CN105148259B - Dual specificity phosphatase enzyme 12(DUSP12) treating function and application in myocardial hypertrophy - Google Patents

Abstract

The invention discloses a kind of dual specificity phosphatase enzyme 12(DUSP12) function and application in myocardial hypertrophy are being treated, belong to the function and application field of gene.Present invention determine that the correlation between the expression and myocardial hypertrophy of DUSP12, result of study shows in the model that myocardial hypertrophy occurs, and the expression of DUSP12 and normally organizes and compares significant decrease；Inhibit DUSP12 expression to significantly promote myocardial hypertrophy, fibrosis, deteriorate heart function, promotes DUSP12 overexpression then to significantly suppress myocardial hypertrophy, fibrosis, protect heart function.Therefore; DUSP12 can be used as target gene; for screening cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or the drug for treating myocardial hypertrophy; it is used to prepare cardioprotection function, resisting cardiac hypertrophy and/or prevention, alleviation and/or the drug for treating myocardial hypertrophy, provides an effective new way for the treatment of myocardial hypertrophy.

Description

Dual specificity phosphatase enzyme 12(DUSP12) treating function and application in myocardial hypertrophy

Technical field

The invention belongs to the function of gene and application field, in particular to a kind of dual specificity phosphatase enzyme 12(DUSP12) Treat the function and application in myocardial hypertrophy.

Background technique

Myocardial hypertrophy is cardiac muscle to chronobiological mechanical pressure or the increased compensatory response of volumetric loading, is common in high blood The cardiovascular diseases such as pressure, aortic stenosis are mainly shown as that cardiac muscle cell's volume increases, albumen synthesis increases, extracellularly Matrix such as increases at the features [1-3].Hypertension, Senile degenerative aortic valve disease are in rise year by year trend in China.By high blood Myocardial hypertrophy caused by the diseases such as pressure, hypertensive heart disease disease incidence are consequently increased.Although myocardial hypertrophy can initially make the heart Myocyte increases, and myocardial contractive power is reinforced, and is a kind of compensatory mechanism for maintaining normal cardiac output, but the pressure of long duration Or volumetric loading is overweight, can cause myocardial remodelling, simultaneously because myocardium requirementing keto quantity increases, and coronary artery blood supply relative deficiency, Cause myocardial ischemia, cardiac muscle cell apoptosis, and then lead to decompensation, so as to cause heart failure, malignant arrhythmia, even sudden It waits indefinitely [4,5].Research shows that with the occurrence and development of heart left chamber plumpness, myocardial ischemia, ventricular arrhythmia, heart failure, The incidence of the cardiovascular events such as sudden death increases 6~10 times [6].

It is now recognized that myocardial hypertrophy is the complicated dynamic process that one kind of multiple factors participate in adjusting.Research finds long-term Biomethanics pressure and/or volumetric loading are excessive, increase ventricle wall stress, lead to myocardial hypertrophy.In addition, Angiotensin II The various extracellular stimulus signals such as (Ang II), Endothelin (ET), catecholamine, transforming growth factor-β (TGF-β) can induce core The change of interior gene expression, so as to cause cardiac myocyte hypertrophy [7-11].The pathological process of myocardial hypertrophy from molecular level Point three links: it is gene transcription activating in the appearance of extracellular plumpness stimulus signal, intracellular signal transduction and core, finally induce cell Loose character mutation occurs.Research at present has shown that many A signal pathways participate in the process of myocardial hypertrophy.Wherein, calcium tune nerve Phosphatase calcineurin/NFAT, mitogen-activated protein kinase (MAPK) and PI3K/Akt/GSK3 signal beta Signal Transduction Pathways with And by this three accesses downstream transcription factor MCIP1.4 adjusted, NF- κ B, AP-1, MEF2, mTOR etc. in myocardial hypertrophy Play an important role [1,2,12-17] in occurrence and development.Calcineurin (calcineurin) be it is a kind of by calcium ion and The multifunctional signal enzyme that calmodulin is adjusted, can be by making nuclear factor of activated T cells (nuclear factor of activated T cells, NFAT) indexing enters core, adjust the expression [18,19] of loose gene (ANP, BNP) in core.MAPK includes three sub- families Race [20]: ERKs, JNKs and p38-MAPK.The MAPKs activation of phosphorylation promotes downstream transcription factor related with myocardial hypertrophy The transcriptional activity of NF- κ B, AP-1, MEF2, NFAT etc., and cytogene transcription and albumen synthesis are adjusted, cause cardiac muscle cell fertile Greatly, lead to myocardial hypertrophy [20].

Dual specificity phosphatase enzyme 12(DUSP12), it is one of the atypia DUSP family member of discovery in 1999, gene It is positioned at No. 1 chromosome long arm, encodes the protein containing 340 amino acid, DUSP12 albumen is in adult each main organs There is expression, wherein expressing highest in pancreas, brain, lungs, there is the expression [21] of moderate in heart.Its cell is default Position is still disputable at present, can be respectively positioned in cytoplasm or nucleus in different cell or tissues.At present about The correlative study of DUSP12 is still less, be concentrated mainly on its on glycometabolism and the relationship of cell death.In liver cell, DUSP12 can be by activating glucokinase dephosphorylation, to promote the aerobic oxidation [22] of glycolysis and sugar.Yeast, In Hela cell, HEK293 cell, it has been found that it can inhibit cell death caused by various stimulations, but not have to the proliferation of cell Have an impact [23].In addition DUSP12 can make yeast MAPK pathway protein SLT2 dephosphorylation inactivate [24] in yeast.But DUSP12 is in heart disease at present still without research.

Bibliography:

1. Li H, He C, Feng J, Zhang Y, Tang Q, Bian Z,Bai X, Zhou H, Jiang H, Heximer SP, Qin M, Huang H, Liu PP, Huang C. Regulator of g protein signaling 5 protects against cardiac hypertrophy and fibrosis during biomechanical stress of pressure overload. Proc Natl Acad Sci U S A. 2010; 107:13818-13823.

2. Lu J, Bian ZY, Zhang R, Zhang Y, Liu C,Yan L, Zhang SM, Jiang DS, Wei X, Zhu XH, Chen M, Wang AB, Chen Y, Yang Q, Liu PP, Li H. Interferon regulatory factor 3 is a negative regulator of pathological cardiac hypertrophy. Basic Res Cardiol. 2013;108:326.

3. Li H, Tang QZ, Liu C, Moon M, Chen M, Yan L, Bian ZY, Zhang Y, Wang AB, Nghiem MP, Liu PP. Cellular flice-inhibitory protein protects against cardiac remodeling induced by angiotensin ii in mice. Hypertension. 2010;56:1109-1117.

4. Bui AL, Horwich TB, Fonarow GC. Epidemiology and risk profile of heart failure. Nat Rev Cardiol. 2011;8:30-41.

5. Diwan A, Dorn GW, 2nd. Decompensation ofcardiac hypertrophy: Cellular mechanisms and novel therapeutic targets. Physiology (Bethesda). 2007;22:56-64.

6. Zile MR, Gottdiener JS, Hetzel SJ, McMurray JJ, Komajda M, McKelvie R, Baicu CF, Massie BM, Carson PE. Prevalence and significance of alterations in cardiac structure and function in patients with heart failure and a preserved ejection fraction. Circulation. 2011;124:2491-2501.

7. Ai D, Pang W, Li N, Xu M, Jones PD, Yang J, Zhang Y, Chiamvimonvat N, Shyy JY, Hammock BD, Zhu Y. Soluble epoxide hydrolase plays an essential role in angiotensin ii-induced cardiac hypertrophy. Proc Natl Acad Sci U S A. 2009;106:564-569.

8. Kurdi M, Booz GW. New take on the role of angiotensin ii in cardiac hypertrophy and fibrosis. Hypertension. 2011;57:1034-1038.

9. Komati H, Maharsy W, Beauregard J, Hayek S, Nemer M. Zfp260 is an inducer of cardiac hypertrophy and a nuclear mediator of endothelin-1 signaling. J Biol Chem. 2011;286:1508-1516.

10. Ramunddal T, Lindbom M, Tang MS, Shao Y, Boren J, Omerovic E. Overexpression of apolipoprotein b attenuates pathologic cardiac remodeling and hypertrophy in response to catecholamines and after myocardial infarction in mice. Scand J Clin Lab Invest. 2012;72:230-236.

11. Koitabashi N, Danner T, Zaiman AL, Pinto YM, Rowell J, Mankowski J, Zhang D, Nakamura T, Takimoto E, Kass DA. Pivotal role of cardiomyocyte tgf-beta signaling in the murine pathological response to sustained pressure overload.J Clin Invest. 2011;121:2301-2312.

12. Li HL, Wang AB, Huang Y, Liu DP, Wei C, Williams GM, Zhang CN, Liu G, Liu YQ, Hao DL, Hui RT, Lin M, Liang CC. Isorhapontigenin, a new resveratrol analog, attenuates cardiac hypertrophy via blocking signaling transduction pathways. Free Radic Biol Med.2005;38:243-257.

13. Yan L, Wei X, Tang QZ, Feng J, Zhang Y, Liu C, Bian ZY, Zhang LF, Chen M, Bai X, Wang AB, Fassett J, Chen Y, He YW, Yang Q, Liu PP,Li H. Cardiac-specific mindin overexpression attenuates cardiac hypertrophy via blocking akt/gsk3beta and tgf-beta1-smad signalling. Cardiovasc Res. 2011;92: 85-94.

14. Cai J, Yi FF, Bian ZY, Shen DF, Yang L, Yan L, Tang QZ, Yang XC, Li H. Crocetin protects against cardiac hypertrophy by blocking mek-erk1/2 signalling pathway. J Cell Mol Med. 2009;13:909-925.

15. Cai J, Yi FF, Yang L, Shen DF, Yang Q, Li A, Ghosh AK, Bian ZY, Yan L, Tang QZ, Li H, Yang XC. Targeted expression of receptor-associated late transducer inhibits maladaptive hypertrophy via blocking epidermal growth factor receptor signaling.Hypertension. 2009;53:539-548.

16. Bian ZY, Huang H, Jiang H, Shen DF, Yan L, Zhu LH, Wang L, Cao F, Liu C, Tang QZ, Li H. Lim and cysteine-rich domains 1 regulates cardiac hypertrophy by targeting calcineurin/nuclear factor ofactivated t cells signaling. Hypertension. 2010;55:257-263.

17. Xiao J, Moon M, Yan L, Nian M, Zhang Y, Liu C, Lu J, Guan H, Chen M, Jiang D, Jiang H, Liu PP, Li H. Cellular flice-inhibitory protein protects against cardiac remodelling after myocardial infarction. Basic Res Cardiol. 2012;107:239.23.

18. Liu Q, Chen Y, Auger-Messier M, MolkentinJD. Interaction between nfkappab and nfat coordinates cardiac hypertrophy and pathological remodeling. Circ Res. 2012;110:1077-1086.

19. Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, Jones F, Kimball TR, Molkentin JD. Calcineurin/nfat coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004;94: 110-118.

20. Rose BA, Force T, Wang Y. Mitogen-activatedprotein kinase signaling in the heart: Angels versus demons in a heart-breaking tale. Physiol Rev. 2010;90:1507-1546.

21. M. Muda, E.R. Manning, K. Orth, and J.E. Dixon, Identification of the human YVH1 protein-tyrosine phosphatase orthologue reveals a novel zinc binding domain essential for in vivo function. J Biol Chem 274 (1999) 23991- 5.

22. M.J. Munoz-Alonso, G. Guillemain, N. Kassis, J. Girard, A.F. Burnol, and A. Leturque, A novel cytosolic dual specificity phosphatase, interacting with glucokinase, increases glucose phosphorylation rate. J Biol Chem 275 (2000) 32406-12.

23. E.L. Cain, S.E. Braun, and A. Beeser, Characterization of a human cell line stably over-expressing the candidate oncogene, dual specificity phosphatase 12. PLoS One 6 (2011) e18677.

24. A. Sacristán-Reviriego, H. Martín, and M. Molina, Identification of putative negative regulators of yeast signaling through a screening for protein phosphatases acting on cell wall integrity and mating MAPK pathways. Fungal Genetics and Biology 77 (2015) 1-11。

Summary of the invention

For the defect and deficiency for solving the above-mentioned prior art, it is an object of the invention to determine the expression of DUSP12 and cardiac muscle Plump correlation, provide a kind of DUSP12 prepare cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviate and/ Treat the new opplication in the drug of myocardial hypertrophy.

The purpose of the invention is achieved by the following technical solution:

The present invention has determined the relationship between DUSP12 expression and myocardial hypertrophy by test:

1, the expression of cardiac myocyte hypertrophy marker ANP, β-MHC are obviously raised when myocardial hypertrophy occurs, the table of DUSP12 It is lowered up to obvious

The present invention selects normal person and dilated cardiomyopathy heart respectively, normal sham-operation (Sham) mouse and passes through Aorta arch constriction operation (AB) causes the mouse heart of myocardial hypertrophy, has detected the albumen table of ANP, β-MHC, DUSP12 respectively Up to situation.The result shows that the cardiac myocyte hypertrophy mark in the mouse heart of dilated cardiomyopathy and generation myocardial hypertrophy The expression of object ANP, β-MHC are obviously raised, and (Fig. 1, Fig. 2) is obviously lowered in the expression of DUSP12.

2, DUSP12 interferes (Adsh DUSP12) and is overexpressed (Ad DUSP12) adenovirus to the heart induced through Ang II The influence of myocyte hypertrophy model

Present invention discover that in menses angiotensin II(Ang II) induction external myocardial hypertrophy model in, DUSP12 crosses table Hypertrophy up to cardiac muscle cell is obvious suppressed, and DUSP12 does not express cardiac muscle cell and obvious loose (Fig. 3) occurs.

3, DUSP12 gene knockout significantly promotes myocardial hypertrophy, fibrosis, deteriorates heart function

The present invention selects wild-type mice, DUSP12 knock out mice to test, and every kind of mouse is divided into artificial hand Art group and operation group, every group of 10 mouse.Operation group gives aorta arch constriction operation, and sham-operation group refuses arch of aorta contracting It is narrow, the measurement of plump cardiac myocytes, fibrosis and heart function is then carried out by each group mouse to sham-operation group and operation group, The influence for the myocardial hypertrophy that research DUSP12 gene knockout induces aorta arch constriction.The result shows that knocking out DUSP12 gene institute The DUSP12 defect of cause significantly deteriorates myocardial hypertrophy, fibrosis and heart function (Fig. 4, Fig. 5, Fig. 6, Fig. 7).

4, DUSP12 gene overexpression significantly suppresses myocardial hypertrophy and its fibrosis, improves heart function

The present invention selects heartspecific DUSP12 transgenic mice and nontransgenic mice to test, and small by every kind Mouse is divided into sham-operation group and operation group, every group of 10 mouse.Operation group gives aorta arch constriction operation, and sham-operation group is not led Then arch of aorta constriction carries out plump cardiac myocytes, fibrosis and heart function by each group mouse to sham-operation group and operation group The measurement of energy, the influence for the myocardial hypertrophy that research DUSP12 gene overexpression induces aorta arch constriction.The result shows that crossing table Myocardial hypertrophy and fibrosis are significantly inhibited up to DUSP12 gene, is protected heart function (Fig. 8, Fig. 9, Figure 10, Figure 11).

It can be seen from the above result that the expression of DUSP12 compares significant drop with normal group in the model that myocardial hypertrophy occurs It is low；Inhibit DUSP12 expression to significantly promote myocardial hypertrophy, fibrosis, deteriorate heart function, promotes DUSP12 to be overexpressed then significant Myocardial hypertrophy, fibrosis are inhibited, heart function is protected.Therefore DUSP12 has protection heart function and inhibits myocardial hypertrophy and fiber The effect of change, especially DUSP12 have the work for being able to suppress the generation of myocardial hypertrophy related disease caused by aorta arch constriction With.

A kind of function of DUSP12 in myocardial hypertrophy, being mainly reflected in DUSP12 has protection heart function and inhibits cardiac muscle Plump effect, especially DUSP12 have the function of the generation of myocardial hypertrophy caused by being able to suppress aorta arch constriction.

For the above-mentioned function of DUSP12, provide the application of DUSP12 a kind of, be mainly reflected in DUSP12 cardioprotection, Application in anti-cardiac fibrosis and treatment myocardial hypertrophy, especially DUSP12 are screening or are preparing cardioprotection function, the anti-heart It is applied in dirty fibrosis and/or the drug of prevention, alleviation and/or treatment myocardial hypertrophy.The application includes DUSP12 direct As cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or the effective component for treating myocardial hypertrophy drug, energy Enough promote DUSP12 expression chemical substance be used as indirectly cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviate and/ Or the effective component for the treatment of myocardial hypertrophy drug.

A kind of drug of cardioprotection function includes DUSP12.

A kind of drug of anti-cardiac fibrosis includes DUSP12.

It is a kind of prevention, alleviate and/treatment myocardial hypertrophy drug, include DUSP12.

The invention has the following beneficial effects:

Present invention finds the new function of DUSP12 gene, i.e., have the function of being capable of cardioprotection, the anti-heart for DUSP12 gene Dirty fibrosis and the effect for inhibiting myocardial hypertrophy.Therefore, DUSP12 can be used as target gene, for screening cardioprotection function, resisting Cardiac fibrosis and/or prevention, alleviation and/or the drug for treating myocardial hypertrophy are used to prepare cardioprotection function, anti-cardiac muscle fertilizer Thick and/or prevention, the drug for alleviating and/or treating myocardial hypertrophy provide an effective new way for the treatment of myocardial hypertrophy Diameter.

Detailed description of the invention

Fig. 1 is the protein expression of ANP, β-MHC, DUSP12 in normal person and dilated cardiomyopathy patients (expanding heart trouble) heart Situation and statistics histogram；(0.05 vs normal person's group of *: p <) is lowered in the expression of dilated cardiomyopathy patients heart DUSP12.

Fig. 2 is Western blot detection wild-type mice after sham-operation (Sham) and aorta arch constriction operation (AB) ANP, β-MHC, the expression of DUSP12 and statistics histogram in heart, GAPDH is as internal reference, and wherein 4W is indicated 4 weeks, 8W table Show 8 weeks；(0.05 vs wild-type mice Sham group of *: p <) is lowered in the expression that the heart DUSP12 of myocardial hypertrophy occurs.

Fig. 3 is SD suckling mouse primary cardiomyocytes adenovirus AdshRNA, AdshDUSP12, AdGFP and AdDUSP12 sense Dye counts histogram through the post-stimulatory immunofluorescence of Ang II and cell surface area；The interference adenovirus of DUSP12 promotes the heart The overexpression adenovirus of myocyte hypertrophy, DUSP12 inhibits cardiac myocyte hypertrophy (0.05 vs PBS group of *: p <, #:p < 0.05 Vs Ang II group).

Fig. 4 be HW/BW after wild-type mice (WT) and DUSP12 knock out mice (DUSP12-KO) AB perform the operation 4 weeks, The statistics histogram of LW/BW and HW/TL；Wherein, HW is cardiac mass, and BW is weight, and LW is lungs total amount, and TL is tibia length (0.05 vs WT Sham group of *: p <, 0.05 vs WT AB group of #:p <).

Fig. 5 is wild-type mice (WT) and ventricle is transversal after DUSP12 knock out mice (DUSP12-KO) AB operation 4 weeks Face and heart tissue HE dyeing, WGA dyeing and cardiomyocytes cross-sectional area statistics histogram (0.05 vs WT Sham of *: p < Group, 0.05 vs WT AB group of # p <).

Fig. 6 is wild-type mice (WT) and heart tissue after DUSP12 knock out mice (DUSP12-KO) AB operation 4 weeks Sirius red stains and left room area of collagen count histogram (0.05 vs WT Sham group of *: p <, 0.05 vs WT of #:p < AB group).

Fig. 7 is wild-type mice (WT) and heart function is examined after DUSP12 knock out mice (DUSP12-KO) AB operation 4 weeks Survey the statistics histogram of result；FS is shortening fraction, and EF is ejection fraction, and LVEDd is left ventricular end diastolic diameter (*: p < 0.05 vs WT Sham group, 0.05 vs WT AB group of #:p <).

Fig. 8 be NTG and DUSP12-TG mouse AB perform the operation 4 weeks after HW/BW, LW/BW and HW/TL statistics histogram (*: 0.05 vs NTG Sham group of p <, 0.05 vs NTG AB group of #:p <).

Fig. 9 is ventricle cross section and heart tissue HE dyeing, WGA dye after NTG and DUSP12-TG mouse AB performs the operation 4 weeks Color and cardiomyocytes cross-sectional area statistics histogram (0.05 vs NTG Sham group of *: p <, 0.05 vs NTG AB of #:p < Group).

Figure 10 is heart tissue sirius red stains and left room area of collagen after NTG and DUSP12-TG mouse AB performs the operation 4 weeks It counts histogram (0.05 vs NTG Sham group of *: p <, 0.05 vs NTG AB group of #:p <).

Figure 11 is the statistics histogram of heart function testing result after NTG and DUSP12-TG mouse AB performs the operation 4 weeks；FS is short Axis shortening rate, EF are ejection fraction, and LVEDd is left ventricular end diastolic diameter (0.05 vs NTG Sham group of *: p <, #:p < 0.05 vs NTG AB group).

Specific embodiment

Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.

Animal for research and raising

Experimental animal: select 8-10 week old, weight in 23.5-27.5g, background is the wild-type mice of male C57BL/6 (WT), systemic DUSP12 knock out mice (DUSP12-KO), heartspecific DUSP12 transgenic mice (DUSP12- TG) and nontransgenic mice (NTG, littermate control nontransgenic mice) is experimental subjects.

(1) building of systemic DUSP12 knock out mice:

Systemic DUSP12 knock out mice is constructed using CRISPR-Cas9 technology.Firstly, being set by online CRISPR Meter tool (http://crispr.mit.edu) predicts the boot sequence of mouse DUSP12, designs 2 single-stranded oligo:

Oligo1:AAACCAATAGCTCCAAGTACTGCGG,

Oligo2:TAGGCCGCAGTACTTGGAGCTATTG.

Oligo1 and oligo2 anneal to form double-stranded DNA, and double-stranded DNA is connected into the pUC57-sgRNA through BsaI digestion (Addgene 51132) constructs sgRNA expression vector.

Using the sgRNA expression vector of above-mentioned building as template, using following primer by PCR amplification contain T7 promoter and The DNA fragmentation of boot sequence:

Forward primer:GATCCCTAATACGACTCACTATAG,

Reverse primer:AAAAAAAGCACCGACTCGGT.

It is carried out using the PCR product expanded as template using MEGAshortscript Kit(Ambion, AM1354) external Transcription；Cas9 plasmid (Addgene 44758) passes through T7 Ultra kit(Ambion, Am1345) it is transcribed.It will transcribe The mRNA of the Cas9 and boot sequence RNA that arrive use miRNeasy Micro Kit(Qiaen, 217084) after purification, pass through 5247 micro-injection system of FemtoJet is injected into the unicellular fertilized eggs of wild type C57BL/6 mouse.It chooses through micro- note The fertilized eggs survived after penetrating are transplanted in healthy female mice fallopian tubal, obtain F0 for mouse after gestation by 21 days.

F1 generation and F2 identify that wild-type mice includes the DNA sequence dna of one section of long 124bp, and is mutated small for mouse by PCR The DNA sequence dna of mouse (DUSP12 knock out mice) containing 110bp, final protein product are detected by western blot Identification.Wherein, PCR identifies that primer is as follows:

DUSP12-238-F:5 '-CCGACCAGCTTACCTTTGAA-3 ',

DUSP12-238-R:5 '-CAAACACACGCTCAAAGAGG-3 '.

Testing mouse used is mutant homozygote.

(2) building of heartspecific DUSP12 transgenic mice:

It is complete with following primer PCR amplification mouse DUSP12 using wild type C57BL/6 mouse DUSP12 gene cDNA as template Long gene (NCBI, DUSP12 mus NM_023173.2):

Upstream primer: TGCTCTAGAGCCACCATGTTGGAAGCGCAGGGT,

Downstream primer: TGCTCTAGATCACAGCTTCTTTGTCTG.

Amplification DUSP12 full-length gene and pCAG-loxP-CAT-loxP plasmid (pCAG-loxP-CAT-loxP plasmid by Beijing Union Medical College basis institute teacher Yang Qinglin provides, and preparation process is referring to document: Kim T, Zhelyabovska O, Liu J, et al. Generation of an Inducible, Cardiomyocyte-Specific Transgenic Mouse Model with PPAR b/d Overexpression[J]. Peroxisome Proliferator- Activated Receptors (PPARs), 57.) through XbaI(NEB, # R0145L) it connects after digestion, form pCAG- LoxP-CAT-loxP-DUSP12-hGHpA carrier (CAG (chicken beta-actin)-CAT (chloramphenicol Acetyltransferase)-DUSP12-hGHpA), the plasmid of building is injected into wild type by micro-injection system In the unicellular fertilized eggs of C57BL/6 mouse, which enters in healthy female mice, and development obtains F0 for mouse.It will obtain F0 for mouse and α-MHC-Cre mouse hybrid, and by tamoxifen induction (tamoxifen 80mg/kg/D, intraperitoneal injection, Continued stimulus 5 days) obtain heartspecific DUSP12 transgenic mouse (above-mentioned transgenic mice is prepared referring to following documents: Jiang DS, Bian ZY, Zhang Y, Zhang SM, Liu Y, Zhang R et al. Role of interferon regulatory factor 4 in the regulation of pathological cardiac hypertrophy. Hypertension 2013;61:1193-1202.).

Feeding environment: all experiment mices are raised in SPF grades of Experimental Animal Centers, and SPF grades of size mouse feeds are purchased from north Capital Fukang Biotechnology Co., Ltd.Rearing conditions: room temperature is between 22-24 DEG C, and humidity is between 40-70%, light and shade alternating Lighting hours is 12h, and free water is ingested.

Expression of 1 DUSP12 of embodiment in normal person and Mutation of Patients with Cardiomyopathy heart

Normal Human Heart's (dead individual contributed of non-cardiac reason), dilated cardiomyopathy heart is selected (to do the heart The receptor of dirty transfer operation patient displacement, DCM), protein is extracted to heart and carries out SDS-PAGE- western blot test (Western blot), binding specificity know DUSP12 albumen and cardiac myocyte hypertrophy marker ANP(Millipore, AB2232), β-MHC(santa cruz, sc53090) antibody detected, measure its DUSP12(santa cruz, Sc98431 expression), GAPDH(Cell Signaling Technology, 2128) it is used as internal reference.Testing result such as Fig. 1 institute Show, the expression of cardiac myocyte hypertrophy marker ANP, β-MHC in dilated cardiomyopathy heart are obviously raised, DUSP12's Expression is obvious to lower (Fig. 1).

Expression of 2 DUSP12 of embodiment in wild-type mice sham-operation group and myocardial hypertrophy model group heart

1. establishing mouse cardiac muscle hypertrophy model using aorta arch constriction operation (AB), model manipulation process:

1.1 Preoperative Method

(1) it anaesthetizes: first weighing to mouse, the amount of anaesthetic (3% yellow Jackets) needed for calculating according to 90mg/kg weight passes through Intraperitoneal injection, and record injection time point.Press from both sides tail, folder toe without significant reaction and mouse it is in good condition for anesthesia Success criteria (one As after injection about 10min have reaction with the small mousetrap toe of about 50min after anesthesia, 30min or so is best after anesthesia without significant reaction Operating time).

(2) art area prepares: by the left chest of mouse, left side chest and the skin unhairing of left fore oxter.With wet yarn after shaving Cloth wiping art area removes deratization hair, is advisable with not influencing surgical field of view.

(3) trachea cannula: the upper front tooth of mouse is fixed on V shaped slab inclined-plane with rubber band, and rapidly passes through trachea cannula Glottis is properly inserted intratracheally, and subsequent right lateral position is placed on heating cushion (heating cushion need to preheat in advance), then by trachea cannula It is connect with ventilator, fixed mouse.If the thorax fluctuating of mouse is consistent with breathing unit frequency, illustrate trachea cannula success.

1.2 aorta arch constriction arts (AB)

AB art myocardial hypertrophy model group: taking right lateral position, and mouse left fore is placed in above right fore, and will with medical adhesive tape Two forelimbs are fixed.It is encased inside cotton swab below right chest, raises thorax, is successively 75% alcohol to field of operation with the tincture of iodine and volume fraction Domain skin degerming.Left hand holds ophthalmic tweezers and has pinched left skin of chest, and the right hand holds eye scissors and cuts off skin about 1cm, successively separates flesh Meat and soft tissue slightly push left lung aside with cotton swab in 2-3 rib horizontal opening thoracic cavity, and dissociate arch of aorta descending branch, and 7-0 is performed the operation Suture pass through blood vessel, and one section of 26G(25.0-27.5g mouse is placed in parallel above blood vessel) or 27G(23.5-25.0g) infuse Emitter syringe needle ligatures blood vessel and syringe needle together, then extracts syringe needle out i.e. and can reach the Vasoconstriction of respective degrees.Ligation finishes It successively sutures afterwards, closes thoracic cavity, be inserted into thoracic cavity from sealing with syringe and extract 1cc gas out to restore negative pressure in thoracic cavity, pull out Rapid skin suture notch after syringe out.

Only threading does not ligature sham-operation group (Sham) after free descending aorta out, remaining step is the same as AB art myocardial hypertrophy Model group.

1.3 postoperative care

In operation after the ligation of arch of aorta descending branch, there is autonomous respiration to mouse, kickback occurs in folder toe, extraction tracheae Intubation, and mouse is put into the rearging cage of padding, feed and the drinking water crossed equipped with high pressure sterilization, continue to raise in receptacle Observation.

2. materials

Assay balance is opened, is returned to zero spare.It is re-weighed and puts to death mouse.The curved tweezer of ophthalmology lives the vessel pedicle below auricle, cuts Lower heart, is immediately placed on sterile gauze, gently squeezes heart intracavity liquid, after dipping in dry surface liquid, weighs and record, by heart It is put into corresponding cryopreservation tube, is immediately placed in liquid nitrogen container, be used for molecular Biological Detection after -80 DEG C of refrigerators save.

3. expression of the DUSP12 in Sham group mouse and myocardial hypertrophy model group mouse heart

4 weeks and 8 weeks hearts, mention heart after selecting wild-type mice Sham group and myocardial hypertrophy model group AB to perform the operation respectively Protein is taken to carry out SDS-PAGE- western blot test (Western blot), binding specificity identifies DUSP12 albumen and the heart The antibody of myocyte hypertrophy marker ANP, β-MHC are detected, and measure the expression of its DUSP12, GAPDH is as internal reference, detection As a result as shown in Figure 2.As shown in Fig. 2, expression of the cardiac myocyte hypertrophy marker in postoperative ANP, β-MHC of AB is obviously raised, The expression of DUSP12 is in the postoperative obvious downward of AB.Show that the expression that the heart DUSP12 of myocardial hypertrophy occurs is lowered.

3 DUSP12 of embodiment interferes (Adsh DUSP12) and is overexpressed (Ad DUSP12) adenovirus and stimulates Ang II Primary cardiomyocytes hypertrophy influence

1. primary newborn SD rat myocardial cells culture

(1) newborn 1 day Sprague-Dawley suckling mouse 8,75% alcohol disinfecting below neck, with eye scissors and microforceps Heart is removed, is put into the glass dish for filling 10mL DMEM/F12 liquid.Another is taken again, repeats above procedure.

(2) heart is cleaned with DMEM/F12 culture medium, and heart is cut into 1-2mm³Fragment.It is transferred to and is placed with rotor In serum bottle, DMEM/F12 is sucked, pancreatin digestive juice is added.Revolving speed is 120r/min, digests 15min, the static several seconds, discards Supernatant.

(3) pancreatin digestive juice is added, revolving speed 120r/min digests 15min.Static several seconds, Aspirate supernatant are used The DMEM/F12 culture medium of 20% calf serum terminates digestion, is placed in 4 DEG C of refrigerators and saves.The step is repeated, circulation is several times. Taking should exhaust when supernatant as far as possible, when tissue block bleaches and obviously becomes smaller, terminate digestion.

(4) myocardial cell suspensions that will be gathered are centrifuged 8min with 1500rpm revolving speed, discard supernatant liquid.In centrifuge tube Appropriate culture medium is added, cell is resuspended in soft piping and druming, is concentrated in 1 50mL centrifuge tube, and cell suspension is filtered with 40 μm of cell Net filtration.

(5) by cell inoculation in the culture dish of 100mm, adherent 90min when poor draws not adherent cell suspension mistake Filter.Brdu(final concentration 0.1mM is added according to the total amount of cell suspension), after mixing, it is added to the coated device of 0.1% gelatin In ware.

(6) jog cell dispersion, whirlpool does not rock.37℃,5% CO₂It is incubated for 48 hours and is cleaned 1 time with PBS, replacement culture Base.

2. DUSP12 interferes (Adsh DUSP12) and is overexpressed (Ad DUSP12) adenovirus to the heart induced through Ang II The influence of myocyte hypertrophy model

AdshRNA(silencing RNA containing shRNA() adenovirus, be used as control), Adsh DUSP12(contain shRNA-DUSP12 The adenovirus of (silencing RNA-DUSP12 fusion protein)), AdGFP(green fluorescent protein containing GFP() adenovirus, be used as control) And the Ad DUSP12(- DUSP12 of green fluorescent protein containing GFP-DUSP12(fusion protein) adenovirus) (the structure of these adenovirus Process is built referring to document: Chen K, Gao L, Liu Y, et al. Vinexin- β protects against cardiac hypertrophy by blocking the Akt-dependent signalling pathway[J].Basic Res Cardiol, 2013,108 (2): 1-14.) adenovirus 10 MOIs infect 3 days primary cardiac muscles of culture respectively Cell is small with 1 μM of Angiotensin II (Ang II) (being purchased from Sigma company, A9525) or control PBS stimulation 48 after 12 hours When, then carry out immunofluorescent test.The result shows that myocardial cell surface area after Adsh DUSP12 adenovirus infection compared with AdshRNA control group increases, and the myocardial cell surface area through Ad DUSP12 adenovirus infection is then brighter than control group AdGFP Aobvious to reduce (Fig. 3), i.e. the interference adenovirus of DUSP12 promotes cardiac myocyte hypertrophy, and the overexpression adenovirus of DUSP12 inhibits cardiac muscle Cellular mast,

4 myocardial hypertrophy model mice myocardial hypertrophy of embodiment and fibrosis detection and heart function detection

1. establishing mouse cardiac muscle hypertrophy model using aorta arch constriction operation (AB)

Select 8-10 week old, weight 23.5-27.5g wild-type mice (WT), DUSP12 knock out mice (DUSP12-KO), heartspecific DUSP12 transgenic mice (DUSP12-TG) and nontransgenic mice (NTG) are respectively divided into vacation Operation group (Sham) and AB art myocardial hypertrophy model group, i.e. WT Sham group, WT AB group, DUSP12-KO Sham group, DUSP12- KO AB group, DUSP12-TG Sham group, DUSP12-TG AB group, NTG Sham group, NTG AB group, every group of 10 mouse.Modeling Method is the same as embodiment 2.The detection of the AB detection for carrying out myocardial hypertrophy and fibrosis respectively and heart function in postoperative 4 weeks.

2. materials

(1) previous work: preparing the urine cup of 10% formaldehyde of volume fraction equipped with 20mL in advance, and posts label (mouse volume Number, group, type of surgery and materials the date).The culture dish for filling 10% KCl solution of mass fraction is placed at materials.It opens Assay balance returns to zero spare.It is re-weighed and puts to death mouse.

(2) draw materials: the curved tweezer of ophthalmology lives the vessel pedicle below auricle, cuts heart, is immediately placed in 10% KCl of mass fraction In solution.It after cardiac arrest after diastole, is placed on sterile gauze, gently squeezes heart intracavity liquid, after dipping in dry surface liquid, It weighs and records, heart is put into corresponding urine cup, detected after fixed 48h for pathology.

(3) measurement of correlation and calculating: mouse lung is taken out, filter paper blots after trimming, weighs and records.Cut off mouse hind leg Skin at shin bone, measures and records tibia length.Calculate the ratio (HW/BW) of heart weight and weight, the ratio of lung weight and weight (LW/BW) and the heart weighs the ratio (HW/TL) with tibia length.

3. pathology detect

3.1 prepare paraffin specimen slice

Primary operational program includes trimming heart → embedding frame processing → flowing water flushing → dehydration → transparent → waxdip → packet Bury → slice → spread out it is spare after piece → dry or toast.

3.2 hematoxylin-eosins (HE) dyeing

Key step are as follows: paraffin specimen is taken to be sliced 55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% alcohol 1min → 95% alcohol of alcohol 1min → 70% 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → water Wash the hydrochloride alcohol of 1min → 1% (take 3mL concentrated hydrochloric acid and 70% alcohol of 297mL be sufficiently mixed uniformly) 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, epsom salt 2g, the two are dissolved in 100mL distilled water) 1min → washing 1min → Yihong is molten Liquid (Zhuhai shellfish rope, BA-4024) 3-5min → distilled water washes away loose colour → 70% alcohol of alcohol 1s → 95% alcohol of 1s → 100% 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of the interior drying of the not dry mounting → draught cupboard immediately of dimethylbenzene, microscope is taken pictures.

HE dyes picture statistics: every picture selects 3 or more clear borders, and the approximately centrally located cell of core is used 6.0 software circle cell area of Image-Pro Plus.

3.3 wheat germ aggregate (WGA) dyeing

Key step: the paraffin specimen slice that 30min is toasted through 60 DEG C is placed in dimethylbenzene 5min × 3 time → 100% second Alcohol 5min × 2 time → 95% ethyl alcohol of ethyl alcohol 5min → 70% 5min → distilled water rinsing 5min × 2 time → PBS rinses 5min → PBS Rinsing 10min → discard PBS is added dropwise 37 DEG C of pancreatin working solution (DIG-3008, Foochow step new) and is protected from light incubation 20min → PBS drift 5min × 3 time → taking-up slice is washed, dries the liquid (tissue is sure not drying) around tissue with filter paper, changes stroke circle with group and lays flat → 37 DEG C of dropwise addition 488 working solution of WGA-Alexa Flour (10 μ g/mL), which is protected from light, is incubated for 2h → discards dye liquor, PBS in wet box 5min × 3 time → SlowFade Gold antifade reagent with DAPI mounting → viewed under fluoroscopy is rinsed, is shown Micro mirror is taken pictures.

3.4 Picro-Sirius reds (PSR) dyeing

Key step are as follows: paraffin specimen is taken to be sliced 55 DEG C of baking 30min → dimethylbenzene 2min, 3 times → 100% alcohol 1min → 95% alcohol of alcohol 1min → 70% 1min → flowing water rinses 10min → 0.2% phosphomolybdic acid 2min of distilled water 1min → mass fraction → 0.1% sirius red picric acid solution drop dyed in tissue, wet box 90min → go residul liquid-removing → 0.01N hydrochloric acid 4s → 70% alcohol, 1 time → 90% alcohol, 1 time → 100% alcohol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of the not dry lid glass immediately of dimethylbenzene Piece mounting, microscope are taken pictures.

PSR dyes picture statistics (6.0 software of Image-Pro Plus): the collagen ratio=area of collagen/(gross area-sky Fine flour product) × 100%.

Cardiac muscular tissue is made of cardiac muscle cell and interstitial tissue, and heart is a terminal differentiation organ, and cardiac muscle cell loses increasing Ability is grown, the reaction of cardiac muscle cell caused by various physiology or pathological stimuli can only be the volume increase of individual cells and cannot Quantitatively it is proliferated.Therefore, in the pathophysiological process of myocardial hypertrophy, it is mainly shown as that cardiac muscle cell's volume increases, muscle segment Quantity increases, cell arrangement disorder, and cardiac mesenchymal changes proliferation and conversion including Cardiac Fibroblasts, collagenous fibres density Increase, collagen secretion increases, collagen proportional balancing method imbalance etc..

Phenotypic results after WT and DUSP12-KO mouse uses AB art to establish myocardial hypertrophy model are shown in Fig. 4-7.Sham(is false Operation) difference in group between HW/BW, LW/BW and HW/TL of WT and DUSP12-KO mouse is not statistically significant；WT mouse AB postoperative 4 weeks HW/BW, LW/BW, HW/TL are higher than its Sham group；AB postoperative 4 weeks, HW/BW, LW/BW of DUSP12-KO mouse And HW/TL rises (Fig. 4) compared with WT mouse.HE dyeing and WGA stained slice can be observed: Sham group heart no significant difference, AB group increases compared with the heart of Sham group, and the heart of DUSP12-KO mouse is significantly greater than WT group mouse；Sham group myocardium myo fibril It is neat, fine and close to tie up cell arrangement, form is complete, and karyon and nucleolar structure are clear；AB group myofilament is disorganized, loose, and cardiac muscle is thin Cell space product significantly increases, and form is irregular, born of the same parents' nuclear hyperchromatism, increase, deformity, and kernel is fuzzy, and DUSP12-KO group is then than WT group cell Loose obvious, difference is statistically significant (Fig. 5).After PSR dyeing, find AB group myocardium of ventricle interstitial collagen content compared with Sham group Increase, collagen increase becomes apparent around arteries, and collagen thickening is disorganized at network-like；DUSP12-KO mouse AB art Myocardial collagen network content and perivascular collagen content then increase more (Fig. 6) more postoperative than WT mouse AB afterwards.Result above is said Bright apparent myocardial hypertrophy occurs for mouse after the modeling of AB art, and the myocardial hypertrophy and degree of fibrosis of DUSP12-KO mouse are greater than WT mouse.

Fig. 8-11 is that NTG and DUSP12-TG mouse uses AB art to establish the phenotypic results after myocardial hypertrophy model. DUSP12-TG mouse AB postoperative 4 weeks HW/BW, LW/BW and HW/TL are lower than the postoperative 4 weeks groups (Fig. 8) of NTG mouse AB.HE dyeing And WGA stained slice can be observed: AB group increases compared with the heart of Sham group, and the degree that the postoperative TG mouse heart of AB increases is remote Less than NTG mouse；TG mouse AB postoperative myocardial cell cross section product is greater than Sham group, significantly less than NTG mouse AB group (Fig. 9). PSR dyeing is as it can be seen that TG mouse AB postoperative myocardial interstitial collagen content and perivascular collagen content are less than NTG mouse AB group (figure 10).These results suggest that after the modeling of AB art, apparent myocardial hypertrophy occurs for mouse, the myocardial hypertrophy of DUSP12-TG mouse and Degree of fibrosis is less than NTG mouse.

4. ultrasound detection heart function

4.1 early-stage preparations

(1) Anesthesia machine prepares: first connecting the intake interface on oxygen cylinder and Anesthesia machine, then to unscrew dosing mouth on Anesthesia machine close Capping, tightens sealing cover after being rapidly added isoflurane to safe scale.Total valve on oxygen cylinder is unscrewed, flow control valve is adjusted Knob, outlet pressure maintain 0.2-0.3mPa.

(2) mouse to be measured prepares: after mouse to be detected is anaesthetized rapidly with isoflurane, left anterior pectorial region shaving, by what is handled well Mouse head protrudes into anesthetic conduit pullover, the narcosis for maintaining mouse stable with 1.5-2.0% isoflurane.

The detection of 4.2 heart functions

Mouse takes left lateral position or dorsal position, and uniformly smears ultrasonic coupling agent (Tianjin Cheng Xin company) in shaving area.It adopts With high-frequency ultrasound in diagnosis instrument, frequency 15MHz, selection standard papillary muscles of left ventricle short axis view is measured, in left room diastasis Diameter (LVEDd), ejection fraction (EF) and shortening fraction (FS).

Fig. 7 is that WT and DUSP12-KO mouse uses AB art to establish the heart function testing result after myocardial hypertrophy model.With WT Sham group is compared, and is shown decreased cardiac function and myocardial hypertrophy within WT mouse AB postoperative 4 weeks, is mainly shown as the index of myocardial hypertrophy LVEDd increases, and reflects index EF, FS of heart function and then decline.AB postoperative 4 weeks, the index of DUSP12-KO mouse cardiac muscle plumpness The degree of increase and the degree for reflecting that the index of heart function declines are greater than WT mouse (Fig. 7).These results and DUSP12-KO mouse The more result of myocardial hypertrophy is consistent.

Figure 11 is that NTG and DUSP12-TG mouse uses AB art to establish the heart function testing result after myocardial hypertrophy model.AB Postoperative 4 weeks, compared with NTG mouse, degree and reflect what the index of heart function declined that the index of TG mouse cardiac muscle plumpness increases Degree is then less than NTG group (Figure 11), and difference is statistically significant.

It can be seen from the above result that in the myocardial hypertrophy disease model caused by aorta arch constriction, DUSP12 gene defect Myocardial hypertrophy, fibrosis are significantly promoted, heart function is deteriorated, DUSP12 gene overexpression significantly suppresses myocardial hypertrophy, fiber Change, protects heart function.Therefore DUSP12 gene has the function of protecting heart function and inhibits myocardial hypertrophy and fibrosis, especially DUSP12 gene has the function of the generation of myocardial hypertrophy related disease caused by being able to suppress aorta arch constriction.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

Claims (6)

1. application of the dual specificity phosphatase enzyme 12 in the drug for screening anti-cardiac fibrosis, it is characterised in that: the application For the purpose of the diagnosing and treating of non-disease.

2. application of the dual specificity phosphatase enzyme 12 in the drug for preparing anti-cardiac fibrosis.

3. application according to claim 2, it is characterised in that: be used as anti-cardiac fibrosis including dual specificity phosphatase enzyme 12 Drug effective component.

4. dual specificity phosphatase enzyme 12 is applied in screening prevention, the drug alleviated and/or treat myocardial hypertrophy, feature exists In: the application is the purpose of the diagnosing and treating of non-disease.

5. dual specificity phosphatase enzyme 12 is applied in preparation prevention, the drug alleviated and/or treat myocardial hypertrophy.

6. application according to claim 5, it is characterised in that: including dual specificity phosphatase enzyme 12 as prevention, alleviate and/ Or the effective component of the drug for the treatment of myocardial hypertrophy.