transfection, fresh DMEM complete medium was replaced and after 48 hours the cells and virus in culture were collected.

Virus was collected in medium: 25mL of 40% PEG-8000 was added to each 100mL of cell supernatant, centrifuged at 2800g at 4℃overnight, and at 15℃for 15min. 1mL of cell lysis buffer was added to the virus particles and resuspended.

Virus collection in cells: cells collected by the scraping method were resuspended in 5mL of cell lysis buffer and freeze-thawed three times repeatedly in a-80 ℃ refrigerator and 37 ℃ water bath.

The virus suspension in the medium was mixed with the freeze-thaw cell suspension, 1mol/L magnesium chloride was added to a final concentration of 1mmol/L, and the benzoate enzyme (merck) was added to a final concentration of 250U/mL, and incubated at 37℃for 45min. After centrifugation at 4000rpm for 4min at 4℃the supernatant was taken. Viruses were purified using iodixanol gradient density centrifugation.

The detection method of the virus titer comprises the following steps: the viral vector plasmid was diluted to 1 ng/. Mu.l and calculated at this time as plasmid copy number concentration: 1.36×10 ¹¹ vg/mL. The plasmid was diluted twice in gradient 13 times to obtain standards 1 to 14, and a standard curve was prepared by diluting Standard DNA dilution with 2 times.

Taking 5 μl of the purified virus AAV9-shRNA-circZNF609 prepared above, extracting virus gDNA by using tissue genomic DNA extraction kit according to instruction, and finally obtaining 50 μl ddH ₂ O was eluted, and then virus gDNA was re-diluted 100-fold and assayed for virus titer by qPCR.

qPCR reaction System (10. Mu.L): SYBR Green 5. Mu.L, upstream primer F and downstream primer R (10. Mu.M) each 0.5. Mu. L, ddH ₂ O2.5. Mu.L, standard DNA dilutions or 2. Mu.L of viral genomic DNA;

the sequences of the upstream primer F and the downstream primer R for qPCR reaction are as follows:

upstream primer F (SEQ ID NO. 9): 5'-AAGTACGCCCCCTATTGACG-3';

downstream primer R (SEQ ID NO. 10): 5'-CACGCCCATTGATGTACTGC-3'.

qPCR reaction procedure was as follows: pre-denaturation at 95℃for 10min; denaturation at 95℃for 15sec, annealing at 60℃for 30sec,40 cycles.

The virus titer was determined by linear fitting, since the number of cycles and the logarithm of Standard DNAdilution concentration were linear. AAV8 virus after titer determination can be used directly in animal experiments or frozen at-80 ℃.

Example 2

1. Establishing of doxorubicin-induced mouse cardiotoxicity injury model

Taking 8-10 week old C57BL/6J wild male mice, administering 5mg/kg doxorubicin to the mice to induce cardiotoxic injury, and performing intraperitoneal injection once a week for 4 weeks, wherein the corresponding control model is a control group of mice, and the mice are replaced by intraperitoneal injection of an equal volume of physiological saline once a week for 4 weeks. Mice were sacrificed 7 days after the last dosing was completed to continue feeding mice.

AAV9-sh-circ-ZNF609 injection

Will 10 ¹¹ The vg/dose virus was injected into mice by tail vein injection, and 1 week later, a cardiotoxic injury model was constructed. Where vg represents vector genome. The specific experimental process is as follows:

first, the experimental mice were divided into 4 groups, which were a control virus+physiological saline group, a control virus+doxorubicin group, an AAV9-shRNA-circ-ZNF 609+physiological saline group, and an AAV9-shRNA-circ-ZNF 609+doxorubicin group, respectively.

Starting 1 week before modeling of the heart toxicity injury model, the mice are treated by tail vein injection through a disposable 1mL sterile syringe, and the specific method is as follows:

group 1 control virus+saline group, all according to 10 ¹¹ vg/mouse, the tail vein of the mouse is injected with the control virus, and physiological saline intraperitoneal injection is started after 1 week;

group 2 control virus+doxorubicin groups, all according to 10 ¹¹ vg/mouse, the tail vein of the mouse is injected with control virus, and the intraperitoneal injection of the doxorubicin is started after 1 week;

AAV9-shRNA-circ-ZNF609+ physiological saline group of group 3, all according to 10 ¹¹ vg/mouse, AAV9-shRNA-circ-ZNF609 is injected into the tail vein of the mouse, and physiological saline intraperitoneal injection is started after 1 week;

AAV9-shRNA-circ-ZNF609+ doxorubicin group of group 4 AAV9-shRNA-circ-ZNF609 was injected intravenously into the tail of mice at 100. Mu.L/mouse, and 1 week later, intraperitoneal injection of doxorubicin was started.

After 1 week of 4 th doxorubicin intraperitoneal injection, heart color Doppler ultrasonic detection is carried out on the mice, the mice are sacrificed after detection, the heart of the mice is obtained through dissection, firstly, fluorescent quantitative PCR is used for verifying whether AAV9-shRNA-circ-ZNF609 successfully reduces the expression of circ-ZNF609 in the heart at animal level, then, tunel staining is carried out on myocardial tissue section samples, and the number of cells positive to Tunel is counted.

qPCR detection of circ-ZNF609 expression Change

Mice were sacrificed 1 week after completion of the 4 th doxorubicin intraperitoneal injection, hearts of the mice were dissected, total RNAs in heart tissue were extracted using Trizol lysate, and cdnas were obtained using a reverse transcription kit. The expression of circ-ZNF609 was detected by qPCR and 2 ^-ΔCT The expression changes of circ-ZNF609 were analyzed by calculation. qPCR reaction System (10. Mu.L): SYBR Green 5. Mu.L, upstream primer F and downstream primer R (10. Mu.M) each 0.5. Mu.L,ddH ₂ 2. Mu.L of O2.5. Mu. L, cDNA dilution;

upstream primer F (SEQ ID NO. 11): 5'-GAAGGGGAGAATGAGTGCCG-3';

downstream primer R (SEQ ID NO. 12): 5'-GTCAACGTCCCACCTCAAGGTTC-3'.

qPCR reaction procedure was as follows: pre-denaturation at 95 ℃ for 30sec; denaturation at 95℃for 15sec, annealing at 60℃for 30sec and extension 40 times.

As a result, as shown in FIG. 3, a total of 48 mouse hearts were examined for the expression of circ-ZNF609, 9 of which were derived from the first group, and the relative expression amounts of circ-ZNF609 were 0.89, 0.83, 1.16, 0.98, 1.04, 1.13, 0.77, 1.40, 1.13, respectively; of which 10 were from the second group, the relative expression levels of circ-ZNF609 were 0.83, 0.87, 0.73, 1.14, 0.65, 0.82, 0.76, 0.74, 0.52, respectively; of which 15 were from the third group, the relative expression levels of circ-ZNF609 were 1.28, 0.93, 1.62, 3.70, 3.80, 1.59, 1.34, 1.15, 1.19, 1.30, 3.44, 3.74, 1.38, 1.27, 1.26, respectively; of these, 14 were from the fourth group, and the relative expression levels of circ-ZNF609 were 0.59, 0.75, 0.86, 0.64, 0.95, 0.50, 1.85, 0.57, 0.84, 0.91, 0.74, 0.77, 1.05, and 0.72, respectively.

4. Mouse heart ultrasound detection

After dehairing and wiping the chest of the mice clean, the mice were anesthetized with isoflurane and their heart rate stabilized at 450-500 beats/min. The contractile function of the mice was examined using a small animal cardiac ultrasound detection system (Visual Sonics, vevo 2100), and long axis images of the left ventricle B-mode of the mice were acquired and M-mode images were acquired where the left ventricle diameter was greatest. Finally, the LV trace tool was used to calculate left ventricular Ejection Fraction (EF) and left ventricular short axis shortening (FS). As a result, as shown in FIG. 4, a total of 48 mice were subjected to cardiac ultrasound examination, 9 of which were from the first group, with EF of 53.9%, 53.3%, 49.0%, 62.6%, 50.9%, 55.3%, 66.8%, 59.0%, and FS of 28.8%, 27.6%, 27.3%, 24.4%, 32.8%, 25.6%, 28.2%, 36.4%, 31.0%, respectively; of which 10 only comes from the second group, EF is 51.1%, 59.2%, 53.0%, 56.1%, 52.8%, 54.0%, 59.2%, 66.9%, 56.6%, 58.7%, and FS is 25.8%, 31.1%, 26.3%, 28.9%, 26.8%, 27.5%, 30.8%, 36.3%, 29.4%, 30.6%, respectively; 15 of these are from the third group, EF is 32.7%, 24.8%, 23.9%, 32.6%, 31.6%, 26.0%, 40.9%, 37.0%, 36.8%, 42.7%, 42.2%, 42.3%, 45.3%, 40.6%, 49.5%, and FS is 14.7%, 11.3%, 10.8%, 15.2%, 14.7%, 11.9%, 19.6%, 17.5%, 17.4%, 20.7%, 20.0%, 20.3%, 21.9%, 19.4%, 24.3%, respectively; of these 14, from the fourth group, EF was 53.2%, 53.9%, 70.6%, 54.3%, 47.7%, 67.0%, 51.0%, 67.9%, 52.3%, 57.9%, 55.6%, 65.7%, 48.3%, 58.0%, and FS was 26.8%, 27.4%, 39.1%, 27.7%, 23.6%, 36.2%, 25.5%, 37.1%, 26.1%, 30.0%, 28.6%, 35.6%, 24.0%, 30.1%, respectively.

5. Tunel staining of mouse myocardial tissue

Tissue sections generated after frozen sections of mouse myocardial tissue were attached to slides, which were stored at-80 ℃.

The specific dyeing method is as follows:

after 50% glycerol sealed film under light-shielding conditions, images were collected by means of a ZEN software and the number of positive cardiomyocytes was counted with Image J under observation under a laser confocal microscope (Carl Zeiss, thuringia, germany) (Hoechst excitation wavelength 375nm, corresponding emission wavelength 425nm, indicated by blue light; tunel-FITC excitation wavelength 485nm, emission wavelength 525nm, indicated by green light; cy3 excitation wavelength 550nm, corresponding emission wavelength 570nm, indicated by red light).

As a result, as shown in FIG. 5, a total of 16 heart tissue sections were stained with Tunel, and 16 heart tissue sections were obtained from the above-mentioned 4 groups of mice, each group of 4 mice being obtained from a different individual mouse in the group. Counting the first group of heart tissue sections to obtain Tunel positive cells with the number ratio of 1.361%, 0.861%, 0.916% and 0.767% of the total cells; counting the second group of heart tissue sections to obtain Tunel positive cell number which accounts for 0.856 percent, 0.797 percent, 0.724 percent and 1.023 percent of total cell number; counting the third group of heart tissue sections to obtain the ratio of Tunel positive cells to total cells of 17.336%, 20.208%, 18.348% and 18.289%; and the fourth group of heart tissue sections are counted to obtain the ratio of Tunel positive cells to total cells of 16.769%, 14.679%, 12.925% and 13.216% respectively.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> Shanghai university

<120> a medicament for treating cardiotoxic injury induced by doxorubicin and use thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 54

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

agtcaagtct gaaaagcaat gctcgagcat tgcttttcag acttgacttt tttg 54

<210> 2

<211> 58

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gatcagtcaa gtctgaaaag caatgctcga gcattgcttt tcagacttga cttttttg 58

<210> 3

<211> 58

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aattcaaaaa agtcaagtct gaaaagcaat gctcgagcat tgcttttcag acttgact 58

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

agtcaagtct gaaaagcaat g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

agtcaagtct gaaaagcaat gat 23

<210> 6

<211> 62

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gatcagtcaa gtctgaaaag caatgatctc gagatcattg cttttcagac ttgacttttt 60

tg 62

<210> 7

<211> 61

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aattcaaaaa gtcaagtctg aaaagcaatg atctcgagat cattgctttt cagacttgac 60

t 61

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

agtcaagtct gaaaagcaat g 21

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aagtacgccc cctattgacg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

cacgcccatt gatgtactgc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

gaaggggaga atgagtgccg 20

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gtcaacgtcc cacctcaagg ttc 23

Claims

1. The application of a reagent interfering the expression of circular RNA circ-ZNF609 in myocardial tissue in preparing the medicine for preventing and/or treating the cardiotoxic injury induced by doxorubicin,

when the circular RNA circ-ZNF609 is derived from human sources, the GeneID is: hsa_circ_0000615;

when the circular RNA circ-ZNF609 is derived from a mouse source, the GeneID is: mmu_circ_0001797.

2. The use according to claim 1, wherein the reagent comprises circ-ZNF609shRNA, the nucleotide sequence of which is shown in SEQ ID No. 1.

3. The use according to claim 2, wherein the amplification primer of the circ-ZNF609shRNA comprises an upstream primer F and a downstream primer R, the nucleotide sequence of the upstream primer is shown in SEQ ID No.2, and the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 3.

4. The use according to claim 1, wherein the agent comprises an AAV virally packaged circ-ZNF609shRNA, the nucleotide sequence of the circ-ZNF609shRNA being shown in SEQ ID No. 1.

5. The use of claim 4, wherein the AAV virus is an AAV9 virus.

6. The medicine for treating the doxorubicin-induced cardiotoxic injury is characterized in that the effective components of the medicine comprise circ-ZNF609shRNA packaged by AAV9 virus and pharmaceutically acceptable auxiliary materials, and the nucleotide sequence of the circ-ZNF609shRNA is shown as SEQ ID NO. 1.

7. The medicament according to claim 6, wherein the dosage form of the medicament is an intravenous injection.