CN105194660A - Function and application of ubiquitin-specific protease 18 (USP18) on treatment of cardiac hypertrophy - Google Patents

Abstract

The invention discloses a function and application of ubiquitin-specific protease 18 (USP18) on treatment of cardiac hypertrophy, and belongs to the field of functions and application of genes. A mutual relation between USP18 expression and the cardiac hypertrophy is determined, and a research result shows that in a model suffering from the cardiac hypertrophy, USP18 expression is obviously lower than that of a normal group; and cardiac hypertrophy and fibrosis are promoted and a cardiac function is worsened by inhibiting USP18 expression, and cardiac hypertrophy and fibrosis are obviously inhibited and the cardiac function is protected by promoting USP18 overexpression. Therefore, the USP18 can serve as a target gene, is used for screening medicines for protecting the cardiac function, resisting cardiac fibrosis and/or preventing and relieving and/or treating cardiac hypertrophy, and is used for preparing medicines for protecting the cardiac function, resisting cardiac hypertrophy and/or preventing and relieving and/or treating cardiac hypertrophy, and a new effective path is provided for treatment of cardiac hypertrophy cardiac hypertrophy.

Description

Ubiquitin specific proteinase 18(USP18) treating the function and application in myocardial hypertrophy

Technical field

The invention belongs to function and the application of gene, particularly a kind of ubiquitin specific proteinase 18(USP18) treating the function and application in myocardial hypertrophy.

Background technology

Myocardial hypertrophy is the compensatory response that cardiac muscle increases chronobiological mechanical pressure or volumetric loading, be common in the cardiovascular disease such as hypertension, aortic stenosis, its main manifestations is the features [1-3] such as myocardial cell volume increases, albumen synthesis increases, extracellular matrix increases.Hypertension, Senile degenerative aortic valve disease in China in ascendant trend year by year.Myocardial hypertrophy caused by the diseases such as hypertension, hypertensive heart disease sickness rate also increase thereupon.Although myocardial hypertrophy can make myocardial cell increase at first, myocardial contraction is strengthened, it is a kind of compensatory mechanism maintaining normal cardiac output, but the pressure of long duration or volumetric loading overweight, can cause myocardial remodelling, simultaneously because myocardium requirementing keto quantity increases, and coronary blood is for relative deficiency, cause myocardial ischemia, apoptosis of cardiac muscle, and then cause mistake compensatory, thus cause [4,5] such as heart failure, malignant arrhythmia, even sudden deaths.Research shows developing along with heart left chamber plumpness, and the incidence rate of the cardiovascular event such as myocardial ischemia, ventricular arrhythmia, heart failure, sudden death adds 6 ~ 10 times [6].

Think that myocardial hypertrophy is the dynamic process that one kind of multiple factors participate in the complexity regulated at present.Research finds long-term biomechanics pressure and/or volumetric loading excessively, ventricle wall stress is increased, causes myocardial hypertrophy.In addition, various born of the same parents' external stimulus signals such as Angiotensin II (AngII), Endothelin (ET), catecholamine, transforming growth factor-β (TGF-β) can induce the change of gene expression in core, thus cause cardiac myocyte hypertrophy [7-11].Divide three links from the pathological process of molecular level myocardial hypertrophy: gene transcription activating in the appearance of the outer plump stimulus signal of born of the same parents, intracellular signal transduction and core, finally bring out cell and loose character mutation occurs.Current research has shown the process that many A signal pathways participates in myocardial hypertrophy.Wherein, calcineurin calcineurin/NFAT, mitogen activated protein kinase (MAPK) and PI3K/Akt/GSK3 signal beta Signal Transduction Pathways and downstream transcription factor MCIP1.4, NF-κ B, AP-1, MEF2, mTOR etc. of being regulated by these three paths play an important role [1 in the developing of myocardial hypertrophy, 2,12-17].Calcineurin (calcineurin) is a kind of multifunctional signal enzyme regulated by calcium ion and calmodulin, by making nuclear factor of activated T cells (nuclearfactorofactivatedTcells, NFAT) transposition enters core, regulate the expression [18,19] of loose gene (ANP, BNP) in core.MAPK comprises three subfamilies [20]: ERKs, JNKs and p38-MAPK.The MAPKs of phosphorylation activates the transcriptional activity promoting downstream transcription factor NF-κ B, AP-1, MEF2, the NFAT etc. relevant with myocardial hypertrophy, and regulates cytogene to transcribe and albumen synthesis, causes cardiac myocyte hypertrophy, causes myocardial hypertrophy [20].

Ubiquitin specific proteinase 18(USP18) be IFN main reverse feedback regulation person in vivo, be cloned out first in 1999 when studying leukemia mouse, its cDNA comprises the exploitation reading frame of 1107bp, coding 368 aminoacid altogether, molecular weight is 43kDa, therefore be named as UBP43(UbiquitinProcessingProtein the earliest), rear discovery its there is the effect of ubiquitin hydrolases, be included into ubiquitin hydrolases (UbiquitinSpecificProteinase, USP) family, therefore this gene is named as USP18 by discovery sequencing again.USP18 is positioned the mankind No. 22 chromosome/mices No. 6 chromosomes, it is closely related that the region 22q11.2 that mankind USP18 gene is located is called the syndromic disease of diGeorge with one just, and this syndrome characteristic shows as thymic hypoplasia and Congenital Heart dysplasia.In wild type adult mouse, USP18 at thymus, peritoneal macrophage high expressed.To the analysis prompting of the different hematopoietic cell system of mice, USP18 only expresses in monokaryon relevant cell system.

Because USP18 has the negative-feedback regu-lation effect to 1 type IFN path, people find in the research of IFN being treated to hepatitis B, and the patient USP18 of IFN treatment opposing increases at liver expression, and prompting USP18 can be used as the index judging IFN treatment response.Research finds, after wild-type mice gives IFN multiple injection, IFN signal path is in nonreply state very soon, and the JAK-STATs signal path of USP18 knock out mice is in lasting phosphorylation state, and prompting IFN signal path exists hypersensitive state.In addition, interferon can apoptosis-inducedly react, and has research prompting, and the cell of USP18 gene silencing gives the apoptosis-promoting effect can strengthening IFN after interferon stimulates, but respectively have at its short apoptosis pathway of different cell line need not.USP18, except having the effect of reverse feedback regulation IFN signal path, also has the activity of hydrolytic enzyme, and this enzymatic activity is embodied in 1. USP18 can make the albumen of ubiquitination go ubiquitination to react (deUbiquitination); The albumen that 2. generation ISGyaltion can be made to modify goes ISGylation to modify, and (deISGylation, ISGylation modify, refer to that ISG15 albumen is combined with target protein, this step is similar to ubiquitination, relate to E1, E2, E3 enzyme), the enzyme hydrolysis effect of these 2 kinds of USP18 above-mentioned depends on the cysteine of the 61st, this site is considered to the enzyme active sites of USP18, and this site mutation makes USP18 gene lose the effect of removing ubiquitination and going ISGylation to modify.Nearest research confirms that the ubiquitination of going of TAK1-TAB1 complex is mediated by USP18, USP18 makes TAK1 inactivation by going ubiquitination effect, and the activation of TAK1 is required for the activation of downstream NF-κ B and NFAT, this research prompting USP18 participates in regulation and control inflammatory reaction by removing ubiquitination target protein.UBE1L, ISG15 and USP18 dysregulation is found to be present in polytype tumor, research finds, USP18 process LAN can play stable cyclinD1 albumen, to anti-apoptotic, promote the effect of tumor cell proliferation, and this effect be depend on USP18 go ISGylation modification.Contrary, USP18KO mice, ISGylation modifies and obviously raises, and increases with obvious apoptosis simultaneously, and the ISGylation modification of going of prompting USP18 may have close ties with cell proliferation, apoptosis.

List of references:

1.LiH,HeC,FengJ,ZhangY,TangQ,BianZ,BaiX,ZhouH,JiangH,HeximerSP,QinM,HuangH,LiuPP,HuangC.Regulatorofgproteinsignaling5protectsagainstcardiachypertrophyandfibrosisduringbiomechanicalstressofpressureoverload.ProcNatlAcadSciUSA.2010;107:13818-13823.

2.LuJ,BianZY,ZhangR,ZhangY,LiuC,YanL,ZhangSM,JiangDS,WeiX,ZhuXH,ChenM,WangAB,ChenY,YangQ,LiuPP,LiH.Interferonregulatoryfactor3isanegativeregulatorofpathologicalcardiachypertrophy.BasicResCardiol.2013;108:326.

3.LiH,TangQZ,LiuC,MoonM,ChenM,YanL,BianZY,ZhangY,WangAB,NghiemMP,LiuPP.Cellularflice-inhibitoryproteinprotectsagainstcardiacremodelinginducedbyangiotensiniiinmice.Hypertension.2010;56:1109-1117.

4.BuiAL,HorwichTB,FonarowGC.Epidemiologyandriskprofileofheartfailure.NatRevCardiol.2011;8:30-41.

5.DiwanA,DornGW,2nd.Decompensationofcardiachypertrophy:Cellularmechanismsandnoveltherapeutictargets.Physiology(Bethesda).2007;22:56-64.

6.ZileMR,GottdienerJS,HetzelSJ,McMurrayJJ,KomajdaM,McKelvieR,BaicuCF,MassieBM,CarsonPE.Prevalenceandsignificanceofalterationsincardiacstructureandfunctioninpatientswithheartfailureandapreservedejectionfraction.Circulation.2011;124:2491-2501.

7.AiD,PangW,LiN,XuM,JonesPD,YangJ,ZhangY,ChiamvimonvatN,ShyyJY,HammockBD,ZhuY.Solubleepoxidehydrolaseplaysanessentialroleinangiotensinii-inducedcardiachypertrophy.ProcNatlAcadSciUSA.2009;106:564-569.

8.KurdiM,BoozGW.Newtakeontheroleofangiotensiniiincardiachypertrophyandfibrosis.Hypertension.2011;57:1034-1038.

9.KomatiH,MaharsyW,BeauregardJ,HayekS,NemerM.Zfp260isaninducerofcardiachypertrophyandanuclearmediatorofendothelin-1signaling.JBiolChem.2011;286:1508-1516.

10.RamunddalT,LindbomM,TangMS,ShaoY,BorenJ,OmerovicE.Overexpressionofapolipoproteinbattenuatespathologiccardiacremodelingandhypertrophyinresponsetocatecholaminesandaftermyocardialinfarctioninmice.ScandJClinLabInvest.2012;72:230-236.

11.KoitabashiN,DannerT,ZaimanAL,PintoYM,RowellJ,MankowskiJ,ZhangD,NakamuraT,TakimotoE,KassDA.Pivotalroleofcardiomyocytetgf-betasignalinginthemurinepathologicalresponsetosustainedpressureoverload.JClinInvest.2011;121:2301-2312.

12.LiHL,WangAB,HuangY,LiuDP,WeiC,WilliamsGM,ZhangCN,LiuG,LiuYQ,HaoDL,HuiRT,LinM,LiangCC.Isorhapontigenin,anewresveratrolanalog,attenuatescardiachypertrophyviablockingsignalingtransductionpathways.FreeRadicBiolMed.2005;38:243-257.

13.YanL,WeiX,TangQZ,FengJ,ZhangY,LiuC,BianZY,ZhangLF,ChenM,BaiX,WangAB,FassettJ,ChenY,HeYW,YangQ,LiuPP,LiH.Cardiac-specificmindinoverexpressionattenuatescardiachypertrophyviablockingakt/gsk3betaandtgf-beta1-smadsignalling.CardiovascRes.2011;92:85-94.

14.CaiJ,YiFF,BianZY,ShenDF,YangL,YanL,TangQZ,YangXC,LiH.Crocetinprotectsagainstcardiachypertrophybyblockingmek-erk1/2signallingpathway.JCellMolMed.2009;13:909-925.

15.CaiJ,YiFF,YangL,ShenDF,YangQ,LiA,GhoshAK,BianZY,YanL,TangQZ,LiH,YangXC.Targetedexpressionofreceptor-associatedlatetransducerinhibitsmaladaptivehypertrophyviablockingepidermalgrowthfactorreceptorsignaling.Hypertension.2009;53:539-548.

16.BianZY,HuangH,JiangH,ShenDF,YanL,ZhuLH,WangL,CaoF,LiuC,TangQZ,LiH.Limandcysteine-richdomains1regulatescardiachypertrophybytargetingcalcineurin/nuclearfactorofactivatedtcellssignaling.Hypertension.2010;55:257-263.

17.XiaoJ,MoonM,YanL,NianM,ZhangY,LiuC,LuJ,GuanH,ChenM,JiangD,JiangH,LiuPP,LiH.Cellularflice-inhibitoryproteinprotectsagainstcardiacremodellingaftermyocardialinfarction.BasicResCardiol.2012;107:239.23.

18.LiuQ,ChenY,Auger-MessierM,MolkentinJD.Interactionbetweennfkappabandnfatcoordinatescardiachypertrophyandpathologicalremodeling.CircRes.2012;110:1077-1086.

19.WilkinsBJ,DaiYS,BuenoOF,ParsonsSA,XuJ,PlankDM,JonesF,KimballTR,MolkentinJD.Calcineurin/nfatcouplingparticipatesinpathological,butnotphysiological,cardiachypertrophy.CircRes.2004;94:110-118.

20.RoseBA,ForceT,WangY.Mitogen-activatedproteinkinasesignalingintheheart:Angelsversusdemonsinaheart-breakingtale.PhysiolRev.2010;90:1507-1546。

Summary of the invention

For solving defect and the deficiency of above-mentioned prior art; the object of the invention is to determine the expression of USP18 and the mutual relation of myocardial hypertrophy, the new opplication of a kind of USP18 in the medicine preparing cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/treatment myocardial hypertrophy is provided.

Object of the present invention is achieved through the following technical solutions:

The present invention determines the relation between USP18 expression with myocardial hypertrophy by test:

1, during generation myocardial hypertrophy, the expression of cardiac myocyte hypertrophy mark ANP, β-MHC is obviously raised, and the expression of USP18 is obviously raised

The present invention selects normal person and dilated cardiomyopathy heart respectively, normal sham-operation (Sham) mice and cause the mouse heart of myocardial hypertrophy by aorta arch constriction operation (AB), have detected the protein expression situation of ANP, β-MHC, USP18 respectively.Result shows, the expression of cardiac myocyte hypertrophy mark ANP, β-MHC in the mouse heart of dilated cardiomyopathy and generation myocardial hypertrophy is obviously raised, and the expression of USP18 is obviously raised (Fig. 1, Fig. 2).

2, USP18 interference (AdshUSP18) and process LAN (AdUSP18) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

The present invention finds at intravascular Angiotensin Converting Enzyme II(AngII) in the external myocardial hypertrophy model of inducing, the hypertrophy of USP18 process LAN myocardial cell is obviously suppressed, and USP18 does not express myocardial cell and occurs obviously loose (Fig. 3).

3, USP18 gene knockout significantly promotes myocardial hypertrophy, fibrosis, worsens cardiac function

The present invention selects wild-type mice, USP18 knock out mice is tested, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research USP18 gene knockout is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that the USP18 defect knocked out caused by USP18 gene significantly worsens myocardial hypertrophy, fibrosis and cardiac function (Fig. 4, Fig. 5, Fig. 6, Fig. 7).

4, USP18 gene overexpression significantly suppress myocardial hypertrophy and fibrosis thereof, improves cardiac function

The present invention selects heartspecific USP18 transgenic mice and nontransgenic mice to test, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research USP18 gene overexpression is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that process LAN USP18 gene significantly suppresses myocardial hypertrophy and fibrosis, cardiac function protecting (Fig. 8, Fig. 9, Figure 10, Figure 11).

By in the known model there is myocardial hypertrophy of above result, the expression of USP18 compares remarkable rising with normal group; Suppress USP18 to express and significantly promote myocardial hypertrophy, fibrosis, worsen cardiac function, promote that USP18 process LAN then significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.Therefore USP18 has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly USP18 to have the effect of the myocardial hypertrophy relevant disease generation that aorta arch constriction can be suppressed to cause.

The function of USP18 in myocardial hypertrophy, is mainly reflected in the effect that USP18 has cardiac function protecting and suppress the effect, particularly USP18 of myocardial hypertrophy to have the myocardial hypertrophy generation that aorta arch constriction can be suppressed to cause.

For the above-mentioned functions of USP18; the application of a kind of USP18 is provided; application, particularly USP18 that major embodiment is USP18 in cardioprotection, anti-cardiac fibrosis and treatment myocardial hypertrophy screening or prepare cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine in apply.Described application comprises USP18 directly as the effective ingredient of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine, and the chemical substance that USP18 can be promoted to express is indirectly as cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or the effective ingredient for the treatment of myocardial hypertrophy medicine.

A medicine for cardioprotection function, comprises USP18.

A medicine for anti-cardiac fibrosis, comprises USP18.

Prevention, alleviation and/treatment myocardial hypertrophy a medicine, comprise USP18.

The present invention has following beneficial effect:

Present invention finds the New function of USP18 gene, namely have can cardioprotection function, anti-cardiac fibrosis and suppress the effect of myocardial hypertrophy for USP18 gene.Therefore; USP18 can be used as target gene; for screening the medicine of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy; for the preparation of the medicine of cardioprotection function, resisting cardiac hypertrophy and/or prevention, alleviation and/or treatment myocardial hypertrophy, the treatment for myocardial hypertrophy provides an effective new way.

Accompanying drawing explanation

Fig. 1 is ANP, β-MHC in normal person and DCM (dilated cardiomyopathy) (expansion cardiopathia) patient's heart, the protein expression situation of USP18 and statistics block diagram, the up-regulated (*: p < 0.05vs normal person group) of dilated cardiomyopathy patients heart USP18.

The expression of Fig. 2 be wild-type mice in sham-operation (Sham) and aorta arch constriction operation (AB) afterwards heart ANP, β-MHC, USP18 and statistics block diagram, GAPDH is as internal reference, wherein 4W represents 4 weeks, 8W represents 8 weeks, and the up-regulated (*: p < 0.05vs wild-type mice Sham group) of the heart USP18 of myocardial hypertrophy occurs.

Fig. 3 is that SD neonatal rat primary cardiomyocytes adenovirus AdshRNA, AdshUSP18, AdGFP and AdUSP18 infect, through the post-stimulatory immunofluorescence of AngII and cell surface area statistics block diagram, the interference adenovirus of USP18 promotes cardiac myocyte hypertrophy, the process LAN adenovirus of USP18 suppresses cardiac myocyte hypertrophy (*: p < 0.05vsPBS group, #:p < 0.05vsAngII group).

Fig. 4 is the statistics block diagram of wild-type mice (WT) and USP18 knock out mice (USP18-KO) AB art HW/BW, LW/BW and HW/TL after 4 weeks; Wherein, HW is cardiac mass, and BW is body weight, and LW is lungs total amount, and TL is tibia length (*: p < 0.05vsWTSham group, #:p < 0.05vsWTAB group).

Fig. 5 is ventricle cross sections and heart tissue HE dyeing, WGA dyeing and cardiomyocytes cross-sectional area statistics block diagram after wild-type mice (WT) and USP18 knock out mice (USP18-KO) AB art 4 weeks, wherein 4w represents 4 weeks (*: p < 0.05vsWTSham group, #p < 0.05vsWTAB group).

Fig. 6 is heart tissue sirius red stains and left room area of collagen statistics block diagram after wild-type mice (WT) and USP18 knock out mice (USP18-KO) AB art 4 weeks, wherein 4w represents 4 weeks (*: p < 0.05vsWTSham group, #:p < 0.05vsWT type AB group).

Fig. 7 is the statistics block diagram of wild-type mice (WT) and USP18 knock out mice (USP18-KO) AB art cardiac function testing result after 4 weeks; EF is ejection fraction, and LVEDd is LVED (Left Ventricular End Systolic Dimension), and LVSDd is left room end systolic diameter (*: p < 0.05vsWTSham group, #:p < 0.05vsWTAB group).

The statistics block diagram (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group) of Fig. 8 NTG and TG mice AB art HW/BW, LW/BW and HW/TL after 4 weeks.

Fig. 9 is NTG and TG mice AB art 4 weeks rear heart cross sections and heart tissue HE dyeing, WGA dyeing and cardiomyocytes cross-sectional area statistics block diagram, wherein 4w represents 4 weeks (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Figure 10 is NTG and TG mice AB art 4 weeks rear heart tissue sirius red stains and left room area of collagen statistics block diagram, and wherein 4w represents 4 weeks (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Figure 11 is the statistics block diagram of NTG and TG mice AB art cardiac function testing result after 4 weeks; EF is ejection fraction, and LVEDd is LVED (Left Ventricular End Systolic Dimension), and LVESd is left room end systolic diameter (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Detailed description of the invention

Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited thereto.

Animal for research and raising

Laboratory animal: select 8-10 age in week, body weight is at 23.5-27.5g, background is the wild-type mice (WT) of male C57BL/6, general USP18 knock out mice (USP18-KO), heartspecific USP18 transgenic mice (USP18-TG) and nontransgenic mice (NTG, littermate control nontransgenic mice) are experimental subject.

(1) structure of general USP18 knock out mice:

Utilize CRISPR-Cas9 technique construction general USP18 knock out mice.First, predicted the homing sequence of mice USP18 by online CRISPR design tool (http://crispr.mit.edu), design 2 strand oligo:

oligo1：TAGGCGGCTCAGCCACAACTGAC，

oligo2：AAACGTCAGTTGTGGCTGAGCCG。

Oligo1 and oligo2 annealing forms double-stranded DNA, double-stranded DNA is connected into the pUC57-sgRNA(Addgene51132 through limit BsaI enzyme action) build sgRNA expression vector.

With the sgRNA expression vector of above-mentioned structure for template, following primer is used to contain the DNA fragmentation of T7 promoter and homing sequence by pcr amplification:

Forwardprimer：GATCCCTAATACGACTCACTATAG，

Reverseprimer：AAAAAAAGCACCGACTCGGT。

With increased PCR primer for template uses MEGAshortscriptKit(Ambion, AM1354) carry out in vitro transcription; Cas9 plasmid (Addgene44758) is by T7Ultrakit(Ambion, Am1345) transcribe.The mRNA that will transcribe Cas9 and the homing sequence RNA obtained uses miRNeasyMicroKit(Qiaen, 217084) after purification, be injected into by FemtoJet5247 micro-injection system in the unicellular germ cell of wild type C57BL/6 mice.Choose the germ cell survived after microinjection, be transplanted in healthy female Mus fallopian tube, obtained F0 for mice through 21 days after gestation.

F1 generation and F2 are identified by PCR for mice, and wild-type mice comprises the DNA sequence of a segment length 366bp, and mutant mice (USP18 knock out mice) DNA sequence containing 314bp, final protein product carries out Testing and appraisal by westernblot.Wherein, PCR identifies that primer is as follows:

USP18-366-F：5’-GGGTCATTTGTCTCCGGCTT-3’，

USP18-366-R：5’-TAAGCACACGGAAAGTCGCT-3’。

Testing mice used is mutant homozygote.

(2) structure of heartspecific USP18 transgenic mice:

With wild type C57BL/6 mice USP18 gene cDNA (Openbiosystem, 8861597) for template, with following primer PCR amplification mice USP18 full-length gene (NCBI, USP18musNM_011909.2):

Forward primer: CTAGCTAGCGCCACCATGGGCAAGGGGTTTGGGCTCCTGAGGAA,

Downstream primer: CTAGCTAGCTCAGGATCCAGTCTTCGTGT.

(pCAG-loxP-CAT-loxP plasmid is provided by Beijing Union Medical College basis institute teacher Yang Qinglin for the USP18 full-length gene of amplification and pCAG-loxP-CAT-loxP plasmid, preparation process is see document: KimT, ZhelyabovskaO, LiuJ, etal.GenerationofanInducible, Cardiomyocyte-SpecificTransgenicMouseModelwithPPARb/dOve rexpression [J] .PeroxisomeProliferator-ActivatedReceptors (PPARs), 57.) through NheI(NEB, #R0131L) connect after enzyme action, form pCAG-loxP-CAT-loxP-USP18-hGHpA carrier (CAG (chickenbeta-actin)-CAT (chloramphenicolacetyltransferase)-USP18-hGHpA), the plasmid of structure is injected into by micro-injection system in the unicellular germ cell of wild type C57BL/6 mice, this zygote transplation enters in healthy female Mus, growth obtains F0 for mice.By the F0 that obtains for mice and α-MHC-Cre mouse hybrid; and by tamoxifen induction (tamoxifen 80mg/kg/ days; lumbar injection; continued stimulus 5 days) (above-mentioned transgenic mice is prepared with reference to following document: JiangDS to obtain heartspecific USP18 transgenic mouse; BianZY; ZhangY; ZhangSM; LiuY, ZhangRetal.Roleofinterferonregulatoryfactor4intheregulat ionofpathologicalcardiachypertrophy.Hypertension2013; 61:1193-1202.).

Feeding environment: all experiment mices are all raised in SPF level Experimental Animal Center, the large mouse feed of SPF level is purchased from Fukang bio tech ltd of China, Beijing.Rearing conditions: room temperature is between 22-24 DEG C, and humidity is between 40-70%, and it is 12h that light and shade replaces lighting hours, freely drinks water and ingests.

The expression of embodiment 1USP18 in normal person and Mutation of Patients with Cardiomyopathy heart

Select Normal Human Heart's (individuality of the death donation of non-cardiac reason, Donor), dilated cardiomyopathy heart (does the receptor of heart transplant operation patient displacement, DCM), protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), binding specificity knows USP18 albumen and cardiac myocyte hypertrophy mark ANP(Millipore, AB2232), β-MHC(santacruz, sc53090) antibody detects, measure its USP18(santacruz, sc98431) expression, GAPDH(CellSignalingTechnology, 2128) as internal reference.Testing result as shown in Figure 1, obviously raise by the expression of cardiac myocyte hypertrophy mark ANP, β-MHC in dilated cardiomyopathy heart, and the expression of USP18 also obviously raises (Fig. 1).

The expression of embodiment 2USP18 in wild-type mice sham operated rats and myocardial hypertrophy model group heart

1. adopt aorta arch constriction operation (AB) to set up mouse cardiac muscle hypertrophy model, model manipulation flow process:

1.1 Preoperative Method

(1) anaesthetize: first to mouse weights, calculate required anaesthetic (3% pentobarbital sodium) amount according to 90mg/kg body weight, by lumbar injection, and record some inject time.Folder tail, folder toe without significant reaction and mice in good condition be anesthesia Success criteria (after general injection, about 10min is without significant reaction, and respond with the little mousetrap toe of about 50min after anaesthetizing, after anesthesia, about 30min is best operating time).

(2) art district prepares: by the skin unhairing of left for mice chest, left side chest and left fore oxter.Shave Mao Houyong wet gauze wiping art district and remove Mus hair, be advisable not affect surgical field of view.

(3) tracheal intubation: upper for mice front tooth is fixed on V shaped slab inclined-plane with rubber band, and rapidly tracheal intubation is accurately inserted tracheal strips through glottis, right arm reclining is placed in (heating cushion need shift to an earlier date preheating) on heating cushion subsequently, then tracheal intubation is connected with respirator, fixing mice.If the thorax of mice rises and falls consistent with respirator frequency, tracheal intubation success is described.

1.2 aorta arch constriction arts (AB)

AB art myocardial hypertrophy model group: get right arm reclining, mice left fore is placed in above right fore, and is fixed by two forelimbs with medical adhesive tape.Being encased inside cotton swab below right chest, raising thorax, is 75% ethanol to the sterilization of operation area skin by iodine tincture and volume fraction successively.Left hand is held ophthalmic tweezers and has been pinched by left skin of chest, the right hand is held eye scissors and is cut off skin and be about 1cm, separating muscle and soft tissue successively, in 2-3 rib horizontal opening thoracic cavity, slightly push left lung aside with cotton swab, free aortic arch descending branch, by 7-0 sutures through blood vessel, and above blood vessel parallel placement one section of 26G(25.0-27.5g mice) or 27G(23.5-25.0g) syringe needle, by blood vessel and syringe needle, ligation is good together, then extracts the Vasoconstriction that syringe needle can reach respective degrees out.Sew up successively after ligation, close thoracic cavity, extract 1cc gas out to recover negative pressure in thoracic cavity with syringe from sealing insertion thoracic cavity, rapid skin suture otch after extracting syringe.

Sham operated rats (Sham) is a threading not ligation after the descending aorta that dissociates, and all the other steps are with AB art myocardial hypertrophy model group.

1.3 postoperative care

In operation after the ligation of aortic arch descending branch, treat that autonomous respiration appears in mice, kickback appears in folder toe, extract tracheal intubation, and mice is put into the rearging cage of bedding and padding, feedstuff and drinking water autoclaving being housed and crossing, continue breeding observing in receptacle.

2. draw materials

Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.The vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cut heart, be placed in rapidly on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding cryopreservation tube, be placed in liquid nitrogen container rapidly, for molecular Biological Detection after-80 DEG C of Refrigerator stores.

The expression of 3.USP18 in Sham group mice and myocardial hypertrophy model group mouse heart

Select the heart of wild-type mice Sham group and myocardial hypertrophy model group AB Post operation 4 weeks and 8 weeks respectively, protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), the antibody of binding specificity identification USP18 albumen and cardiac myocyte hypertrophy mark ANP, β-MHC detects, measure the expression of its USP18, GAPDH is as internal reference.As shown in Figure 2, cardiac myocyte hypertrophy mark obviously raises in the expression of postoperative ANP, β-MHC of AB testing result, and the expression of USP18 is in the postoperative obvious rise of AB.Show the up-regulated of the heart USP18 that myocardial hypertrophy occurs.

Embodiment 3USP18 interference (AdshUSP18) and process LAN (AdUSP18) adenovirus are on the impact of the primary cardiomyocytes hypertrophy that AngII stimulates

1. primary newborn SD rat myocardial cells culture

(1) newborn 1 day Sprague-Dawley neonatal rat 8,75% alcohol disinfecting below cervical region, takes off heart with eye scissors and microforceps, puts into the glass dish filling 10mLDMEM/F12 liquid.Get another again, repeat above process.

(2) with DMEM/F12 culture medium cleaning heart, and heart is cut into 1-2mm ³fragment.Be transferred to and be placed with in the serum bottle of rotor, suck DMEM/F12, add trypsinization liquid.Rotating speed is 120r/min, digestion 15min, static several seconds, abandoning supernatant.

(3) add trypsinization liquid, rotating speed is 120r/min, digestion 15min.The static several seconds, Aspirate supernatant, stops digestion by the DMEM/F12 culture medium of 20% calf serum, and is placed in 4 DEG C of Refrigerator stores.Repeat this step, circulation several times.Should exhaust when getting supernatant as far as possible, when piece of tissue bleaches and obviously diminishes, stop digestion.

(4) myocardial cell suspensions will gathered, with the centrifugal 8min of 1500rpm rotating speed, abandoning supernatant.In centrifuge tube, add appropriate culture medium, softly blow and beat re-suspended cell, be concentrated in 1 50mL centrifuge tube, cell suspension cell 40 μm of filter screen filtration.

(5) cell is seeded in the culture dish of 100mm, adherent 90min during difference, draws not adherent cell suspension and filter.Brdu(final concentration 0.1mM is added according to the total amount of cell suspension), after mixing, join in the vessel with 0.1% gelatin bag quilt.

(6) jog cell dispersion, whirlpool does not rock.37 DEG C, 5%CO ₂hatch and clean 1 time with PBS, replaced medium in 48 hours.

2.USP18 interference (AdshUSP18) and process LAN (AdUSP18) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

AdshRNA(is containing the reticent RNA of shRNA() adenovirus, with comparing), AdshUSP18(is containing the reticent RNA-USP18 fusion rotein of shRNA-USP18() adenovirus), AdGFP(is containing GFP(green fluorescent protein) adenovirus, with comparing) and AdUSP18(containing GFP-USP18(green fluorescent protein-USP18 fusion rotein) adenovirus) (building process of these adenoviruss is see document: ChenK, GaoL, LiuY, etal.Vinexin-β protectsagainstcardiachypertrophybyblockingtheAkt-depend entsignallingpathway [J]. basicResCardiol 2013,108 (2): 1-14.) adenovirus 10MOIs infects the cultivation primary cardiomyocytes of 3 days respectively, with 1 μM of Angiotensin II (AngII) (available from Sigma after 12 hours, A9525) or contrast PBS stimulate 48 hours, then carry out immunofluorescence test.Result shows the comparatively AdshRNA matched group increase of the myocardial cell surface area after AdshUSP18 adenovirus infection, and the myocardial cell surface area through AdUSP18 adenovirus infection then obviously reduces (Fig. 3) than matched group AdGFP; Namely the interference adenovirus of USP18 promotes cardiac myocyte hypertrophy, and the process LAN adenovirus of USP18 suppresses cardiac myocyte hypertrophy.

Embodiment 4 myocardial hypertrophy model mice myocardial hypertrophy and fibrosis detect and cardiac function detects

1. adopt aorta arch constriction operation (AB) to set up mouse cardiac muscle hypertrophy model

Select 8-10 age in week, body weight is respectively divided into sham operated rats (Sham) and AB art myocardial hypertrophy model group at the wild-type mice (WT) of 23.5-27.5g, USP18 knock out mice (USP18-KO), heartspecific USP18 transgenic mice (USP18-TG) and nontransgenic mice (NTG), i.e. WTSham group, WTAB group, USP18-KOSham group, USP18-KOAB group, USP18-TGSham group, USP18-TGAB group, NTGSham group, NTGAB group, often organize 10 mices.Modeling method is with embodiment 2.The postoperative detection carrying out myocardial hypertrophy and Fibrotic detection and cardiac function for 4 weeks respectively of AB.

2. draw materials

(1) previous work: the urine cup preparing volume fraction 10% formaldehyde that 20mL is housed in advance, and post label (mouse number, group, type of surgery and draw materials the date).The culture dish filling mass fraction 10%KCl solution is placed in the place that draws materials.Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.

(2) draw materials: the vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cuts heart, be placed in rapidly mass fraction 10%KCl solution.Until cardiac arrest after relaxing period, be placed on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding urine cup, detect for pathology after fixing 48h.

(3) measurement of correlation and calculating: take out mice lungs, after pruning, filter paper blots, and weighs and record.Cut off mouse hind leg tibia place skin, measure and record tibia length.Calculate the heart and weigh the ratio (HW/BW) with body weight, lung weighs with the ratio (LW/BW) of body weight and the heart is heavy and the ratio (HW/TL) of tibia length.

3. paraffin specimen section is prepared in pathology detection 3.1

Main operation sequence comprises pruning heart → embedding frame process → running water → dehydration → transparent → waxdip → embedding → section → stand sheet → dry or for subsequent use after toasting.

3.2 hematoxylin-eosins (HE) dye

Key step is: get paraffin specimen and cut into slices 55 DEG C and toast 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → washing 1min → 1% hydrochloride alcohol (getting 3mL concentrated hydrochloric acid fully to mix homogeneously with 297mL70% ethanol) 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, Magnesium sulfate heptahydrate 2g, both are dissolved in 100mL distilled water) 1min → washing 1min → Yihong solution (Zhuhai shellfish rope, BA-4024) 3-5min → distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of in the not dry mounting → fume hood immediately of dimethylbenzene and dry up, microscope is taken pictures.

HE dyeing picture statistics: every pictures selects more than 3 clear border, and core is roughly positioned at the cell of central authorities, with Image-ProPlus6.0 software circle cell area.

3.3 WGAs (WGA) dye

Key step: the paraffin specimen section through 60 DEG C of baking 30min is placed in dimethylbenzene 5min × 3 time → 100% ethanol 5min × 2 time → 95% ethanol 5min → 70% ethanol 5min → distilled water rinsing 5min × 2 time → PBS rinsing 5min → PBS rinsing 10min → discard PBS, drip pancreatin working solution (DIG-3008, Foochow steps new) 37 DEG C of lucifuges hatch 20min → PBS rinsing 5min × 3 time → take out section, the liquid (tissue is sure not drying) around tissue is dried with filter paper, to lie against in wet box → drip WGA-AlexaFlour488 working solution (10 μ g/mL) 37 DEG C of lucifuges with groupization stroke circle and hatch 2h → discard dye liquor, PBS rinsing 5min × 3 time → SlowFadeGoldantifadereagentwithDAPI mounting → viewed under fluoroscopy, microscope is taken pictures.

3.4 Picro-Sirius reds (PSR) dye

Key step is: get paraffin specimen and cut into slices 55 DEG C and toast 30min → dimethylbenzene 2min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → running water 10min → distilled water 1min → mass fraction 0.2% phosphomolybdic acid 2min → 0.1% sirius red picric acid solution drips in tissue, dye in wet box 90min → removal residual liquid → 0.01N hydrochloric acid 4s → 70% ethanol 1 time → 90% ethanol 1 time → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of dimethylbenzene not dry coverslip immediately mounting, microscope is taken pictures.

PSR dyeing picture statistics (Image-ProPlus6.0 software): collagen ratio=area of collagen/(gross area-blank area) × 100%.

Cardiac muscular tissue is made up of myocardial cell and stroma, and heart is a whole end differentiation organ, and myocardial cell loses multiplication capacity, the myocardial cell reaction that various physiology or pathological stimuli cause, and can only be that the volume of individual cells increases and can not quantitatively breed.Therefore, in the pathophysiological process of myocardial hypertrophy, main manifestations is that myocardial cell volume increases, muscle segment increasing number, cell arrangement is disorderly, and cardiac mesenchymal changes the propagation and the conversion that comprise Cardiac Fibroblasts, collagen fiber density increases, and collagen secretion increases, collagen proportional balancing method imbalance etc.

Phenotypic results after WT and USP18-KO mice adopts AB art to set up myocardial hypertrophy model is shown in Fig. 4-7.Sham(sham-operation) the equal not statistically significant of the difference between HW/BW, LW/BW and HW/TL of WT and USP18-KO mice in group; WT mice AB HW/BW, LW/BW, HW/TL of postoperative 4 weeks are higher than its Sham group; Postoperative 4 weeks of AB, HW/BW, LW/BW and HW/TL all comparatively WT mice rising (Fig. 4) of USP18-KO mice.HE dyeing and WGA stained can be observed: Sham group heart no significant difference, and AB group all increases compared with the heart of Sham group, and the heart of USP18-KO mice is obviously greater than WT group mice; Sham group myocardium myo fibril cell arrangement is neat, fine and close, and form is complete, karyon and nucleolar structure clear; AB group myofilament arrangement disorder, loose, myocardial cell volume obviously increases, form irregularity, karyon engrain, increase, deformity, and kernel is fuzzy, and USP18-KO group is then obvious than WT group cellular mast, and difference has statistical significance (Fig. 5).After PSR dyeing, find the comparatively Sham group increase of AB group myocardium of ventricle interstitial collagen content, around arteries, collagen increase is more obvious, and collagen increases thick, and arrangement disorder becomes network-like; USP18-KO mice AB postoperative myocardial interstitial collagen content and perivascular collagen content are then than the postoperative increase of WT mice AB more (Fig. 6).These results suggest that obvious myocardial hypertrophy occurs mice after the modeling of AB art, the myocardial hypertrophy of USP18-KO mice and fibrosis are greater than WT mice.

Fig. 8-11 is the phenotypic results after NTG and USP18-TG mice adopts AB art to set up myocardial hypertrophy model.The degree that HW/BW, LW/BW and HW/TL of same AB postoperative 4 weeks TG mices increase is significantly less than NTG mice (Fig. 8).HE dyeing and WGA stained can be observed: AB group all increases compared with the heart of Sham group, and the degree that the postoperative TG mouse heart of AB increases is much smaller than NTG mice; TG mice AB postoperative myocardial cell cross section is long-pending is significantly less than NTG mice AB group (Fig. 9).PSR dyeing is visible, and TG mice AB postoperative myocardial interstitial collagen content and perivascular collagen content are less than NTG mice AB group (Figure 10).These results suggest that obvious myocardial hypertrophy occurs mice after the modeling of AB art, the myocardial hypertrophy of USP18-TG mice and fibrosis are less than NTG mice.

4. ultrasound detection cardiac function

4.1 early-stage preparations

(1) anesthetic machine prepares: first connect the intake interface on oxygen cylinder and anesthetic machine, then turn on dosing mouth seal cover on anesthetic machine, tighten seal cover after adding rapidly isoflurane to safe scale.Turn on total valve on oxygen cylinder, the knob of adjustment flow control valve, outlet pressure maintains 0.2-0.3mPa.

(2) mice to be measured prepares: after mice to be detected is anaesthetized rapidly with isoflurane, hair is shaved in left anterior pectorial region, the mouse head handled well is stretched into anesthetis conduit pullover in, maintain the stable narcotism of mice with 1.5-2.0% isoflurane.

4.2 cardiac function detect

Mice gets left lateral position or dorsal position, and is shaving hair-fields uniform application ultrasonic coupling agent (Tianjin Cheng Xin company).Adopt high-frequency ultrasound in diagnosis instrument, frequency is 15MHz, selection standard papillary muscles of left ventricle short axis view, measurement, LVED (Left Ventricular End Systolic Dimension) (LVEDd), left room end systolic diameter (LVESd), ejection fraction (EF).

Fig. 7 is the cardiac function testing result after WT and USP18-KO mice adopts AB art to set up myocardial hypertrophy model.Compared with WTSham group, WT mice AB shows decreased cardiac function and myocardial hypertrophy in postoperative 4 weeks, and main manifestations is that index LVEDd, the LVESd of myocardial hypertrophy increases, and reflects that the index EF of cardiac function then declines.Postoperative 4 weeks of AB, the degree that the degree of the index increase of USP18-KO mouse cardiac muscle plumpness and the index of reflection cardiac function decline is greater than WT mice.

Figure 11 is the cardiac function testing result after NTG and USP18-TG mice adopts AB art to set up myocardial hypertrophy model.Postoperative 4 weeks of AB, compared with NTG mice, the degree that the degree of the index increase of TG mouse cardiac muscle plumpness and the index of reflection cardiac function decline then is less than NTG group.

From above result, in the myocardial hypertrophy disease model that aorta arch constriction causes, USP18 genetic flaw significantly promotes myocardial hypertrophy, fibrosis, and worsen cardiac function, USP18 gene overexpression significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.Therefore USP18 gene has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly USP18 gene to have the effect of the myocardial hypertrophy relevant disease generation that aorta arch constriction can be suppressed to cause.

Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims (9)

1. the application of ubiquitin specific proteinase 18 in the medicine of screening cardioprotection function.

2. the application of ubiquitin specific proteinase 18 in the medicine preparing cardioprotection function.

3. application according to claim 2; it is characterized in that: comprise the effective ingredient of ubiquitin specific proteinase 18 as the medicine of cardioprotection function, the chemical substance that ubiquitin specific proteinase 18 can be promoted to express is as the effective ingredient of the medicine of cardioprotection function.

4. the application of ubiquitin specific proteinase 18 in the medicine of the anti-cardiac fibrosis of screening.

5. the application of ubiquitin specific proteinase 18 in the medicine of the anti-cardiac fibrosis of preparation.

6. application according to claim 5, it is characterized in that: comprise the effective ingredient of ubiquitin specific proteinase 18 as the medicine of anti-cardiac fibrosis, the chemical substance that ubiquitin specific proteinase 18 can be promoted to express is as the effective ingredient of the medicine of anti-cardiac fibrosis.

7. ubiquitin specific proteinase 18 prevents in screening, alleviates and/or treats in the medicine of myocardial hypertrophy and applies.

8. ubiquitin specific proteinase 18 prevents in preparation, alleviates and/or treats in the medicine of myocardial hypertrophy and applies.

9. application according to claim 8, it is characterized in that: comprise ubiquitin specific proteinase 18 as prevention, alleviate and/or the effective ingredient of medicine for the treatment of myocardial hypertrophy, the chemical substance that ubiquitin specific proteinase 18 can be promoted to express is as prevention, the effective ingredient of medicine of alleviating and/or treating myocardial hypertrophy.