CN105194653B - Zinc finger protein 30 7（ZNF307）Application in myocardial hypertrophy is treated - Google Patents

Abstract

The invention discloses a kind of zinc finger protein 30 7 cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviate and/treatment myocardial hypertrophy in application, belong to the application field of gene.Present invention determine that in the model that myocardial hypertrophy occurs, ZNF307 expression compares with normal group and significantly reduces；Suppress ZNF307 expression and significantly promote myocardial hypertrophy, fibrosis, deteriorate heart function, promote ZNF307 to be overexpressed and then significantly suppress myocardial hypertrophy, fibrosis, protect heart function.ZNF307 can be used as drug targets, for screening the medicine of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/treatment myocardial hypertrophy；ZNF307, for designing and preparing the medicine and/or biological reagent of cardioprotection function, resisting cardiac hypertrophy and/or prevention, alleviation and/treatment myocardial hypertrophy, an effective new way can be provided for the treatment of myocardial hypertrophy as the target gene in gene therapy.

Description

Zinc finger protein 30 7（ZNF307）Application in myocardial hypertrophy is treated

Technical field

The invention belongs to the function of gene and application field, more particularly to a kind of zinc finger protein 30 7（ZNF307）Treating Function and application in myocardial hypertrophy, the specifically application in preparing prevention, alleviating and/or treating myocardial hypertrophy medicine.

Background technology

Myocardial hypertrophy（Hypertrophic cardiomyopathy, HCM）It is that cardiac muscle increases to chronic stress or volumetric loading The compensatory response added, it is mainly shown as the features [1-3] such as cardiac muscle cell's volume increases and extracellular matrix increases.Although the heart Flesh plumpness is initially a kind of compensatory mechanism, but the pressure of long duration or volumetric loading can cause decompensation, so as to cause Dilated cardiomyopathy, heart failure even sudden death etc. [4,5].Myocardial hypertrophy has turned into the independence of the angiocardiopathies such as heart failure Hazards, the incidence of disease and case fatality rate of heart failure are considerably increased, it is bigger [5- than harm such as smoking, hypercholesterolemias 7].Research shows with the plump heart such as occurrence and development, myocardial ischemia, ventricular arrhythmia, heart failure, sudden death of heart left chamber The incidence of vascular events adds 6~10 times [6].However, the mechanism of myocardial hypertrophy is not yet completely clearly, it is clinical at present On there is no highly effective prevention and controls.Thus, it is found that the specific molecular and signal path of myocardial hypertrophy are blocked, for entering One step illustrates the occurrence and development mechanism of myocardial hypertrophy, find the drug target of preventing and treating myocardial hypertrophy have it is very important theoretical and Clinical meaning.

Myocardial hypertrophy is the dynamic process that a kind of complicated many factors participate in regulation.At present, the hair about myocardial hypertrophy Life system is not yet completely clearly.Research finds that long-term pressure and/or volumetric loading are excessive, makes the increase of ventricle wall stress, causes Myocardial hypertrophy；Angiotensin II (Ang II), Endothelin (ET), catecholamine, transforming growth factor-β (TGF-β) etc. are each The extracellular stimulus signal of kind can induce the change of gene expression in core, so as to cause cardiac myocyte hypertrophy [7-11]；Cardiac muscle cell's fertilizer When big, its character mutation, volume increase, the change of cardiac muscle cell's contract protein types.The myocardial hypertrophy from molecular level Three links of pathological process point：It is gene transcription activating in the appearance of extracellular plump stimulus signal, intracellular signal transduction and core, most Cell is induced eventually, and loose character mutation occurs.The research of this project team early stage shows that many A signal pathways participate in the mistake of myocardial hypertrophy Journey, wherein, calcineurin calcineurin/NFAT, MAPK (MAPK) and PI3K/ Akt/GSK3 signal betas Signal Transduction Pathways and the downstream transcription factor MCIP1.4 adjusted by this three paths, NF- κ B, AP-1, MEF2 etc. plays an important role [1,2,12-17] in the occurrence and development of myocardial hypertrophy.Calcineurin (calcineurin) it is a kind of multifunctional signal enzyme adjusted by calcium ion and calmodulin (Calmodulin, CaM), can passes through Nuclear factor of activated T cells (nuclear factor of activated T cells, NFAT) indexing is entered core, adjust in core The expression [18,19] of loose gene (ANP, BNP).Prompting calcineurin paths may be by adjusting the work of loose gene Change and induce myocardial hypertrophy.MAPKs is a kind of serine/threonine protein kitase, research show MAPK it is a variety of cause fat it is big because Played an important role in the myocardial hypertrophy reaction of son mediation.MAPK includes three subfamilies [20]：Extracellular signal-regulated kinase (extracellular signal-regulated kinases, ERKs), c-jun N-terminals kinases (c-jun N- Terminal kinases, JNKs) and p38-MAPK.MAPK paths are the cascade reactions of three phosphorylating kinases, with cascade Extracellular signal is amplified and is delivered to intracellular by mode step by step.The MAPKs of phosphorylation can activate it is relevant with myocardial hypertrophy under Transcription factor NF-KB, AP-1, MEF2, NFAT etc. transcriptional activity are swum, and adjusts cytogene transcription and albumen synthesis, Cause cardiac myocyte hypertrophy, cause myocardial hypertrophy.Research shows that 3 kinds of MAPKs are involved in cardiac myocyte hypertrophy reaction, wherein, ERK1/2 activation is to adjust the key factor [20] of cardiac myocyte hypertrophy.PI3K/Akt/GSK3 signal beta Signal Transduction Pathways are cardiac muscles Another important signal path in cellular mast occurrence and development.Research finds that mechanical stimulus caused by pressure load can activate PI3K/Akt/GSK3 signal betas path [26].The important target spot in downstream is activated after the activation of the kinases (PI3K) of phosphoric acid acyl inositol -3 AKT, AKT pass through 3 stream substrates：The activation of rapamycin target body albumen (mTOR) and Glycogen synthesis kinases (GSK3 β) with And FoxO inactivation and increase albumen synthesis, promote transcription factor transposition, adjust loose gene, so as to cause cardiac muscle cell fertile [13,22] greatly.

Zinc finger gene is to occupy significant proportion in human gene, and the albumen of coding is in cell growth, differentiation, development and many Played a significant role in disease [23].Jing Li [24] team identifies and describes a new zinc finger gene, is named as ZNF307, it encodes 545 amino acid, is expressed in a variety of tissues, and have altimeter to reach in brain and heart.ZNF307 eggs A SCAN domain and a KRAB domain are also being included in addition to possessing Zinc finger domain in vain.Tried by luciferase Test analysis and show that ZNF307 has the transcriptional activity for suppressing a variety of factors, including SRF, AP-1, NF- κ B, p53, p21.But its In human diseases, as myocardial hypertrophy pathology generating process in whether have certain effect still unknown.

Bibliography：

1. Li H, He C et al. Regulator of g protein signaling 5 protects against cardiac hypertrophy and fibrosis during biomechanical stress of pressure overload. Proc Natl Acad Sci U S A. 2010;107:13818-13823.

2. Lu J, Bian ZY et al. Interferon regulatory factor 3 is a negative regulator of pathological cardiac hypertrophy. Basic Res Cardiol. 2013;108: 326.

3. Li H, Tang QZ et al. Cellular flice-inhibitory protein protects against cardiac remodeling induced by angiotensin ii in mice. Hypertension. 2010;56:1109-1117.

4. Bui AL, Horwich et al. Epidemiology and risk profile of heart failure. Nat Rev Cardiol. 2011;8:30-41.

5. Diwan A, Dorn GW. Decompensation of cardiac hypertrophy: Cellular mechanisms and novel therapeutic targets. Physiology (Bethesda). 2007;22:56- 64.

6. Zile MR, Gottdiener et al. Prevalence and significance of alterations in cardiac structure and function in patients with heart failure and a preserved ejection fraction. Circulation. 2011;124:2491-2501.

7. Ai D, Pang W et al. Soluble epoxide hydrolase plays an essential role in angiotensin II-induced cardiac hypertrophy. Proc Natl Acad Sci U S A. 2009;106:564-569.

8. Kurdi M, Booz GW et al. New take on the role of angiotensin ii in cardiac hypertrophy and fibrosis. Hypertension. 2011;57:1034-1038.

9. Komati H et al. Zfp260 is an inducer of cardiac hypertrophy and a nuclear mediator of endothelin-1 signaling. J Biol Chem. 2011;286:1508-1516.

10. Ramunddal T, Lindbom M et al. Overexpression of apolipoprotein b attenuates pathologic cardiac remodeling and hypertrophy in response to catecholamines and after myocardial infarction in mice. Scand J Clin Lab Invest. 2012;72:230-236.

11. Koitabashi N, Danner T et al. Pivotal role of cardiomyocyte tgf- beta signaling in the murine pathological response to sustained pressure overload. J Clin Invest. 2011;121:2301-2312.

12. Li HL, Wang AB et al. Isorhapontigenin, a new resveratrol analog, attenuates cardiac hypertrophy via blocking signaling transduction pathways. Free Radic Biol Med. 2005;38:243-257.

13. Yan L, Wei X et al. Cardiac-specific mindin overexpression attenuates cardiac hypertrophy via blocking akt/gsk3beta and tgf-beta1-smad signalling. Cardiovasc Res. 2011;92:85-94.

14. Cai J, Yi FF et al. Crocetin protects against cardiac hypertrophy by blocking mek-erk1/2 signalling pathway. J Cell Mol Med. 2009;13:909-925.

15. Cai J, Yi FF et al. Targeted expression of receptor-associated late transducer inhibits maladaptive hypertrophy via blocking epidermal growth factor receptor signaling. Hypertension. 2009;53:539-548.

16. Bian ZY, Huang H et al. Lim and cysteine-rich domains 1 regulates cardiac hypertrophy by targeting calcineurin/nuclear factor of activated t cells signaling. Hypertension. 2010;55:257-263.

17. Xiao J, Moon M et al. Cellular flice-inhibitory protein protects against cardiac remodelling after myocardial infarction. Basic Res Cardiol. 2012;107:239.

18. Liu Q, Chen Y et al. Interaction between nfkappab and nfat coordinates cardiac hypertrophy and pathological remodeling. Circ Res. 2012; 110:1077-1086.

19. Wilkins BJ, Dai YS et al. Calcineurin/nfat coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004; 94:110-118.

20. Rose BA, Force T et al. Mitogen-activated protein kinase signaling in the heart: Angels versus demons in a heart-breaking tale. Physiol Rev. 2010;90:1507-1546.

21. Hua Y, Zhang Y et al. Chronic akt activation accentuates aging- induced cardiac hypertrophy and myocardial contractile dysfunction:

Role of autophagy. Basic Res Cardiol. 2011;106:1173-1191.

22. Ronnebaum SM, Patterson C. The foxo family in cardiac function and dysfunction. Annu Rev Physiol. 2010;72:81-94.

23. Klug, A. and Schwabe, J. W. R. (1995) Protein motifs 5. Zinc fingers. FASEB J. 9 (8), 597-604

24. Li J, Wang Y et al. ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway. Biochem Biophys Res Commun. 2007 Nov 30;363(4):895-900. Epub 2007 Sep 10。

The content of the invention

For solve above-mentioned prior art the defects of and deficiency, primary and foremost purpose of the invention be determine ZNF307 expression and The correlation of myocardial hypertrophy, there is provided a kind of ZNF307 is as drug targets in screening cardioprotection function, anti-cardiac fibrosis And/or the application in the medicine of prevention, alleviation and/treatment myocardial hypertrophy.

The purpose of the present invention is achieved through the following technical solutions：

The present invention is first by testing the relation for determining that ZNF307 is expressed between myocardial hypertrophy：

Cardiac myocyte hypertrophy mark ANP, Myh7 expression are substantially raised when myocardial hypertrophy the 1st, occurs, ZNF307 expression Obvious up-regulation

The present invention selects normal person and dilated cardiomyopathy heart respectively, normal sham-operation mouse and passes through sustainer Bow constriction operation causes the mouse heart of myocardial hypertrophy, have detected ANP, Myh7, ZNF307 protein expression situation respectively.As a result Show, mouse heart cardiac myocyte hypertrophy mark ANP, Myh7 of dilated cardiomyopathy and generation myocardial hypertrophy table Up to obvious up-regulation, ZNF307 expression is also substantially raised（Fig. 1）.

2nd, ZNF307 is disturbed（Adsh ZNF307）And it is overexpressed（Ad ZNF307）Adenovirus is to the heart that is induced through Ang II The influence of myocyte hypertrophy model

Present invention discover that in menses angiotensin II（Ang II）In the external myocardial hypertrophy model of induction, ZNF307 crosses table Hypertrophy up to cardiac muscle cell is obvious suppressed, and it is obvious loose that ZNF307 does not express cardiac muscle cell's appearance（Fig. 2）.

3rd, ZNF307 gene knockouts significantly promote myocardial hypertrophy, fibrosis, deteriorate heart function

The present invention is tested from wild-type mice, ZNF307 knock out mice, and every kind of mouse is divided into and done evil through another person Art group and operation group, every group of 10 mouse.Operation group gives aorta arch constriction operation, and sham-operation group refuses arch of aorta contracting It is narrow, then by carrying out the measure of plump cardiac myocytes, fibrosis and heart function to each group mouse of sham-operation group and operation group, The influence for the myocardial hypertrophy that research ZNF307 gene knockouts are induced aorta arch constriction.As a result show to knock out ZNF307 genes institute The ZNF307 defects of cause significantly deteriorate myocardial hypertrophy, fibrosis and heart function (Fig. 3, Fig. 4, Fig. 5, Fig. 9).

4th, ZNF307 gene overexpressions significantly suppress myocardial hypertrophy and its fibrosis, improve heart function

The present invention is tested from heartspecific ZNF307 transgenic mices and nontransgenic mice, and will be every kind of small Mouse is divided into sham-operation group and operation group, every group of 10 mouse.Operation group gives aorta arch constriction operation, and sham-operation group is not led Arch of aorta constriction, then by carrying out plump cardiac myocytes, fibrosis and heart work(to each group mouse of sham-operation group and operation group The measure of energy, the influence for the myocardial hypertrophy that research ZNF307 gene overexpressions are induced aorta arch constriction.As a result table was shown Myocardial hypertrophy and fibrosis, protection heart function (Fig. 6, Fig. 7, Fig. 8, Figure 10) are significantly inhibited up to ZNF307 genes.

Understood by result above in the model that myocardial hypertrophy occurs, notable liter is compared in ZNF307 expression with normal group It is high；Suppress ZNF307 expression and significantly promote myocardial hypertrophy, fibrosis, deteriorate heart function；ZNF307 is promoted to be overexpressed then notable Myocardial hypertrophy, fibrosis are inhibited, protects heart function.ZNF307 is the inhibiting factor after myocardial hypertrophy disease produces.Therefore ZNF307 has the function that to protect heart function and suppress myocardial hypertrophy and fibrosis, particularly ZNF307 that the arch of aorta can be suppressed The effect that myocardial hypertrophy relevant disease caused by constriction occurs.

For ZNF307 above-mentioned function, there is provided a kind of ZNF307 application, be mainly reflected in that ZNF307 is preparing protection Applied in the medicine of cardiac function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy.

A kind of medicine of cardioprotection function, includes ZNF307.

A kind of medicine of anti-cardiac fibrosis, includes ZNF307.

The medicine of a kind of prevention, alleviation and/treatment myocardial hypertrophy, includes ZNF307.

The present invention is had the following advantages relative to prior art and effect：

（1）Present invention discover that the New function of ZNF307 genes, i.e. ZNF307 genes have being capable of cardioprotection function, the anti-heart Dirty fibrosis and the effect for suppressing myocardial hypertrophy.

（2）Effect based on ZNF307 in cardioprotection function, anti-cardiac fibrosis and suppression myocardial hypertrophy disease, its It can be used for preparing cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or the medicine for treating myocardial hypertrophy.

Brief description of the drawings

Fig. 1 is the protein expression figure of ANP, Myh7, ZNF307 in normal person and dilated cardiomyopathy patients heart；

A is normal person and the expression figure for expanding ANP, Myh7, ZNF307 in worry Mutation of Patients with Cardiomyopathy heart；

Mutation of Patients with Cardiomyopathy heart ZNF307 up-regulated expression (*：p＜ 0.05vs normal persons group).

B is mouse in sham-operation（Sham）Performed the operation with aorta arch constriction（AB）ANP, Myh7, ZNF307 in heart afterwards Expression figure；

Illustrate the up-regulated expression that the heart ZNF307 of myocardial hypertrophy occurs, GAPDH is as internal reference；Wherein 4W expressions 4 weeks, 8W Represent 8 weeks（*：pThe vs wild-type mice Sham groups of ＜ 0.05）.

Fig. 2 is SD suckling mouse primary cardiomyocytes adenovirus AdshRNA, Adsh ZNF307, Ad-GFP and Ad ZNF307 Infection, through the post-stimulatory immunofluorescence figures of Ang II；

As a result show that ZNF307 interference adenovirus promotes cardiac myocyte hypertrophy, ZNF307 overexpression adenovirus suppresses the heart Myocyte hypertrophy (*：p＜ 0.05vs PBS groups, #：p II group of ＜ 0.05vs Ang).

Fig. 3 is wild-type mice（WT）With ZNF307 knock out mice（ZNF307-KO）AB models HW/BW after 4 weeks, LW/BW and HW/TL statistics block diagram；

Wherein HW：Cardiac mass；BW：Body weight；LW：Lungs total amount；TL：Tibia length（*：pThe vs wild types of ＜ 0.05 Sham groups, #：pThe vs wild type AB groups of ＜ 0.05）.

Fig. 4 is wild-type mice（WT）With ZNF307 knock out mice（ZNF307-KO）AB models heart tissue after 4 weeks HE dyeing, WGA dyeing and cardiomyocytes cross-sectional area statistics block diagram（*：pThe vs wild type Sham groups of ＜ 0.05, #p＜ 0.05 Vs wild type AB groups）.

Fig. 5 is wild-type mice（WT）With ZNF307 knock out mice（ZNF307-KO）AB models heart tissue after 4 weeks Sirius red stains and left room area of collagen statistics block diagram（*：pThe vs wild type Sham groups of ＜ 0.05, #：pThe vs of ＜ 0.05 are wild Raw type AB groups）.

Fig. 6 is NTG and TG mouse AB models HW/BW, LW/BW and HW/TL after 4 weeks statistics block diagram（*：p＜ 0.05 Vs NTG Sham groups, #：pThe vs NTG AB groups of ＜ 0.05）.

Fig. 7 is that heart tissue HE is dyed NTG and TG mouse AB models after 4 weeks, WGA dyeing and cardiomyocytes cross-sectional area are united Count block diagram（*：pThe vs NTG Sham groups of ＜ 0.05, #：pThe vs NTG AB groups of ＜ 0.05）.

Fig. 8 be NTG and TG mouse AB models after 4 weeks heart tissue sirius red stains and left room area of collagen statistics column Figure（*：pThe vs NTG Sham groups of ＜ 0.05, #：pThe vs NTG AB groups of ＜ 0.05）.

Fig. 9 be WT and ZNF307-KO mouse AB models after 4 weeks ultrasound detection heart function result count block diagram；

Wherein, LVEDd is LVED, LVESd is left room end systolic diameter, FS is shortening fraction （*：pThe vs wild type Sham groups of ＜ 0.05, #：pThe vs wild type AB groups of ＜ 0.05）.

Figure 10 be NTG and TG mouse AB models after 4 weeks ultrasound detection heart function result count block diagram；

Wherein, LVEDd is LVED, LVESd is left room end systolic diameter, FS is shortening fraction （*：pThe vs NTG Sham groups of ＜ 0.05, #：pThe vs NTG AB groups of ＜ 0.05）.

Embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The implementation provided Example is only explanation to the inventive method, remaining content without limiting the invention in any way announcement.

The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as《Molecular cloning：It is real Test room guide》3rd edition（New York:Cold Spring Harbor laboratory Press, 2005) bar described in Part is carried out.

Animal for research and raising

Experimental animal：From 8-10 week old, body weight in 23.5-27.5g, background is male C57BL/6 wild-type mice （Name WT）, ZNF307 knock out mice（ZNF307-KO）, heartspecific ZNF307 transgenic mices（TG）And non-turn base Because of mouse（NTG, littermate control nontransgenic mice）For experimental subjects.

The structure of systemic ZNF307 knock out mice：

We utilize the systemic ZNF307 knock out mice of CRISPR-Cas9 technique constructions.First, by online CRISPR design tools（http://crispr.mit.edu）Predict mouse ZNF307 homing sequence.Then primer is passed through (oligo1:TAGGCTCAGCGCCTGCCGGGGTC and oligo2:AAACGACCCCGGCAGGCGCTGAG related sequence) is cloned Arrange and insert in Puc57-sgRNA expression vectors（Addgene5132）.Primer containing T7 promoters and homing sequence RNA leads to PCR is crossed to be expanded（Forward primer: GATCCCTAATACGACTCACTATAG Reverse primer: AAAAAAAGCACCGACTCGGT）.Then use MEGAshortscript Kit (Amibion, AM1354) and MiRNeasy Micro Kit (Qiaen, 217084) are transcribed and are purified homing sequence RNA.Cas9 plasmids（Addgene 44758）Pass through T7 Ultra kit（Ambion, Am1345）Transcribed.Cas9 and homing sequence RNA mRNA pass through The micro-injection systems of FemtoJet 5247 are injected into unicellular embryonated egg.F1 generation and F2 are identified for mouse by PCR （Primers F (5’- GCTAGAGAACCCGGAACGTC-3’) and R (5’- GCTGCCTGTCCAAGTACTC-3’)）. Wild-type mice includes 394 bp one section long DNA sequence dna, and mutant mice contains 393 bp DNA sequence dna.Final albumen production Thing carries out Testing and appraisal by western blot.

The structure of heartspecific ZNF307 transgenic mices：

Use primer（Sense primer：TGCTCTAGAGCCACCATGGCTAGAGAACCCGGAA；Anti-sense primer： TGCTCTAGACTACAGATCACTGTGAGACAAT）Mouse ZNF307 full-length genes are expanded, the ZNF307 full-length genes of amplification （NCBI, GENE ID: 544922）After being connected to the pCAG-loxP-CAT- loxP plasmids of our structures, pCAG- is formed LoxP-CAT-loxP-ZNF307-hGHpA carriers (CAG (chicken beta-actin)-CAT (chloramphenicol Acetyltransferase)-ZNF307-hGHpA), the plasmid of structure is configured to fertilized embryo by microinjection （C57BL/6J backgrounds）, by obtained mouse and α-MHC-Cre mouse hybrids, and induced by TAM（TAM 80mg/KG/ days, intraperitoneal injection, continued stimulus 5 days）Obtain heartspecific ZNF307 transgenic mouses.Thereafter through Western blot identify protein expression situation.

Feeding environment：All experiment mices are raised in SPF level Experimental Animal Centers, and the big mouse feed of SRF levels is purchased from north Capital Fukang bio tech ltd.Rearing conditions：Room temperature is between 22-24 DEG C, and humidity is between 40-70%, light and shade alternating Lighting hours is 12h, and free water is ingested.

【Embodiment 1】Expression of the ZNF307 in normal person and Mutation of Patients with Cardiomyopathy heart

From Normal Human Heart（The dead individual contributed of non-cardiac reason）, dilated cardiomyopathy heart（Do the heart The acceptor of dirty transfer operation patient displacement, DCM）, SDS-PAGE- western blot tests are carried out to heart extraction protein （Western blot）, binding specificity knows ZNF307 albumen and cardiac myocyte hypertrophy mark ANP（Millipore, AB2232）、Myh7（Santa cruz, sc53090）Antibody detected, determine its ZNF307（It is unknown）Expression, GAPDH （Bioworld Technology, MB001）Do internal reference.Testing result is as shown in figure 1, in dilated cardiomyopathy heart Cardiac myocyte hypertrophy mark ANP, Myh7 expression are substantially raised, and ZNF307 expression is also substantially raised（Figure 1A）.

【Embodiment 2】Expression of the ZNF307 in wild-type mice Sham groups and AB operation 4W, 8W hearts

1. myocardial hypertrophy model is performed the operation using aorta arch constriction, model manipulation flow：

1.1 Preoperative Method

（1）Anesthesia：First weighed to mouse, according to anaesthetic needed for the calculating of 90mg/kg body weight（3% yellow Jackets）Amount, passes through Intraperitoneal injection, and record injection time point.Press from both sides tail, folder toe without significant reaction and mouse it is in good condition for anesthesia Success criteria（One As injection after about 10min without significant reaction, have reaction with the small mousetrap toes of about 50min after anesthesia, 30min or so is optimal after anesthesia Operating time）.

（2）Art area prepares：By the left chest of mouse, left side chest and the skin unhairing of left fore oxter.With wet yarn after shaving Cloth wipes art area and removes deratization hair, is advisable with not influenceing surgical field of view.

（3）Trachea cannula：The upper front tooth of mouse is fixed on V shaped slab inclined-plane with rubber band, and rapidly passed through trachea cannula Glottis is properly inserted tracheal strips, and subsequent right lateral position is placed on heating cushion（Heating cushion need to preheat in advance）, then by trachea cannula It is connected with lung ventilator, fixed mouse.If the thorax fluctuating of mouse is consistent with breathing unit frequency, illustrate trachea cannula success.

1.2 aorta arch constriction arts

Right lateral position is taken, and mouse left fore is placed in above right fore, and two forelimbs is fixed with medical adhesive tape.Under right chest Side is encased inside cotton swab, raises thorax, is successively that 75% alcohol sterilizes to operation area skin with the tincture of iodine and volume fraction.Left hand holds eye Section's tweezer has pinched left skin of chest, and the right hand holds eye scissors and cuts off skin about 1cm, successively separating muscle and soft tissue, in 2-3 ribs Horizontal opening thoracic cavity, slightly push left lung aside with cotton swab, dissociate arch of aorta descending branch, and 7-0 sutures are passed through into blood vessel, and in blood vessel Top is placed in parallel one section of 26G（25.0-27.5g mouse）Or 27G（23.5-25.0g）Syringe needle, by blood vessel and syringe needle Ligature together, then extract the Vasoconstriction that syringe needle can reach respective degrees out.Sutured successively after ligation, close thoracic cavity, Thoracic cavity is inserted at sealing with syringe and extract 1cc gases out to recover negative pressure in thoracic cavity, extract rapid suture skin after syringe Skin otch.Sham-operation group（Sham）Only threading does not ligature after the descending aorta that dissociates, the same myocardial hypertrophy of remaining step（AB） Model group.

1.3 postoperative care

After arch of aorta descending branch ligation, treat that autonomous respiration occurs in mouse, kickback occurs in folder toe, extract tracheae and insert Pipe, and mouse is put into the rearging cage of the bedding and padding crossed equipped with autoclaving, feed and drinking water, continue raising in receptacle and see Examine.

2. materials：

Assay balance is opened, zeroing is standby.It is re-weighed and puts to death mouse.The vessel pedicle that the curved tweezer of ophthalmology is lived below auricle, cuts Lower heart, is immediately placed on sterile gauze, gently extrudes heart intracavity liquid, after dipping in dry surface liquid, weighs and record, by heart It is put into corresponding cryopreservation tube, is immediately placed in liquid nitrogen container, is used for molecular Biological Detection after -80 DEG C of refrigerators preserve.

3. expression of the ZNF307 in Sham mouse and AB mouse hearts：

Wild type Sham mouse and AB the Post operations heart of 4 weeks and 8 weeks are selected respectively, and SDS- is carried out to heart extraction protein PAGE- western blot tests（Western blot）, binding specificity identification ZNF307 albumen and cardiac myocyte hypertrophy mark ANP, Myh7 antibody are detected, and determine its ZNF307 expression, testing result is as shown in Figure 1B.As shown in Figure 1B, it is myocardium Expression of the cellular mast mark in AB postoperative ANP, Myh7 is substantially raised, and ZNF307 expression is in the postoperative obvious up-regulations of AB.

【Embodiment 3】ZNF307 is disturbed（Adsh ZNF307）And it is overexpressed（Ad ZNF307）Adenovirus is stimulated Ang II Primary cardiomyocytes ZNF307 expression influence

1. primary newborn SD rat myocardial cells culture

Newborn 1 day Sprague-Dawley neonatal rat myocardial cell is separately cultured, liquid is changed after culture primary cardiomyocytes 48h.

2. ZNF307 is disturbed（Adsh ZNF307）And it is overexpressed（Ad ZNF307）Adenovirus is to the heart that is induced through Ang II The influence of myocyte hypertrophy model

AdshRNA（Adenovirus containing shRNA (silence RNA), as control）、Adsh ZNF307（Containing shRNA- ZNF307 (silence RNA- ZNF307 fusion proteins) adenovirus）、AdGFP（Adenopathy containing GFP (green fluorescent protein) Poison, as control）And Ad ZNF307（Green fluorescent protein-the ZNF307 of ZNF307 containing GFP- fusion proteins) adenovirus） The MOIs of adenovirus 10 infects the primary cardiomyocytes of culture 3 days respectively, with 1 μM of Angiotensin II after 12 hours（Ang II）（Purchased from Sigma companies, A9525）Or control PBS is stimulated 48 hours, then carries out immunofluorescent test.As a result Adsh is shown Myocardial cell surface area after ZNF307 adenovirus infections increases compared with AdshRNA control groups, and the heart infected through Ad ZNF307 Myocyte's surface area then significantly reduces than control group AdGFP（Fig. 2）.

【Embodiment 4】Mouse cardiac muscle is plump（AB）Model myocardial hypertrophy and fibrosis detection

1. myocardial hypertrophy model is performed the operation using aorta arch constriction, model manipulation flow：

From 8-10 week old, body weight 23.5-27.5g wild-type mice, ZNF307 knock out mice, specific heart Property ZNF307 transgenic mices and nontransgenic mice are respectively divided into sham-operation group and myocardial hypertrophy model group, every group of 10 mouse. Modeling method is the same as embodiment 2.

2. materials

（1）Previous work：Prepare the urine cup of the formaldehyde of volume fraction 10% equipped with 20mL in advance, and post label（Mouse is compiled Number, group, type of surgery and materials the date）.The culture dish for filling the KCl solution of mass fraction 10% is placed at materials.Open Assay balance, zeroing are standby.It is re-weighed and puts to death mouse.

（2）Materials：The vessel pedicle that the curved tweezer of ophthalmology is lived below auricle, cuts heart, is immediately placed in the KCl of mass fraction 10% In solution.After cardiac arrest after diastole, it is placed on sterile gauze, gently extrudes heart intracavity liquid, after dipping in dry surface liquid, Weigh and record, heart is put into corresponding urine cup, being used for pathology after fixed 48h detects.

（3）Measurement of correlation and calculating：Mouse lung is taken out, filter paper blots after trimming, weighs and records.Cut off mouse hind leg Skin at shin bone, measure and record tibia length.Calculate heart weight and the ratio of body weight（HW/BW）, the heavy ratio with body weight of lung （LW/BW）And the ratio of heart weight and tibia length（HW/TL）.

3. pathology detect

3.1 prepare paraffin specimen section

Primary operational program includes trimming heart → embedding frame processing → flowing water flushing → dehydration → transparent → waxdip → bag Bury → section → spread out it is standby after piece → dry or toast.

3.2 hematoxylin-eosin（HE）Dyeing

Mainly comprise the following steps：55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% alcohol 1min → 95% alcohol 1min → 70% alcohol 1min → distilled water 1min → haematoxylin solution（Zhuhai shellfish rope, BA-4021）The hydrochloric acid wine of 5min → washing 1min → 1% Essence（3mL concentrated hydrochloric acids are taken to be sufficiently mixed uniformly with the alcohol of 297mL 70%）1-3s → washing 1min → Scott liquid（Sodium acid carbonate 0.35g, epsom salt 2g, both are dissolved in 100mL distilled water）1min → washing 1min → Yihong solution（Zhuhai shellfish rope, BA- 4024）3-5min → distilled water washes away the alcohol of the alcohol 1s of the alcohol 1s of loose colour → 70% → 95% → 100% 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of the interior drying of the not dry mounting → fume hood immediately of dimethylbenzene, microscope is taken pictures.

HE dyeing picture statistics：More than 3 clear borders are selected per pictures, the approximately centrally located cell of core, are used The software circle cell areas of Image-Pro Plus 6.0.

3.3 WGA（WGA）Dyeing

Mainly comprise the following steps：First section dewaxing, then use trypsase（DIG-3008, Foochow step new）Antigen retrieval is carried out, after With WGA-AF488（1mg/ml, W11261, Invitrogen）Dyeing, last mounting medium mounting（DAPI is included in mounting medium, directly Connect dye core）, microscope takes pictures.

3.4 Picro-Sirius red（PSR）Dyeing

Mainly comprise the following steps：55 DEG C of baking 30min → dimethylbenzene 2min, 3 times → 100% alcohol 1min → 95% alcohol 1min → 70% alcohol 1min → flowing water rinses the sirius red of 10min → phosphomolybdic acid 2min of distilled water 1min → mass fraction 0.2% → 0.1% Picric acid solution drips dyes the alcohol 1 time → 90% of 90min → go residul liquid-removing → 0.01N hydrochloric acid 4s → 70% in tissue, wet box The alcohol 30s of alcohol 1 time → 100%, 3 times → dimethylbenzene 2min, 3 times → take advantage of the not dry cover glass mounting immediately of dimethylbenzene, microscope is clapped According to.

PSR dyeing picture statistics（The softwares of Image-Pro Plus 6.0）：Collagen ratio=area of collagen/（The gross area-sky Fine flour accumulates）× 100%.

Cardiac muscular tissue is made up of cardiac muscle cell and interstitial tissue, and heart is a terminal differentiation organ, and cardiac muscle cell loses increasing Grow ability, caused by various physiology or pathological stimuli cardiac muscle cell react, can only be individual cells volume increase and can not Quantitatively breed.Therefore, in the pathophysiological process of myocardial hypertrophy, it is mainly shown as that cardiac muscle cell's volume increases, muscle segment Increasing number, cell arrangement is disorderly, and cardiac mesenchymal changes propagation and the conversion for including Cardiac Fibroblasts, collagenous fibres density Increase, collagen secretion increase, the imbalance of collagen proportional balancing method etc..

Phenotypic results after WT and ZNF307-KO mouse AB models are shown in Fig. 3-5.Sham（Sham-operation）In group WT mouse and Difference between HW/BW, LW/BW and HW/TL of ZNF307-KO mouse is not statistically significant；Postoperative 4 weeks of WT mouse AB's HW/BW, LW/BW, HW/TL are higher than its Sham group；Postoperative 4 weeks of AB, HW/BW, LW/BW and HW/TL of ZNF307-KO mouse compared with WT mouse raise（Fig. 3）.HE is dyed and WGA stained slices can be observed：Sham group heart no significant differences, AB groups are compared with Sham groups Heart increase, the heart of ZNF307-KO mouse is significantly greater than WT group mouse；The myocardium muscle fibril cell arrangement of Sham groups is whole Together, fine and close, form is complete, and karyon and nucleolar structure are clear；AB group myofilaments arrangement disorder, loose, cardiac muscle cell's volume substantially increases Greatly, form is irregular, and born of the same parents' nuclear hyperchromatism, increase, deformity, kernel obscure, and ZNF307-KO groups are obvious compared with WT group cellular masts, difference It is statistically significant（Fig. 4）.After PSR dyeing, find AB groups myocardium of ventricle interstitial collagen content compared with the increase of Sham groups, arteries Surrounding collagen increase becomes apparent, collagen thickening, and arrangement disorder is into network-like；The postoperative collagen contents of ZNF307-KO mouse AB and Then increase more postoperative than WT mouse AB is obvious for perivascular collagen content（Fig. 5）.It these results suggest that after AB models, mouse occurs Obvious myocardial hypertrophy, the myocardial hypertrophy and fibrosis of ZNF307-KO mouse are more than WT mouse.

Fig. 6-8 is the phenotypic results after NTG and ZNF307-TG mouse AB models.The same TG mouse AB HW/ of postoperative 4 weeks BW, LW/BW and HW/TL are higher than its Sham group；The degree of HW/BW, LW/BW and HW/TL increase of the postoperative 4 weeks TG mouse of AB is obvious Less than NTG mouse（Fig. 6）.Cardiac phenotype, AB groups increase compared with the heart of Sham groups, and the journey of the postoperative TG mouse hearts increases of AB Degree is less than NTG mouse.HE is dyed and WGA stained slices can be observed：TG mouse AB postoperative myocardials cell cross section product is more than Sham groups, significantly less than NTG mouse AB groups（Fig. 7）.PSR dyes visible, TG mouse AB postoperative myocardial interstitial collagen contents and blood Collagen content is less than NTG mouse AB groups around pipe（Fig. 8）.It these results suggest that after AB models, obvious cardiac muscle occurs for mouse Plumpness, the myocardial hypertrophy and fibrosis of ZNF307-TG mouse are less than NTG mouse.

【Embodiment 5】Myocardial hypertrophy（AB）Model mice heart function detects

1 ultrasound detection heart function

1.1 early-stage preparations

（1）Anesthesia machine prepares：The intake interface on oxygen cylinder and Anesthesia machine is first connected, then to turn on dosing mouth on Anesthesia machine close Capping, closure is tightened after being rapidly added isoflurane to safe scale.Total valve on oxygen cylinder is turned on, adjusts flow control valve Knob, outlet pressure maintain 0.2-0.3mPa.

（2）Mouse to be measured prepares：After mouse to be detected is anaesthetized rapidly with isoflurane, left anterior pectorial region shaving, by what is handled well Mouse head is stretched into anesthetic conduit pullover, and the stable narcosis of mouse is maintained with 1.5-2.0% isofluranes.

1.2 heart functions detect

Mouse takes left lateral position or dorsal position, and uniformly smears ultrasonic coupling agent in shaving area（Tianjin Cheng Xin companies）.Adopt With high-frequency ultrasound in diagnosis instrument, frequency 15MHz, selection standard papillary muscles of left ventricle short axis view, measure, in left room diastasis Footpath（LVEDD）, left room end systolic diameter（LVESD）And shortening fraction（FS）.

Fig. 9 is heart function testing result figure after WT and ZNF307-KO mouse AB models.Compared with WT Sham groups, WT mouse AB shows decreased cardiac function and myocardial hypertrophy in postoperative 4 weeks, is mainly shown as that index LVEDD, LVESD of myocardial hypertrophy is different The increase of degree, and reflect the index FS of heart function and then decline.Postoperative 4 weeks of AB, the plump index of ZNF307-KO mouse cardiac muscles increase Big degree and the degree for the index decline for reflecting heart function are more than WT mouse（Fig. 9）.These results with ZNF307-KO mouse The more result of myocardial hypertrophy is consistent.

Figure 10 is the ultrasound and PV testing results after NTG and ZNF307-TG mouse AB models.Postoperative 4 weeks of AB is small with NTG Mouse is compared, and the degree that the degree of the plump index increase of TG mouse cardiac muscles and the index of reflection heart function decline then is less than NTG groups （Figure 10）.

From result above, in myocardial hypertrophy disease model caused by aorta arch constriction, ZNF307 gene defects Myocardial hypertrophy, fibrosis are significantly promoted, deteriorates heart function, ZNF307 gene overexpressions significantly suppress myocardial hypertrophy, fiber Change, protect heart function.Therefore ZNF307 genes have the function that to protect heart function and suppress myocardial hypertrophy and fibrosis, particularly ZNF307 genes can suppress the effect that myocardial hypertrophy relevant disease caused by aorta arch constriction occurs.

Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>Zinc finger protein 30 7（ZNF307）Application in myocardial hypertrophy is treated

<130> 1

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> DNA

<213> Artificial

<223>The structure sense primer of systemic ZNF307 knock out mice

<400> 1

taggctcagc gcctgccggg gtc 23

<210> 2

<211> 23

<212> DNA

<213> Artificial

<223>The structure anti-sense primer of systemic ZNF307 knock out mice

<400> 2

aaacgacccc ggcaggcgct gag 23

<210> 3

<211> 24

<212> DNA

<213> Artificial

<223>The sense primer of T7 promoters and homing sequence RNA

<400> 3

gatccctaat acgactcact atag 24

<210> 4

<211> 20

<212> DNA

<213> Artificial

<223>Anti-sense primer containing T7 promoters and homing sequence RNA

<400> 4

aaaaaaagca ccgactcggt 20

<210> 5

<211> 20

<212> DNA

<213> Artificial

<223>Systemic ZNF307 knock out mice PCR identifies sense primer

<400> 5

gctagagaac ccggaacgtc 20

<210> 6

<211> 19

<212> DNA

<213> Artificial

<223>Systemic ZNF307 knock out mice PCR identifies anti-sense primer

<400> 6

gctgcctgtc caagtactc 19

<210> 7

<211> 34

<212> DNA

<213> Artificial

<223>Mouse ZNF307 full-length genes expand sense primer

<400> 7

tgctctagag ccaccatggc tagagaaccc ggaa 34

<210> 8

<211> 31

<212> DNA

<213> Artificial

<223>Mouse ZNF307 full-length genes expand anti-sense primer

<400> 8

tgctctagac tacagatcac tgtgagacaa t 31

Claims (3)

1. the gene of zinc finger protein 30 7 is screening anti-cardiac fibrosis and/or prevention, the alleviation and/or treatment heart as drug targets Application in the plump medicine of flesh, described application is non-diagnostic and non-treatment purpose.

2. the gene of zinc finger protein 30 7 according to claim 1 is screening anti-cardiac fibrosis and/or pre- as drug targets Application in the medicine of anti-, alleviation and/or treatment myocardial hypertrophy, it is characterised in that：Described medicine, it is to refer to promote zinc finger The medicine of the gene expression of albumen 307.

3. zinc finger protein 30 7 is in preparing anti-cardiac fibrosis and/or prevention, alleviation and/or treating the medicine of myocardial hypertrophy Using.