CN105126080A - Application of zinc finger protein 436 (ZNF 436) to treatment of myocardial hypertrophy - Google Patents

Abstract

The invention discloses an application of zinc finger protein 436 (ZNF 436) to protection of the cardiac function, resistance to myocardial fibrosis and/or prevention, relief and treatment of myocardial hypertrophy, and belongs to the field of genetic application. According to the application, it is determined that ZNF 436 expression is lowered obviously compared with a normal group in a myocardial hypertrophy generation model; through inhibition of the ZNF 436 expression, the myocardial hypertrophy and fibrosis are promoted remarkably, and the cardiac function is deteriorated; by promoting ZNF 436 overexpression, the myocardial hypertrophy and fibrosis are inhibited obviously, and the cardiac function is protected. The ZNF 436 can be used as a drug target, and is used in drugs for screening protection of the cardiac function, resistance to myocardial fibrosis and/or prevention, relief and treatment of myocardial hypertrophy. The ZNF 436 can be used as a target gene used in gene therapy, and is used for designing and preparing drugs and/or biological reagents for protection of the cardiac function, resistance to myocardial fibrosis and/or prevention, relief and treatment of myocardial hypertrophy. A new effective path is provided for treatment of myocardial hypertrophy.

Description

Zinc finger protein 43 6(ZNF436) treating the application in myocardial hypertrophy

Technical field

The invention belongs to function and the application of gene, particularly a kind of zinc finger protein 43 6(ZNF436) treating the application in myocardial hypertrophy, the application specifically in preparation prevention, alleviation and/or treatment myocardial hypertrophy medicine.

Background technology

Myocardial hypertrophy is the compensatory response that cardiac muscle increases chronobiological mechanical pressure or volumetric loading, be common in the cardiovascular disease such as hypertension, aortic stenosis, its main manifestations is the features [1-3] such as myocardial cell volume increases, albumen synthesis increases, extracellular matrix increases.Hypertension, Senile degenerative aortic valve disease in China in ascendant trend year by year.Myocardial hypertrophy caused by the diseases such as hypertension, hypertensive heart disease sickness rate also increase thereupon.Although myocardial hypertrophy can make myocardial cell increase at first, myocardial contraction is strengthened, it is a kind of compensatory mechanism maintaining normal cardiac output, but the pressure of long duration or volumetric loading overweight, can cause myocardial remodelling, simultaneously because myocardium requirementing keto quantity increases, and coronary blood is for relative deficiency, cause myocardial ischemia, apoptosis of cardiac muscle, and then cause mistake compensatory, thus cause [4,5] such as heart failure, malignant arrhythmia, even sudden deaths.Research shows developing along with heart left chamber plumpness, and the incidence rate of the cardiovascular event such as myocardial ischemia, ventricular arrhythmia, heart failure, sudden death adds 6 ~ 10 times [6].

Think that myocardial hypertrophy is the dynamic process that one kind of multiple factors participate in the complexity regulated at present.Research finds long-term biomechanics pressure and/or volumetric loading excessively, ventricle wall stress is increased, causes myocardial hypertrophy.In addition, various born of the same parents' external stimulus signals such as Angiotensin II (AngII), Endothelin (ET), catecholamine, transforming growth factor-β (TGF-β) can induce the change of gene expression in core, thus cause cardiac myocyte hypertrophy [7-11].Divide three links from the pathological process of molecular level myocardial hypertrophy: gene transcription activating in the appearance of the outer plump stimulus signal of born of the same parents, intracellular signal transduction and core, finally bring out cell and loose character mutation occurs.Current research has shown the process that many A signal pathways participates in myocardial hypertrophy.Wherein, calcineurin calcineurin/NFAT, mitogen activated protein kinase (MAPK) and PI3K/Akt/GSK3 signal beta Signal Transduction Pathways and downstream transcription factor MCIP1.4, NF-κ B, AP-1, MEF2, mTOR etc. of being regulated by these three paths play an important role [1 in the developing of myocardial hypertrophy, 2,12-17].Calcineurin (calcineurin) is a kind of multifunctional signal enzyme regulated by calcium ion and calmodulin, by making nuclear factor of activated T cells (nuclearfactorofactivatedTcells, NFAT) transposition enters core, regulate the expression [18,19] of loose gene (ANP, BNP) in core.MAPK comprises three subfamilies [20]: ERKs, JNKs and p38-MAPK.The MAPKs of phosphorylation activates and promotes the downstream transcription factor NF-κ B relevant with myocardial hypertrophy, the transcriptional activity of AP-1, MEF2, NFAT etc., and regulates cytogene to transcribe and albumen synthesis, causes cardiac myocyte hypertrophy, causes myocardial hypertrophy [20].Up to the present, it is complicated that numerous research describes HCM morbidity, but its mechanism is still very clear and definite, and clinically also therefore do not have special effective medicine and scheme.Therefore, the further generation development mechanism of research myocardial hypertrophy, to improve HCM patient's heart function and reduction or delay heart failure morbidity, reduce sudden death rate and have great importance.

Zinc finger gene occupies significant proportion in human gene, and the albumen of coding plays a significant role [21] in Growth of Cells, differentiation, growth and numerous disease.Zinc finger protein 43 6 (ZNF436), encodes out containing 470 amino acid whose protein, is expressed in multiple vertebrate animal tissues, and in the brain and heart of people, have highly expression [22].ZNF436 has the transcriptional activity suppressing the multiple factor, comprises SRF, AP-1.But it is in human diseases, in the pathology generating process of such as myocardial hypertrophy whether tool have certain effect still unknown.

List of references

1.LiH,HeC,FengJ,ZhangY,TangQ,BianZ,BaiX,ZhouH,JiangH,HeximerSP,QinM,HuangH,LiuPP,HuangC.Regulatorofgproteinsignaling5protectsagainstcardiachypertrophyandfibrosisduringbiomechanicalstressofpressureoverload.ProcNatlAcadSciUSA.2010;107:13818-13823.

2.LuJ,BianZY,ZhangR,ZhangY,LiuC,YanL,ZhangSM,JiangDS,WeiX,ZhuXH,ChenM,WangAB,ChenY,YangQ,LiuPP,LiH.Interferonregulatoryfactor3isanegativeregulatorofpathologicalcardiachypertrophy.BasicResCardiol.2013;108:326.

3.LiH,TangQZ,LiuC,MoonM,ChenM,YanL,BianZY,ZhangY,WangAB,NghiemMP,LiuPP.Cellularflice-inhibitoryproteinprotectsagainstcardiacremodelinginducedbyangiotensiniiinmice.Hypertension.2010;56:1109-1117.

4.BuiAL,HorwichTB,FonarowGC.Epidemiologyandriskprofileofheartfailure.NatRevCardiol.2011;8:30-41.

5.DiwanA,DornGW,2nd.Decompensationofcardiachypertrophy:Cellularmechanismsandnoveltherapeutictargets.Physiology(Bethesda).2007;22:56-64.

6.ZileMR,GottdienerJS,HetzelSJ,McMurrayJJ,KomajdaM,McKelvieR,BaicuCF,MassieBM,CarsonPE.Prevalenceandsignificanceofalterationsincardiacstructureandfunctioninpatientswithheartfailureandapreservedejectionfraction.Circulation.2011;124:2491-2501.

7.AiD,PangW,LiN,XuM,JonesPD,YangJ,ZhangY,ChiamvimonvatN,ShyyJY,HammockBD,ZhuY.Solubleepoxidehydrolaseplaysanessentialroleinangiotensinii-inducedcardiachypertrophy.ProcNatlAcadSciUSA.2009;106:564-569.

8.KurdiM,BoozGW.Newtakeontheroleofangiotensiniiincardiachypertrophyandfibrosis.Hypertension.2011;57:1034-1038.

9.KomatiH,MaharsyW,BeauregardJ,HayekS,NemerM.Zfp260isaninducerofcardiachypertrophyandanuclearmediatorofendothelin-1signaling.JBiolChem.2011;286:1508-1516.

10.RamunddalT,LindbomM,TangMS,ShaoY,BorenJ,OmerovicE.Overexpressionofapolipoproteinbattenuatespathologiccardiacremodelingandhypertrophyinresponsetocatecholaminesandaftermyocardialinfarctioninmice.ScandJClinLabInvest.2012;72:230-236.

11.KoitabashiN,DannerT,ZaimanAL,PintoYM,RowellJ,MankowskiJ,ZhangD,NakamuraT,TakimotoE,KassDA.Pivotalroleofcardiomyocytetgf-betasignalinginthemurinepathologicalresponsetosustainedpressureoverload.JClinInvest.2011;121:2301-2312.

12.LiHL,WangAB,HuangY,LiuDP,WeiC,WilliamsGM,ZhangCN,LiuG,LiuYQ,HaoDL,HuiRT,LinM,LiangCC.Isorhapontigenin,anewresveratrolanalog,attenuatescardiachypertrophyviablockingsignalingtransductionpathways.FreeRadicBiolMed.2005;38:243-257.

13.YanL,WeiX,TangQZ,FengJ,ZhangY,LiuC,BianZY,ZhangLF,ChenM,BaiX,WangAB,FassettJ,ChenY,HeYW,YangQ,LiuPP,LiH.Cardiac-specificmindinoverexpressionattenuatescardiachypertrophyviablockingakt/gsk3betaandtgf-beta1-smadsignalling.CardiovascRes.2011;92:85-94.

14.CaiJ,YiFF,BianZY,ShenDF,YangL,YanL,TangQZ,YangXC,LiH.Crocetinprotectsagainstcardiachypertrophybyblocking

mek-erk1/2signallingpathway.JCellMolMed.2009;13:909-925.

15.CaiJ,YiFF,YangL,ShenDF,YangQ,LiA,GhoshAK,BianZY,YanL,TangQZ,LiH,YangXC.Targetedexpressionofreceptor-associatedlatetransducerinhibitsmaladaptivehypertrophyviablockingepidermalgrowthfactorreceptorsignaling.Hypertension.2009;53:539-548.

16.BianZY,HuangH,JiangH,ShenDF,YanL,ZhuLH,WangL,CaoF,LiuC,TangQZ,LiH.Limandcysteine-richdomains1regulatescardiachypertrophybytargetingcalcineurin/nuclearfactorofactivatedtcellssignaling.Hypertension.2010;55:257-263.

17.XiaoJ,MoonM,YanL,NianM,ZhangY,LiuC,LuJ,GuanH,ChenM,JiangD,JiangH,LiuPP,LiH.Cellularflice-inhibitoryproteinprotectsagainstcardiacremodellingaftermyocardialinfarction.BasicResCardiol.2012;107:239.23.

18.LiuQ,ChenY,Auger-MessierM,MolkentinJD.Interactionbetweennfkappabandnfatcoordinatescardiachypertrophyandpathologicalremodeling.CircRes.2012;110:1077-1086.

19.WilkinsBJ,DaiYS,BuenoOF,ParsonsSA,XuJ,PlankDM,JonesF,KimballTR,MolkentinJD.Calcineurin/nfatcouplingparticipatesinpathological,butnotphysiological,cardiachypertrophy.CircRes.2004;94:110-118.

20.RoseBA,ForceT,WangY.Mitogen-activatedproteinkinasesignalingintheheart:Angelsversusdemonsinaheart-breakingtale.PhysiolRev.2010;90:1507-1546.

21.Klug,A.andSchwabe,J.W.R.(1995)Proteinmotifs5.Zincfingers.FASEBJ.9(8),597-604

22.LiY,DuX,LiF,DengY,YangZ,WangY,PenZ,WangZ,YuanW,ZhuC,WuX.Anovelzinc-fingerproteinZNF436suppressestranscriptionalactivitiesofAP-1andSRE.MolBiolRep.2006;33(4):287-94。

Summary of the invention

For solving defect and the deficiency of above-mentioned prior art; primary and foremost purpose of the present invention is to determine the expression of ZNF436 and the mutual relation of myocardial hypertrophy, provides a kind of ZNF436 as the application of drug targets in the medicine of screening cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/treatment myocardial hypertrophy.

Object of the present invention is achieved through the following technical solutions:

By test, first the present invention determines that ZNF436 expresses the relation between myocardial hypertrophy:

1, during generation myocardial hypertrophy, the expression of cardiac myocyte hypertrophy mark ANP, β-MHC is obviously raised, and the expression of ZNF436 is also obviously raised

The present invention selects normal person and dilated cardiomyopathy heart, normal sham-operation mice and causes the mouse heart of myocardial hypertrophy by aorta arch constriction operation and respectively by matched group (PBS) or Angiotensin II (AngII) or phyenlephrinium (PE) post-stimulatory myocardial cell, have detected the protein expression situation of ANP, β-MHC, ZNF436 respectively.Result shows, the expression of cardiac myocyte hypertrophy mark ANP, β-MHC in the mouse heart of dilated cardiomyopathy and generation myocardial hypertrophy is obviously raised, the expression of ZNF436 is obviously raised, same at intravascular Angiotensin Converting Enzyme II(AngII) or phyenlephrinium (PE) post-stimulatory myocardial cell in the expression of ANP, β-MHC obviously raise, the expression of ZNF436 is obviously raised (Fig. 1).

2, ZNF436 interference (AdshZNF436) and process LAN (AdZNF436) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

The present invention finds at intravascular Angiotensin Converting Enzyme II(AngII) in the external myocardial hypertrophy model of inducing, the hypertrophy of ZNF436 process LAN myocardial cell is obviously suppressed, and ZNF436 does not express myocardial cell and occurs obviously loose (Fig. 2).

3, ZNF436 gene knockout significantly promotes myocardial hypertrophy, fibrosis, worsens cardiac function

The present invention selects wild-type mice, ZNF436 knock out mice is tested, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research ZNF436 gene knockout is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that the ZNF436 defect knocked out caused by ZNF436 gene significantly worsens myocardial hypertrophy, fibrosis and cardiac function (Fig. 3, Fig. 4, Fig. 5, Fig. 6).

4, ZNF436 gene overexpression significantly suppress myocardial hypertrophy and fibrosis thereof, improves cardiac function

The present invention selects heartspecific ZNF436 transgenic mice and nontransgenic mice to test, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research ZNF436 gene overexpression is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that process LAN ZNF436 gene significantly suppresses myocardial hypertrophy and fibrosis, cardiac function protecting (Fig. 7, Fig. 8, Fig. 9, Figure 10).

By in the known model there is myocardial hypertrophy of above result, the expression of ZNF436 compares remarkable reduction with normal group; Suppress ZNF436 to express and significantly promote myocardial hypertrophy, fibrosis, worsen cardiac function, promote that ZNF436 process LAN then significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.ZNF436 is the inhibitive factor after myocardial hypertrophy disease produces.Therefore the effect that the myocardial hypertrophy relevant disease that ZNF436 has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly ZNF436 that aorta arch constriction can be suppressed to cause occurs.

For the above-mentioned functions of ZNF436, provide the application of a kind of ZNF436, to be ZNF436 apply major embodiment in the medicine preparing cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy.

A medicine for cardioprotection function, comprises ZNF436.

A medicine for anti-cardiac fibrosis, comprises ZNF436.

Prevention, alleviation and/treatment myocardial hypertrophy a medicine, comprise ZNF436.

The present invention has following advantage and effect relative to prior art:

The present invention has following advantage and effect relative to prior art:

(1) the present invention finds the New function of ZNF436 gene, and namely have can cardioprotection function, anti-cardiac fibrosis and suppress the effect of myocardial hypertrophy for ZNF436 gene.

(2) based on ZNF436 at cardioprotection function, anti-cardiac fibrosis with suppress in myocardial hypertrophy disease effect, it may be used for preparing the medicine of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy.

Accompanying drawing explanation

Fig. 1 is the protein expression figure of ANP, β-MHC in normal person and dilated cardiomyopathy patients heart, ZNF436;

A is normal person and the protein expression situation expanding ANP, β-MHC, ZNF436 in cardiaopath's heart;

The up-regulated of dilated cardiomyopathy patients heart ZNF436.(*: p< 0.05vs normal person group)

The expression of B be mice in sham-operation (Sham) and aorta arch constriction operation (AB) afterwards heart ANP, β-MHC, ZNF436;

The up-regulated of the heart ZNF436 that myocardial hypertrophy occurs is described, GAPDH is as internal reference; Wherein 4W represents 4 weeks, 8W represent 8 weeks (*: p< 0.05vs wild-type mice Sham group).

C is the protein expression situation that in In vitro culture neonatal rat primary cardiomyocytes, matched group (PBS) and Angiotensin II (AngII), phyenlephrinium (PE) stimulate rear ANP, β-MHC, ZNF436;

AngII, PE stimulate after ZNF436 up-regulated, GAPDH as internal reference (*: p<0.05vsPBS group)

Fig. 2 is that SD neonatal rat primary cardiomyocytes adenovirus AdshRNA, AdshZNF436, AdGFP and AdZNF436 infect, through the post-stimulatory immunofluorescence figure of Ang II;

Result shows that the interference adenovirus of ZNF436 promotes cardiac myocyte hypertrophy, the process LAN adenovirus of ZNF436 suppress cardiac myocyte hypertrophy (*: p< 0.05vsPBS group, #: p< 0.05vsAng II group).

Fig. 3 is wild-type mice (ZNF436 ^{+ /+}) and ZNF436 knock out mice (ZNF436 ^-/-) the statistics block diagram of HW/BW, LW/BW and HW/TL after AB model 4 weeks;

Wherein HW: cardiac mass; BW: body weight; LW: lungs total amount; TL: tibia length (*: p< 0.05vs wild type Sham group, #: p< 0.05vs wild type AB group).

Fig. 4 is wild-type mice ((ZNF436 ^{+ /+}) and ZNF436 knock out mice (ZNF436 ^-/-) heart tissue HE dyeing and cardiomyocytes cross-sectional area statistics block diagram after AB model 4 weeks;

(*: p< 0.05vs wild type Sham group, # p< 0.05vs wild type AB group).

Fig. 5 is wild-type mice (ZNF436 ^{+ /+}) and ZNF436 knock out mice (ZNF436 ^-/-) within 4 weeks, heart tissue sirius red stains and left room area of collagen add up block diagram to AB model afterwards;

(*: p< 0.05vs wild type Sham group, #: p< 0.05vs wild type AB group).

Fig. 6 is wild-type mice (ZNF436 ^{+ /+}) and ZNF436 knock out mice (ZNF436 ^-/-) the statistics block diagram of cardiac function testing result after AB model 4 weeks;

FS is shortening fraction, LVEDd is LVED (Left Ventricular End Systolic Dimension), LVESd is left room end systolic diameter (*: p< 0.05vs wild type Sham group, #: p< 0.05vs wild type AB group).

The statistics block diagram of Fig. 7 NTG and TG mice AB model HW/BW, LW/BW and HW/TL after 4 weeks;

Wherein HW: cardiac mass; BW: body weight; LW: lungs total amount; TL: tibia length (*: p< 0.05vsNTGSham group, #: p< 0.05vsNTGAB group).

Fig. 8 is the rear heart tissue HE dyeing in 4 weeks of NTG and TG mice AB model and cardiomyocytes cross-sectional area statistics block diagram;

(*: p< 0.05vsNTGSham group, #: p< 0.05vsNTGAB group).

Fig. 9 is NTG and TG mice AB model 4 weeks rear heart tissue sirius red stains and left room area of collagen statistics block diagram;

(*: p< 0.05vsNTGSham group, #: p< 0.05vsNTGAB group).

Figure 10 is the statistics block diagram of NTG and TG mice AB model cardiac function testing result after 4 weeks;

FS is shortening fraction, LVEDd is LVED (Left Ventricular End Systolic Dimension), LVESd is left room end systolic diameter (*: p< 0.05vsNTGSham group, #: p< 0.05vsNTGAB group).

Detailed description of the invention

The features and advantages of the invention can be understood further by reference to the accompanying drawings by following detailed description.The embodiment provided is only the explanation to the inventive method, and does not limit the present invention in any way all the other contents of announcement.

The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition, the condition as described in " molecular cloning: lab guide " the 3rd edition (NewYork:ColdSpringHarborlaboratoryPress, 2005) is carried out.

animal for research and raising

Laboratory animal: select 8-10 week age, body weight at 23.5-27.5g, background be male C57BL/6 wild-type mice (name ZNF436 ^{+ /+}), general ZNF436 knock-out mice (ZNF436 ^-/-), heartspecific ZNF436 transgenic mice (TG) and nontransgenic mice (NTG, littermate control nontransgenic mice) be experimental subject.

The structure of general ZNF436 knock out mice:

We utilize CRISPR-Cas9 technique construction general ZNF436 knock out mice.First, the homing sequence of mice ZNF436 is predicted by online CRISPR design tool (http://crispr.mit.edu).Then clone correlated series by primer (oligo1:TAGGATCCTACACAGAGAGATCTTandoligo2:AAACGTAAAGATCTC TCTGTGTAG) and insert (Addgene5132) in Puc57-sgRNA expression vector.Primer containing T7 promoter and homing sequence RNA is undertaken increase (Forwardprimer:GATCCCTAATACGACTCACTATAGReverseprimer:AAAA AAAGCACCGACTCGGT) by PCR.MEGAshortscriptKit (Amibion, AM1354) andmiRNeasyMicroKit (Qiaen, 217084) is used to transcribe subsequently and purification homing sequence RNA.Cas9 plasmid (Addgene44758) is by T7Ultrakit(Ambion, Am1345) transcribe.The mRNA of Cas9 and homing sequence RNA is injected in unicellular germ cell by FemtoJet5247 micro-injection system.F1 generation and F2 for mice by PCR qualification (PrimersZNF436-F (5 '-CTTAATGCCACTGCCTTCTCG-3 ') andZNF436-R (5 '-TCTCGGAAACGGCAGAAACT-3 ')), final protein product carries out Testing and appraisal by westernblot.

The structure of heartspecific ZNF436 transgenic mice:

With primer (forward primer: TGCTCTAGAGCCACCATGGCAGCCACCCTG, downstream primer: TGCTCTAGATTAGTCCGTATGAACTCTC) increase mice ZNF436 full-length gene (NCBI, ZNF436mus, GENEID:22704), then after the ZNF436 full-length gene of amplification being connected to the pCAG-loxP-CAT-loxP plasmid of our structure, form pCAG-loxP-CAT-loxP-ZNF436-hGHpA carrier (CAG (chickenbeta-actin)-CAT (chloramphenicolacetyltransferase)-ZNF436-hGHpA), the plasmid of structure is configured to fertilized embryo (C57BL/6J background) by microinjection, by the mice that obtains and α-MHC-Cre mouse hybrid, and by tamoxifen induction (tamoxifen 80mg/KG/ days, lumbar injection, continued stimulus 5 days) obtain heartspecific ZNF436 transgenic mouse.After this protein expression situation is identified by westernblot.

Feeding environment: all experiment mices are all raised in SPF level Experimental Animal Center, the large mouse feed of SRF level is purchased from Fukang bio tech ltd of China, Beijing.Rearing conditions: room temperature is between 22-24 DEG C, and humidity is between 40-70%, and it is 12h that light and shade replaces lighting hours, freely drinks water and ingests.

The expression of [embodiment 1] ZNF436 in normal person and expansion cardiaopath heart

Select Normal Human Heart's (individuality of the death donation of non-cardiac reason), expand cardiaopath's heart (doing the receptor of heart transplant operation patient displacement), protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), binding specificity knows ZNF436 albumen and cardiac myocyte hypertrophy mark ANP(Millipore, AB2232), β-MHC(santacruz, sc53090) antibody detects, measure its ZNF436(ATLAS, HPA043817) expression, GAPDH(CellSignalingTechnology, 2128) internal reference is done.Testing result as shown in Figure 1A, obviously raise, and the expression of ZNF436 is obviously raised by the expression of expanding cardiac myocyte hypertrophy mark ANP, β-MHC in cardiaopath's heart.

The expression that [embodiment 2] ZNF436 performs the operation in 4W, 8W heart in wild-type mice Sham group and AB

1. myocardial hypertrophy model adopts aorta arch constriction operation, model manipulation flow process:

1.1 Preoperative Method

(1) anaesthetize: first to mouse weights, calculate required anaesthetic (3% pentobarbital sodium) amount according to 90mg/kg body weight, by lumbar injection, and record some inject time.Folder tail, folder toe without significant reaction and mice in good condition be anesthesia Success criteria (after general injection, about 10min is without significant reaction, and respond with the little mousetrap toe of about 50min after anaesthetizing, after anesthesia, about 30min is best operating time).

(2) art district prepares: by the skin unhairing of left for mice chest, left side chest and left fore oxter.Shave Mao Houyong wet gauze wiping art district and remove Mus hair, be advisable not affect surgical field of view.

(3) tracheal intubation: upper for mice front tooth is fixed on V shaped slab inclined-plane with rubber band, and rapidly tracheal intubation is accurately inserted tracheal strips through glottis, right arm reclining is placed in (heating cushion need shift to an earlier date preheating) on heating cushion subsequently, then tracheal intubation is connected with respirator, fixing mice.If the thorax of mice rises and falls consistent with respirator frequency, tracheal intubation success is described.

1.2 aorta arch constriction arts

Get right arm reclining, mice left fore is placed in above right fore, and is fixed by two forelimbs with medical adhesive tape.Being encased inside cotton swab below right chest, raising thorax, is 75% ethanol to the sterilization of operation area skin by iodine tincture and volume fraction successively.Left hand is held ophthalmic tweezers and has been pinched by left skin of chest, the right hand is held eye scissors and is cut off skin and be about 1cm, separating muscle and soft tissue successively, in 2-3 rib horizontal opening thoracic cavity, slightly push left lung aside with cotton swab, free aortic arch descending branch, by 7-0 sutures through blood vessel, and above blood vessel parallel placement one section of 26G(25.0-27.5g mice) or 27G(23.5-25.0g) syringe needle, by blood vessel and syringe needle, ligation is good together, then extracts the Vasoconstriction that syringe needle can reach respective degrees out.Sew up successively after ligation, close thoracic cavity, extract 1cc gas out to recover negative pressure in thoracic cavity with syringe from sealing insertion thoracic cavity, rapid skin suture otch after extracting syringe.Sham operated rats (Sham) is a threading not ligation after the descending aorta that dissociates, and all the other steps are with myocardial hypertrophy aorta arch constriction operation (AB) model group.

1.3 postoperative care

After aortic arch descending branch ligation, treat that autonomous respiration appears in mice, kickback appears in folder toe, extract tracheal intubation, and mice is put into the rearging cage of bedding and padding, feedstuff and drinking water autoclaving being housed and crossing, continue breeding observing in receptacle.

2. draw materials:

Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.The vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cut heart, be placed in rapidly on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding cryopreservation tube, be placed in liquid nitrogen container rapidly, for molecular Biological Detection after-80 DEG C of Refrigerator stores.

The expression of 3.ZNF436 in Sham mice and AB mouse heart:

Select the heart of wild type Sham mice and AB Post operation 4 weeks and 8 weeks respectively, protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), the antibody of binding specificity identification ZNF436 albumen and cardiac myocyte hypertrophy mark ANP, β-MHC detects, measure the expression of its ZNF436, testing result as shown in Figure 1B.Cardiac myocyte hypertrophy mark obviously raises in the expression of postoperative ANP, β-MHC of AB, and the expression of ZNF436 is in the postoperative obvious rise of AB.

The expression of [embodiment 3] ZNF436 in matched group (PBS) or Angiotensin II (AngII) or phyenlephrinium (PE) post-stimulatory myocardial cell

The newborn 1 day Sprague-Dawley neonatal rat myocardial cell of separation and Culture, liquid is changed after cultivating primary cardiomyocytes 48h, after the hungry myocardial cell 12h of DMEM/F12 adding serum-free makes cell synchronization, give PBS respectively, Angiotensin II (AngII, 1 μM), phyenlephrinium (PE, 1 μM) stimulate 48 hours, protein is extracted to myocardial cell and carries out SDS-PAGE-western blot test (Westernblot), binding specificity identification ZNF436 albumen and cardiac myocyte hypertrophy mark ANP, the antibody of β-MHC detects, measure the expression of its ZNF436, testing result as shown in Figure 1 C.Intravascular Angiotensin Converting Enzyme II(AngII) or phyenlephrinium (PE) post-stimulatory myocardial cell in the expression of ANP, β-MHC obviously raise, the expression of ZNF436 is obviously raised.

The impact that [embodiment 4] ZNF436 disturbs (AdshZNF436) and process LAN (AdZNF436) adenovirus to express the primary cardiomyocytes ZNF436 that AngII stimulates

1. primary newborn SD rat myocardial cells culture

The newborn 1 day Sprague-Dawley neonatal rat myocardial cell of separation and Culture, changes liquid after cultivating primary cardiomyocytes 48h.

2.ZNF436 interference (AdshZNF436) and process LAN (AdZNF436) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

AdshRNA(is containing the adenovirus of shRNA (reticent RNA), with comparing), AdshZNF436(is containing the adenovirus of shRNA-ZNF436 (reticent RNA-ZNF436 fusion rotein)), AdGFP(is containing the adenovirus of GFP (green fluorescent protein), with comparing) and AdZNF436(containing GFP-ZNF436 green fluorescent protein-ZNF436 fusion rotein) adenovirus) adenovirus 10MOIs infects the cultivation primary cardiomyocytes of 3 days respectively, with 1 μM of Angiotensin II (AngII) (available from Sigma after 12 hours, A9525) or contrast PBS stimulate 48 hours, then immunofluorescence test is carried out.Result shows the comparatively AdshRNA matched group increase of the myocardial cell surface area after AdshZNF436 adenovirus infection, and the myocardial cell surface area infected through AdZNF436 then obviously reduces (Fig. 2) than matched group AdGFP.

[embodiment 5] mouse cardiac muscle plumpness (AB) model myocardial hypertrophy and fibrosis detect

1. myocardial hypertrophy model adopts aorta arch constriction operation, model manipulation flow process:

Select 8-10 age in week, body weight is respectively divided into sham operated rats and myocardial hypertrophy model group at the wild-type mice of 23.5-27.5g, ZNF436 knock out mice, heartspecific ZNF436 transgenic mice and nontransgenic mice, often organize 10 mices.Modeling method is with embodiment 2.

2. draw materials

(1) previous work: the urine cup preparing volume fraction 10% formaldehyde that 20mL is housed in advance, and post label (mouse number, group, type of surgery and draw materials the date).The culture dish filling mass fraction 10%KCl solution is placed in the place that draws materials.Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.

(2) draw materials: the vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cuts heart, be placed in rapidly mass fraction 10%KCl solution.Until cardiac arrest after relaxing period, be placed on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding urine cup, detect for pathology after fixing 48h.

(3) measurement of correlation and calculating: take out mice lungs, after pruning, filter paper blots, and weighs and record.Cut off mouse hind leg tibia place skin, measure and record tibia length.Calculate the heart and weigh the ratio (HW/BW) with body weight, lung weighs with the ratio (LW/BW) of body weight and the heart is heavy and the ratio (HW/TL) of tibia length.

3. pathology detect

3.1 prepare paraffin specimen section

Main operation sequence comprises pruning heart → embedding frame process → running water → dehydration → transparent → waxdip → embedding → section → stand sheet → dry or for subsequent use after toasting.

3.2 hematoxylin-eosins (HE) dye

Key step is: 55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → washing 1min → 1% hydrochloride alcohol (getting 3mL concentrated hydrochloric acid fully to mix homogeneously with 297mL70% ethanol) 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, Magnesium sulfate heptahydrate 2g, both are dissolved in 100mL distilled water) 1min → washing 1min → Yihong solution (Zhuhai shellfish rope, BA-4024) 3-5min → distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of in the not dry mounting → fume hood immediately of dimethylbenzene and dry up, microscope is taken pictures.

HE dyeing picture statistics: every pictures selects more than 3 clear border, and core is roughly positioned at the cell of central authorities, with Image-ProPlus6.0 software circle cell area.

3.3 Picro-Sirius reds (PSR) dye

Key step is: 55 DEG C of baking 30min → dimethylbenzene 2min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → running water 10min → distilled water 1min → mass fraction 0.2% phosphomolybdic acid 2min → 0.1% sirius red picric acid solution drips in tissue, dye in wet box 90min → removal residual liquid → 0.01N hydrochloric acid 4s → 70% ethanol 1 time → 90% ethanol 1 time → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of dimethylbenzene not dry coverslip immediately mounting, microscope is taken pictures.

PSR dyeing picture statistics (Image-ProPlus6.0 software): collagen ratio=area of collagen/(gross area-blank area) × 100%.

Cardiac muscular tissue is made up of myocardial cell and stroma, and heart is a whole end differentiation organ, and myocardial cell loses multiplication capacity, the myocardial cell reaction that various physiology or pathological stimuli cause, and can only be that the volume of individual cells increases and can not quantitatively breed.Therefore, in the pathophysiological process of myocardial hypertrophy, main manifestations is that myocardial cell volume increases, muscle segment increasing number, cell arrangement is disorderly, and cardiac mesenchymal changes the propagation and the conversion that comprise Cardiac Fibroblasts, collagen fiber density increases, and collagen secretion increases, collagen proportional balancing method imbalance etc.

ZNF436 ^{+ /+}and ZNF436 ^-/-phenotypic results after mice AB model is shown in Fig. 3-5.Sham(sham-operation) ZNF436 in group ^{+ /+}and ZNF436 ^-/-the equal not statistically significant of difference between HW/BW, LW/BW and HW/TL of mice; ZNF436 ^{+ /+}mice AB HW/BW, LW/BW, HW/TL of postoperative 4 weeks are higher than its Sham group; Postoperative 4 weeks of AB, ZNF436 ^-/-hW/BW, LW/BW and HW/TL all comparatively ZNF436 of mice ^{+ /+}mice rises (Fig. 3).HE stained can be observed: Sham group heart no significant difference, AB group all increases compared with the heart of Sham group, ZNF436 ^-/-the heart of mice is obviously greater than ZNF436 ^{+ /+}group mice; Sham group myocardium myo fibril cell arrangement is neat, fine and close, and form is complete, karyon and nucleolar structure clear; AB group myofilament arrangement disorder, loose, myocardial cell volume obviously increases, form irregularity, karyon engrain, increase, deformity, and kernel is fuzzy, ZNF436 ^-/-group is then than ZNF436 ^{+ /+}group cellular mast is obvious, and difference has statistical significance (Fig. 4).After PSR dyeing, find the comparatively Sham group increase of AB group myocardium of ventricle interstitial collagen content, around arteries, collagen increase is more obvious, and collagen increases thick, and arrangement disorder becomes network-like; ZNF436 ^-/-the postoperative collagen content of mice AB and perivascular collagen content are then than ZNF436 ^{+ /+}the postoperative increase of mice AB more (Fig. 5).These results suggest that, after AB model, obvious myocardial hypertrophy occurs mice, ZNF436 ^-/-myocardial hypertrophy and the fibrosis of mice are greater than ZNF436 ^{+ /+}mice.

Fig. 7-9 is the phenotypic results after NTG and ZNF436-TG mice AB model.Same TG mice AB HW/BW, LW/BW and HW/TL of postoperative 4 weeks are lower than its Sham group; The degree that HW/BW, LW/BW and HW/TL of AB postoperative 4 weeks TG mices increase is significantly less than NTG mice (Fig. 7).Cardiac phenotype, AB group all increases compared with the heart of Sham group, and the degree that the postoperative TG mouse heart of AB increases is much smaller than NTG mice.HE stained can be observed: TG mice AB postoperative myocardial cell cross section is long-pending is greater than Sham group, is significantly less than NTG mice AB group (Fig. 8).PSR dyeing is visible, and TG mice AB postoperative myocardial interstitial collagen content and perivascular collagen content are less than NTG mice AB group (Fig. 9).These results suggest that, after AB model, obvious myocardial hypertrophy occurs mice, the myocardial hypertrophy of ZNF436-TG mice and fibrosis are less than NTG mice.

[embodiment 6] myocardial hypertrophy (AB) model mice cardiac function detects

1 ultrasound detection cardiac function

1.1 early-stage preparations

(1) anesthetic machine prepares: first connect the intake interface on oxygen cylinder and anesthetic machine, then turn on dosing mouth seal cover on anesthetic machine, tighten seal cover after adding rapidly isoflurane to safe scale.Turn on total valve on oxygen cylinder, the knob of adjustment flow control valve, outlet pressure maintains 0.2-0.3mPa.

(2) mice to be measured prepares: after mice to be detected is anaesthetized rapidly with isoflurane, hair is shaved in left anterior pectorial region, the mouse head handled well is stretched into anesthetis conduit pullover in, maintain the stable narcotism of mice with 1.5-2.0% isoflurane.

1.2 cardiac function detect

Mice gets left lateral position or dorsal position, and is shaving hair-fields uniform application ultrasonic coupling agent (Tianjin Cheng Xin company).Adopt high-frequency ultrasound in diagnosis instrument, frequency is 15MHz, selection standard papillary muscles of left ventricle short axis view, measures LVED (Left Ventricular End Systolic Dimension) (LVEDd), left room end systolic diameter (LVESd)) and shortening fraction (FS).

Fig. 6 is ZNF436 ^{+ /+}and ZNF436 ^-/-cardiac function testing result figure after mice AB model.With ZNF436 ^{+ /+}sham group is compared, ZNF436 ^{+ /+}mice AB shows decreased cardiac function and myocardial hypertrophy in postoperative 4 weeks, and main manifestations is that index LVEDd, the LVESd of myocardial hypertrophy increases, and reflects that the index FS of cardiac function then declines.Postoperative 4 weeks of AB, ZNF436 ^-/-the cardiac function deterioration degree of mice is greater than ZNF436 ^{+ /+}mice.

Figure 10 is the ultrasonic testing results after NTG and ZNF436-TG mice AB model.Compared with NTGSham group, NTG mice AB shows decreased cardiac function and myocardial hypertrophy in postoperative 4 weeks.Main manifestations is that index LVEDd, the LVESd of myocardial hypertrophy increases, and reflects that the index FS of cardiac function then declines.Postoperative 4 weeks of AB, compared with NTG mice, the degree that the degree of the index increase of TG mouse cardiac muscle plumpness and the index of reflection cardiac function decline then is less than NTG group.

From above result; in the myocardial hypertrophy disease model that aorta arch constriction causes, ZNF436 genetic flaw significantly promotes myocardial hypertrophy, fibrosis, worsens cardiac function; ZNF436 gene overexpression significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.Therefore the effect that the myocardial hypertrophy relevant disease that ZNF436 gene has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly ZNF436 gene that aorta arch constriction can be suppressed to cause occurs.

Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

SEQUENCELISTING

<110> Wuhan University

<120> zinc finger protein 43 6(ZNF436) treating the application in myocardial hypertrophy

<130>1

<160>8

<170>PatentInversion3.3

<210>1

<211>24

<212>DNA

<213>Artificial

The structure forward primer of <223> general ZNF436 knock out mice

<400>1

taggatcctacacagagagatctt24

<210>2

<211>24

<212>DNA

<213>Artificial

The structure downstream primer of <223> general ZNF436 knock out mice

<400>2

aaacgtaaagatctctctgtgtag24

<210>3

<211>24

<212>DNA

<213>Artificial

<223> contains the forward primer of T7 promoter and homing sequence RNA

<400>3

gatccctaatacgactcactatag24

<210>4

<211>20

<212>DNA

<213>Artificial

<223> contains the downstream primer of T7 promoter and homing sequence RNA

<400>4

aaaaaaagcaccgactcggt20

<210>5

<211>21

<212>DNA

<213>Artificial

<223> general ZNF436 knock out mice PCR identifies forward primer

<400>5

cttaatgccactgccttctcg21

<210>6

<211>20

<212>DNA

<213>Artificial

<223> general ZNF436 knock out mice PCR identifies downstream primer

<400>6

tctcggaaacggcagaaact20

<210>7

<211>30

<212>DNA

<213>Artificial

<223> mice ZNF436 full-length gene amplification forward primer

<400>7

tgctctagagccaccatggcagccaccctg30

<210>8

<211>28

<212>DNA

<213>Artificial

<223> mice ZNF436 full-length gene amplification downstream primer

<400>8

tgctctagattagtccgtatgaactctc28

Claims (8)

1. zinc finger protein 43 6 gene is as the application of drug targets in the medicine of screening cardioprotection function.

2. the application of zinc finger protein 43 6 gene according to claim 1 in the medicine of screening cardioprotection function, is characterized in that: described medicine, refers to the medicine that can promote zinc finger protein 43 6 gene expression.

3. the application of zinc finger protein 43 6 in the medicine preparing cardioprotection function.

4. a medicine for cardioprotection function, is characterized in that: comprise zinc finger protein 43 6.

5. zinc finger protein 43 6 gene as drug targets screening anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine in application.

6. zinc finger protein 43 6 gene according to claim 5 screening anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine in application, it is characterized in that: described medicine, refer to the medicine that can promote zinc finger protein 43 6 gene expression.

7. zinc finger protein 43 6 preparation anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine in application.

8. a medicine for anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy, is characterized in that: comprise zinc finger protein 43 6.