CN105079797A - Function and application of ADAMTS2 (a disintegrinlike and metalloproteinase with thrombospondin type 1 motifs 2) in treating myocardial hypertrophy - Google Patents

Abstract

The invention discloses a function and an application of ADAMTS2 (a disintegrinlike and metalloproteinase with thrombospondin type 1 motifs 2) in treating myocardial hypertrophy. According to the function and the application, the relationship between ADAMTS2 expression and myocardial hypertrophy is determined, and research results prove that ADAMTS2 expression is increased remarkably when compared with that of a normal group in a model with myocardial hypertrophy; myocardial hypertrophy and fibrosis are promoted greatly and cardiac functions are deteriorated greatly through inhibition of ADAMTS2 expression, and myocardial hypertrophy and fibrosis are inhibited greatly and the cardiac functions are protected greatly through promotion of ADAMTS2 overexpression. Therefore, the ADAMTS2 can be taken as a target gene and used for screening and preparing drugs for cardiac function protection, cardiac fibrosis resistance and/or myocardial hypertrophy prevention, relief and/or treatment, and a new effective path for treating myocardial hypertrophy is provided.

Description

Containing the function and application of disintegrin sample metalloproteases 2 in treatment myocardial hypertrophy of I type thrombospondin sequence

Technical field

The invention belongs to function and the application of gene, particularly one is containing the disintegrin sample metalloproteases 2(ADAMTS2 of I type thrombospondin sequence (TSP1)) treating the function and application in myocardial hypertrophy.

Background technology

Myocardial hypertrophy is the adaptability compensation response that the myocardial cell reply neuro humor factor stimulates and mechanical stress changing load is made, be one complicated and merge the dynamic process that many factors participates in regulating, be also simultaneously the required pathological process [1] jointly experienced during most of cardiovascular disease such as hypertension, valvular heart disease, myocardial infarction, cardiomyopathy develop.Myocardial hypertrophy is the adaptability compensation response that heart is made multiple cardiovascular stimulating factors such as hemodynamics load, angiotensin, somatomedin and hormones, and ventricle wall pressure can be made to reduce, and maintains and even can improve heart blood discharge amount; But long-term stress cause persistence pathologic myocardial hypertrophy, and be attended by cardiac shape and deterioration functionally, show the changes such as inflammation, fibrosis and abnormal gene expression.The myocardial hypertrophy continued can cause DCM (dilated cardiomyopathy), heart failure is even died suddenly, therefore myocardial hypertrophy significantly increases sickness rate and the case fatality rate of heart failure, becomes the independent hazard factor of the cardiovascular disease such as heart failure and the signal [2] of poor prognosis.In recent decades, along with our people's growth in the living standard, dietary habit changes thereupon, improving constantly of the sickness rate of the common cardiovascular diseases such as hypertension, coronary heart disease, the incidence rate of the cardiovascular events such as the ventricular arrhythmia that myocardial hypertrophy causes then, sudden cardiac death, myocardial ischemia and heart failure is rising, year by year than front improve 6 ~ 10 times [3-5].In recent years, the generation development mechanism of the numerous scholar in the whole world to myocardial hypertrophy has carried out large quantity research, find some key genes participating in myocardial hypertrophy pathophysiological processes and signal of interest pathway, and to can conduct in-depth research [6-8] by intervention factor wherein.But the generation development mechanism of myocardial hypertrophy is completely clear and definite yet so far, and existing research and discovery still have certain limitation in clinical practice, still can not form the really effective prophylactico-therapeutic measures for myocardial hypertrophy.Therefore, find the specific molecular and the signal transduction pathway that participate in myocardial hypertrophy, myocardial hypertrophy generation development mechanism is illustrated to further system, from cellular and molecular level, myocardial hypertrophy is regulated and controled, explore the therapy target of new control myocardial hypertrophy, there is very important theory and practice meaning.

ADAMTS(adisintegrinlikeandmetalloproteinasewiththrombosp ondintype1motifs) family, Chinese full name is the disintegrin sample Metalloproteinase familv containing I type thrombospondin sequence (TSP1), is at a class Zn newfound after matrix metalloproteinase MMP family ²⁺the secreting type Metalloproteinase familv [9] relied on.ADAMTS2 is as important a member of ADAMTS family, in 1997 by successful clone such as Colige, and find in human heart tissue, have expression [10], this gene mapping is in human chromosomal 5q35.3, relative molecular weight is about 135kDa, together with ADAMTS3 with ADAMTS14, form the subfamily [11] that is referred to as precollagen N end protease.Be different from other family members, still containing peptidase region (PNP) before a specific precollagen amino after the C-terminal TSP-1 sequence of ADAMTS2, negative regulate effect [12] can be produced to the activity of enzyme; Meanwhile, in PNP region, also there is a PLAC region, may reinvent relevant [13] to epithelium; And ADAMTS2 also comprises a RGD sequence, point out it may be associated [14] with potential integrin molecule.The same with other metalloproteases, ADAMTS2 is with the synthesis of the form of proenzyme and exist, and its activation needs through repeatedly shearing modification, machining [12] mainly by front albumen converting Enzyme and C-terminal.ADAMTS2 can participate in precollagen to the process of collagen turnover by shearing N-terminal propetide, acts on I, II, type III precollagen [15].Colige etc. study discovery, ADAMTS2 gene mutation can cause the skin fragility syndrome of domestic animal and the VIIC type Ehlers-Danlos syndrome (EDS) of the mankind, this heredopathia is that a kind of autosomal recessive inheritance is sick, and its typical performance is serious skin fragility, arthrochalasis (overextension) and distinctive facies [16].In addition, ADAMTS2 also participates in the pathophysiological process of hepatic fibrosis, when having a strong impact on the collage synthesis of hepatic stellate cell after ADAMTS2 gene delection, reducing degree of hepatic fibrosis, promoting lapsing to [17] of hepatic fibrosis; Hofer etc. study confirmation, and the glucocorticoid of certain hour and doses can make the expression of the mononuclear cell of peripheral blood CD14+ and pulmonary alveolar macrophage ADAMTS2mRNA obviously raise [11], and prompting ADAMTS2 may play anti-inflammatory effect; Still have research display, ADAMTS2 can not rely on autocatalysis territory but extracellular signal is made ERK1/2 and MLC dephosphorylation then to intracellular transduction by being combined with its potential membrane receptor p120 thus playing anti-angiogenic rebirth and antitumor action [14] in endotheliocyte.In addition, ADAMTS2 also can be regulated and controled by many factors: in vitro under environment, and certain density TIMP-3 can go to disturb precollagenous processing shearing function [18] by suppressing ADAMTS2; Papilin is the necessary constituent of one of extracellular matrix, extensively be present in mammal and invertebrates, research finds that it has very high similarity with the auxiliary area of ADAMTS2, and therefore Papilin can exist [19] as the competitive inhibitor of a kind of ADAMTS2 under environment in vitro; The research display TGF-β of Wang etc. can cause ADAMTS2mRNA to express rising and promote synthesis and the secretion [20] of ADAMTS2 albumen.

List of references:

1.HeinekeJ,MolkentinJD.Regulationofcardiachypertrophybyintracellularsignallingpathways.NatRevMolCellBiol.2006;7(8):589-600.

2.HillJA,OlsonEN.CardiacPlasticity.NEnglJMed.2008;358(13):1370-80.

3.ZileMR,GottdienerJS,HetzelSJ,McMurrayJJ,KomajdaM,McKelvieR,BaicuCF,MassieBM,CarsonPE.Prevalenceandsignificanceofalterationsincardiacstructureandfunctioninpatientswithheartfailureandapreservedejectionfraction.Circulation.2011;124(23):2491-501.

4.MuddJO,KassDA.Tacklingheartfailureinthetwenty-firstcentury.Nature.2008;451(7181):919-928.

5.vanBerloJH,MailletM,MolkentinJD.Signalingeffectorsunderlyingpathologicgrowthandremodelingoftheheart.JClinInvest.2013;123(1):37-45.

6.MailletM,vanBerloJH,MolkentinJD.Molecularbasisofphysiologicalheartgrowth:fundamentalconceptsandnewplayers.NatRevMolCellBiol.2013;14(1):38-48.

7.ShahAM,MannDL.Insearchofnewtherapeutictargetsandstrategiesforheartfailure:recentadvancesinbasicscience.Lancet.2011;378(9792):704-12.

8.SongK,NamYJ,LuoX,QiX,TanW,HuangGN,AcharyaA,SmithCL,TallquistMD,NeilsonEG,HillJA,Bassel-DubyR,OlsonEN.Heartrepairbyreprogrammingnon-myocyteswithcardiactranscriptionfactors.Nature.2012;485(7400):599-604.

9.KunoK,KanadaN,NakashimaE,FujikiF,IchimuraF,MatsushimaK.Molecularcloningofageneencodinganewtypeofmetalloproteinase-disintegrinfamilyproteinwiththrombospondinmotifsasaninflammationassociatedgene.JBiolChem.1997;272(1):556-62.

10.ColigeA,LiSW,SieronAL,NusgensBV,ProckopDJ,LapièreCM.cDNAcloningandexpressionofbovineprocollagenIN-proteinase:anewmemberofthesuperfamilyofzinc-metalloproteinaseswithbindingsitesforcellsandothermatrixcomponents.ProcNatlAcadSciUSA.1997;94(6):2374-9.

11.HoferTP,FrankenbergerM,MagesJ,LangR,MeyerP,HoffmannR,ColigeA,Ziegler-HeitbrockL.Tissue-specificinductionofADAMTS2inmonocytesandmacrophagesbyglucocorticoids.JMolMed(Berl).2008;86(3):323-32.

12.ColigeA,RuggieroF,VandenbergheI,DubailJ,KestelootF,VanBeeumenJ,BeschinA,BrysL,LapièreCM,NusgensB.DomainsandmaturationprocessesthatregulatetheactivityofADAMTS-2,ametalloproteinasecleavingtheaminopropeptideoffibrillarprocollagenstypesI-IIIandV.JBiolChem.2005;280(41):34397-408.

13.NardiJB,MartosR,WaldenKK,LampeDJ,RobertsonHM.Expressionoflacunin,alargemultidomainextracellularmatrixprotein,accompaniesmorphogenesisofepithelialmonolayersinManducasexta.InsectBiochemMolBiol.1999;29(10):883-97.

14.DubailJ,KestelootF,DeroanneC,MotteP,LambertV,RakicJM,LapièreC,NusgensB,ColigeA.ADAMTS-2functionsasanti-angiogenicandanti-tumoralmoleculeindependentlyofitscatalyticactivity.CellMolLifeSci.2010;67(24):4213-32.

15.LeeCW,HwangI,ParkCS,LeeH,ParkDW,KangSJ,LeeSW,KimYH,ParkSW,ParkSJ.ExpressionofADAMTS-2,-3,-13,and-14inculpritcoronarylesionsinpatientswithacutemyocardialinfarctionorstableangina.JThrombThrombolysis.2012;33(4):362-70.

16.ColigeA,SieronAL,LiSW,SchwarzeU,PettyE,WerteleckiW,WilcoxW,KrakowD,CohnDH,ReardonW,ByersPH,LapièreCM,ProckopDJ,NusgensBV.HumanEhlers-DanlossyndrometypeVIICandbovinedermatosparaxisarecausedbymutationsintheprocollagenIN-proteinasegene.AmJHumGenet.1999;65(2):308-17.

17.KestelootF,DesmoulièreA,LeclercqI,ThiryM,ArreseJE,ProckopDJ,LapièreCM,NusgensBV,ColigeA.ADAMmetallopeptidasewiththrombospondintype1motif2inactivationreducestheextentandstabilityofcarbontetrachloride-inducedhepaticfibrosisinmice.Hepatology.2007;46(5):1620-31.

18.WangWM,GeG,LimNH,NagaseH,GreenspanDS.TIMP-3inhibitstheprocollagenN-proteinaseADAMTS-2.BiochemJ.2006;398(3):515-9.

19.KramerovaIA,KawaguchiN,FesslerLI,NelsonRE,ChenY,KramerovAA,Kusche-GullbergM,KramerJM,AckleyBD,SieronAL,ProckopDJ,FesslerJH.Papilinindevelopment;apericellularproteinwithahomologytotheADAMTSmetalloproteinases.Development.2000;127(24):5475-85.

20.WangWM,LeeS,SteiglitzBM,ScottIC,LebaresCC,AllenML,BrennerMC,TakaharaK,GreenspanDS.Transforminggrowthfactor-betainducessecretionofactivatedADAMTS-2.AprocollagenIIIN-proteinase.JBiolChem.2003;278(21):19549-57。

Summary of the invention

For solving defect and the deficiency of above-mentioned prior art; the object of the invention is to determine the expression of ADAMTS2 and the mutual relation of myocardial hypertrophy, the new opplication of a kind of ADAMTS2 in the medicine preparing cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/treatment myocardial hypertrophy is provided.

Object of the present invention is achieved through the following technical solutions:

By test, the present invention determines that ADAMTS2 expresses the relation between myocardial hypertrophy:

1, during generation myocardial hypertrophy, the expression of cardiac myocyte hypertrophy mark ANP, Myh7 is obviously raised, and the expression of ADAMTS2 is also obviously raised

The present invention selects normal person and dilated cardiomyopathy heart respectively, normal sham-operation (Sham) mice and cause the mouse heart of myocardial hypertrophy by aorta arch constriction operation (AB), have detected the protein expression situation of ANP, Myh7, ADAMTS2 respectively.Result shows, the expression of mouse heart cardiac myocyte loose mark ANP, Myh7 of dilated cardiomyopathy and generation myocardial hypertrophy is obviously raised, and the expression of ADAMTS2 also obviously raises (Fig. 1, Fig. 2).

2, ADAMTS2 interference (AdshADAMTS2) and process LAN (AdADAMTS2) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

The present invention finds at intravascular Angiotensin Converting Enzyme II(AngII) in the external myocardial hypertrophy model of inducing, the hypertrophy of ADAMTS2 process LAN myocardial cell is obviously suppressed, ADAMTS2 does not express myocardial cell and occurs obviously loose, each group of equal no significant difference (Fig. 3) through PBS process.

3, ADAMTS2 gene knockout significantly promotes myocardial hypertrophy, fibrosis, worsens cardiac function

The present invention selects wild-type mice, ADAMTS2 knock out mice is tested, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research ADAMTS2 gene knockout is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that the ADAMTS2 defect knocked out caused by ADAMTS2 gene significantly worsens myocardial hypertrophy, fibrosis and cardiac function (Fig. 4, Fig. 5, Fig. 6, Figure 10).

4, ADAMTS2 gene overexpression significantly suppress myocardial hypertrophy and fibrosis thereof, improves cardiac function

The present invention selects heartspecific ADAMTS2 transgenic mice and nontransgenic mice to test, and often kind of mice is divided into sham operated rats and operation group, often organizes 10 mices.Operation group gives aorta arch constriction operation, sham operated rats refuses aorta arch constriction, then by carrying out the mensuration of cardiac myocytes plumpness, fibrosis and cardiac function to each group of mice of sham operated rats and operation group, research ADAMTS2 gene overexpression is on the impact of the myocardial hypertrophy that aorta arch constriction is induced.Result shows that process LAN ADAMTS2 significantly suppresses myocardial hypertrophy and fibrosis, cardiac function protecting (Fig. 7, Fig. 8, Fig. 9, Figure 11).

By in the known model there is myocardial hypertrophy of above result, the expression of ADAMTS2 compares remarkable rising with normal group; Suppress ADAMTS2 to express and significantly promote myocardial hypertrophy, fibrosis, worsen cardiac function, promote that ADAMTS2 process LAN then significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.Therefore ADAMTS2 has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly ADAMTS2 to have the effect of the myocardial hypertrophy relevant disease generation that aorta arch constriction can be suppressed to cause.

The function of ADAMTS2 in myocardial hypertrophy, is mainly reflected in the effect that ADAMTS2 has cardiac function protecting and suppress the effect, particularly ADAMTS2 of myocardial hypertrophy to have the myocardial hypertrophy generation that aorta arch constriction can be suppressed to cause.

For the above-mentioned functions of ADAMTS2; the application of a kind of ADAMTS2 is provided; application, particularly ADAMTS2 that major embodiment is ADAMTS2 in cardioprotection, anti-cardiac fibrosis and treatment myocardial hypertrophy screening or prepare cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine in apply.Described application comprises ADAMTS2 directly as the effective ingredient of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy medicine, and the chemical substance that ADAMTS2 can be promoted to express is indirectly as cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or the effective ingredient for the treatment of myocardial hypertrophy medicine.

A medicine for cardioprotection function, comprises ADAMTS2.

A medicine for anti-cardiac fibrosis, comprises ADAMTS2.

Prevention, alleviation and/treatment myocardial hypertrophy a medicine, comprise ADAMTS2.

The present invention has following beneficial effect:

Present invention finds the New function of ADAMTS2 gene, namely have can cardioprotection function, anti-cardiac fibrosis and suppress the effect of myocardial hypertrophy for ADAMTS2 gene.Therefore; ADAMTS2 can be used as target gene; for screening the medicine of cardioprotection function, anti-cardiac fibrosis and/or prevention, alleviation and/or treatment myocardial hypertrophy; for at the medicine preparing cardioprotection function, resisting cardiac hypertrophy and/or prevention, alleviation and/or treatment myocardial hypertrophy, the treatment for myocardial hypertrophy provides an effective new way.

Accompanying drawing explanation

Fig. 1 is protein expression situation and the statistics block diagram of ANP, Myh7, ADAMTS2 in normal person and dilated cardiomyopathy patients heart; The up-regulated (#:p < 0.05vs normal person group) of dilated cardiomyopathy patients heart ADAMTS2.

The expression of Fig. 2 be wild-type mice in sham-operation (Sham) and aorta arch constriction operation (AB) afterwards heart ANP, Myh7, ADAMTS2 and statistics block diagram, GAPDH is as internal reference; Wherein 4W represents 4 weeks, and 8W represents 8 weeks, and the up-regulated (*/#:p < 0.05vs wild-type mice Sham group) of the heart ADAMTS2 that myocardial hypertrophy occurs is described.

Fig. 3 is that SD neonatal rat primary cardiomyocytes adenovirus AdshRNA, AdshADAMTS2, Ad-GFP and AdADAMTS2 infect, through the post-stimulatory immunofluorescence of AngII and cell surface area statistics block diagram; The interference adenovirus of ADAMTS2 promotes cardiac myocyte hypertrophy, and the process LAN adenovirus of ADAMTS2 suppresses cardiac myocyte hypertrophy (*: p < 0.05vsPBS group, #:p < 0.05vsAngII group).

Fig. 4 is the statistics block diagram of HW/BW, LW/BW and HW/TL after WT and ADAMTS2-KO mice AB performs the operation 4 weeks; Wherein, HW is cardiac mass, and BW is body weight, and LW is lungs total amount, and TL is tibia length (*: p < 0.05vsWTSham group, #:p < 0.05vsWTAB group).

Fig. 5 is that after WT and ADAMTS2-KO mice AB performs the operation 4 weeks, ventricle cross section and heart tissue HE, WGA dye and cardiomyocytes cross-sectional area statistics block diagram (*: p < 0.05vsWTSham group, #p < 0.05vsWTAB group).

Fig. 6 is heart tissue sirius red stains and left room area of collagen statistics block diagram (*: p < 0.05vsWTSham group, #:p < 0.05vsWTAB group) after WT and ADAMTS2-KO mice AB performs the operation 4 weeks.

Fig. 7 is the statistics block diagram of HW/BW, LW/BW and HW/TL after ADAMTS2-NTG and ADAMTS2-TG mice AB performs the operation 4 weeks; Wherein, HW is cardiac mass, and BW is body weight, and LW is lungs total amount, and TL is tibia length (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Fig. 8 is that after ADAMTS2-NTG and ADAMTS2-TG mice AB performs the operation 4 weeks, ventricle cross section and heart tissue HE, WGA dye and cardiomyocytes cross-sectional area statistics block diagram (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Fig. 9 is heart tissue sirius red stains and left room area of collagen statistics block diagram (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group) after ADAMTS2-NTG and ADAMTS2-TG mice AB performs the operation 4 weeks.

Figure 10 is cardiac function testing result figure after WT and ADAMTS2-KO mice AB performs the operation 4 weeks; Wherein, LVEDD is LVED (Left Ventricular End Systolic Dimension), and LVESD is left room end systolic diameter, and FS is shortening fraction (*: p < 0.05vsWTSham group, #:p < 0.05vsWTAB group).

Figure 11 is cardiac function testing result figure after ADAMTS2-NTG and ADAMTS2-TG mice AB performs the operation 4 weeks; Wherein, LVEDD is LVED (Left Ventricular End Systolic Dimension), and LVESD is left room end systolic diameter, and FS is shortening fraction (*: p < 0.05vsNTGSham group, #:p < 0.05vsNTGAB group).

Detailed description of the invention

Animal for research and raising

Laboratory animal: select 8-10 age in week, body weight is at 23.5-27.5g, background is wild-type mice (WT), the ADAMTS2 knock out mice (ADAMTS2-KO of male C57BL/6, purchased from EMMA, article No.: 02292), heartspecific ADAMTS2 transgenic mice (ADAMTS2-TG) and nontransgenic mice (ADAMTS2-NTG, littermate control nontransgenic mice) be experimental subject.

The structure of heartspecific ADAMTS2 transgenic mice:

With wild type C57BL/6 mice ADAMTS2 gene cDNA (openbiosystemCloneID:3965027) for template, with following primer PCR amplification mice ADAMTS2 full-length gene (NCBI, GENEID:216725):

Forward primer: AGCTTTGTTTAAACGCCACCATGGATCCGCCGGC,

Downstream primer: GGACTAGTTTAGAACTTTCCCGGCTTCTC.

(pCAG-loxP-CAT-loxP plasmid is provided by Beijing Union Medical College basis institute teacher Yang Qinglin for the ADAMTS2 full-length gene of amplification and pCAG-loxP-CAT-loxP plasmid, preparation process is see document: KimT, ZhelyabovskaO, LiuJ, etal.GenerationofanInducible, Cardiomyocyte-SpecificTransgenicMouseModelwithPPARb/dOve rexpression [J] .PeroxisomeProliferator-ActivatedReceptors (PPARs), 57.) through PmeI(NEB, #R0560L) and SpeI(NEB, #R0133L) connect after enzyme action, form pCAG-loxP-CAT-loxP-ADAMTS2-hGHpA carrier (CAG (chickenbeta-actin)-CAT (chloramphenicolacetyltransferase)-ADAMTS2-hGHpA), the plasmid of structure is injected into by micro-injection system in the unicellular germ cell of wild type C57BL/6 mice, this zygote transplation enters in healthy female Mus, growth obtains F0 for mice.By the F0 that obtains for mice and α-MHC-Cre mouse hybrid; and by tamoxifen induction (tamoxifen 80mg/kg/ days; lumbar injection; continued stimulus 5 days) (above-mentioned transgenic mice is prepared with reference to following document: JiangDS to obtain heartspecific ZNF394 transgenic mouse; BianZY; ZhangY; ZhangSM; LiuY, ZhangRetal.Roleofinterferonregulatoryfactor4intheregulat ionofpathologicalcardiachypertrophy.Hypertension2013; 61:1193-1202.).

Feeding environment: all experiment mices are all raised in SPF level Experimental Animal Center, the large mouse feed of SPF level is purchased from Fukang bio tech ltd of China, Beijing.Rearing conditions: room temperature is between 22-24 DEG C, and humidity is between 40-70%, and it is 12h that light and shade replaces lighting hours, freely drinks water and ingests.

The expression of embodiment 1ADAMTS2 in normal person and Mutation of Patients with Cardiomyopathy heart

Select Normal Human Heart's (individuality of the death donation of non-cardiac reason, Donor), dilated cardiomyopathy heart (does the receptor of heart transplant operation patient displacement, DCM), protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), binding specificity knows ADAMTS2 albumen and cardiac myocyte hypertrophy mark ANP(Millipore, AB2232), Myh7(santacruz, sc53090) antibody detects, measure its ADAMTS2(abcam, ab125226) expression, GAPDH(CellSignalingTechnology, 2128) as internal reference.Testing result as shown in Figure 1, obviously raise by the expression of cardiac myocyte hypertrophy mark ANP, Myh7 in dilated cardiomyopathy heart, and the expression of ADAMTS2 also obviously raises (Fig. 1).

The expression of embodiment 2ADAMTS2 in wild-type mice sham operated rats and myocardial hypertrophy model group heart

1. adopt aorta arch constriction operation (AB) to set up mouse cardiac muscle hypertrophy model, model manipulation flow process:

1.1 Preoperative Method

(1) anaesthetize: first to mouse weights, calculate required anaesthetic (3% pentobarbital sodium) amount according to 90mg/kg body weight, by lumbar injection, and record some inject time.Folder tail, folder toe without significant reaction and mice in good condition be anesthesia Success criteria (after general injection, about 10min is without significant reaction, and respond with the little mousetrap toe of about 50min after anaesthetizing, after anesthesia, about 30min is best operating time).

(2) art district prepares: by the skin unhairing of left for mice chest, left side chest and left fore oxter.Shave Mao Houyong wet gauze wiping art district and remove Mus hair, be advisable not affect surgical field of view.

(3) tracheal intubation: upper for mice front tooth is fixed on V shaped slab inclined-plane with rubber band, and rapidly tracheal intubation is accurately inserted tracheal strips through glottis, right arm reclining is placed in (heating cushion need shift to an earlier date preheating) on heating cushion subsequently, then tracheal intubation is connected with respirator, fixing mice.If the thorax of mice rises and falls consistent with respirator frequency, tracheal intubation success is described.

1.2 aorta arch constriction arts (AB)

AB art myocardial hypertrophy model group: get right arm reclining, mice left fore is placed in above right fore, and is fixed by two forelimbs with medical adhesive tape.Being encased inside cotton swab below right chest, raising thorax, is 75% ethanol to the sterilization of operation area skin by iodine tincture and volume fraction successively.Left hand is held ophthalmic tweezers and has been pinched by left skin of chest, the right hand is held eye scissors and is cut off skin and be about 1cm, separating muscle and soft tissue successively, in 2-3 rib horizontal opening thoracic cavity, slightly push left lung aside with cotton swab, free aortic arch descending branch, by 7-0 sutures through blood vessel, and above blood vessel parallel placement one section of 26G(25.0-27.5g mice) or 27G(23.5-25.0g) syringe needle, by blood vessel and syringe needle, ligation is good together, then extracts the Vasoconstriction that syringe needle can reach respective degrees out.Sew up successively after ligation, close thoracic cavity, extract 1cc gas out to recover negative pressure in thoracic cavity with syringe from sealing insertion thoracic cavity, rapid skin suture otch after extracting syringe.

Sham operated rats (Sham) is a threading not ligation after the descending aorta that dissociates, and all the other steps are with AB art myocardial hypertrophy model group.

1.3 postoperative care

In operation after the ligation of aortic arch descending branch, treat that autonomous respiration appears in mice, kickback appears in folder toe, extract tracheal intubation, and mice is put into the rearging cage of bedding and padding, feedstuff and drinking water autoclaving being housed and crossing, continue breeding observing in receptacle.

2. draw materials

Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.The vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cut heart, be placed in rapidly on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding cryopreservation tube, be placed in liquid nitrogen container rapidly, for molecular Biological Detection after-80 DEG C of Refrigerator stores.

The expression of 3.ADAMTS2 in Sham group mice and myocardial hypertrophy model group mouse heart

Select the heart of wild type Sham group and myocardial hypertrophy model group AB Post operation 4 weeks and 8 weeks respectively, protein is extracted to heart and carries out SDS-PAGE-western blot test (Westernblot), the antibody of binding specificity identification ADAMTS2 albumen and cardiac myocyte hypertrophy mark ANP, Myh7 detects, measure the expression of its ADAMTS2, GAPDH is as internal reference.As shown in Figure 2, cardiac myocyte hypertrophy mark obviously raises in the expression of AB postoperative ANP, Myh7 testing result, and the expression of ADAMTS2 is in the postoperative obvious rise of AB.Show the up-regulated of the heart ADAMTS2 that myocardial hypertrophy occurs.

Embodiment 3ADAMTS2 interference (AdshADAMTS2) and process LAN (AdADAMTS2) adenovirus are on the impact of the primary cardiomyocytes hypertrophy that AngII stimulates

1. primary newborn SD rat myocardial cells culture

(1) newborn 1 day Sprague-Dawley neonatal rat 8,75% alcohol disinfecting below cervical region, takes off heart with eye scissors and microforceps, puts into the glass dish filling 10mLDMEM/F12 liquid.Get another again, repeat above process.

(2) with DMEM/F12 culture medium cleaning heart, and heart is cut into 1-2mm ³fragment.Be transferred to and be placed with in the serum bottle of rotor, suck DMEM/F12, add trypsinization liquid.Rotating speed is 120r/min, digestion 15min, static several seconds, abandoning supernatant.

(3) add trypsinization liquid, rotating speed is 120r/min, digestion 15min.The static several seconds, Aspirate supernatant, stops digestion by the DMEM/F12 culture medium of 20% calf serum, and is placed in 4 DEG C of Refrigerator stores.Repeat this step, circulation several times.Should exhaust when getting supernatant as far as possible, when piece of tissue bleaches and obviously diminishes, stop digestion.

(4) myocardial cell suspensions will gathered, with the centrifugal 8min of 1500rpm rotating speed, abandoning supernatant.In centrifuge tube, add appropriate culture medium, softly blow and beat re-suspended cell, be concentrated in 1 50mL centrifuge tube, cell suspension cell 40 μm of filter screen filtration.

(5) cell is seeded in the culture dish of 100mm, adherent 90min during difference, draws not adherent cell suspension and filter.Brdu(final concentration 0.1mM is added according to the total amount of cell suspension), after mixing, join in the vessel with 0.1% gelatin bag quilt.

(6) jog cell dispersion, whirlpool does not rock.37 DEG C, 5%CO ₂hatch and clean 1 time with PBS, replaced medium in 48 hours.

2.ADAMTS2 interference (AdshADAMTS2) and process LAN (AdADAMTS2) adenovirus are on the impact of the cardiac myocyte hypertrophy model of inducing through AngII

AdshRNA(is containing the reticent RNA of shRNA() adenovirus, with comparing), AdshADAMTS2(is containing the reticent RNA-ADAMTS2 fusion rotein of shRNA-ADAMTS2() adenovirus), AdGFP(is containing GFP(green fluorescent protein) adenovirus, with comparing) and AdADAMTS2(containing GFP-ADAMTS2(green fluorescent protein-ADAMTS2 fusion rotein) adenovirus) (building process of these adenoviruss is see document: ChenK, GaoL, LiuY, etal.Vinexin-β protectsagainstcardiachypertrophybyblockingtheAkt-depend entsignallingpathway [J]. basicResCardiol 2013,108 (2): 1-14.) adenovirus 10MOIs infects the cultivation primary cardiomyocytes of 3 days respectively, with 1 μM of Angiotensin II (AngII) (available from Sigma after 12 hours, A9525) or contrast PBS stimulate 48 hours, then carry out immunofluorescence test.Result shows the comparatively AdshRNA matched group increase of the myocardial cell surface area after AdshADAMTS2 adenovirus infection, myocardial cell surface area through AdADAMTS2 adenovirus infection then obviously reduces (Fig. 3) than matched group AdGFP, namely the interference adenovirus of ADAMTS2 promotes cardiac myocyte hypertrophy, and the process LAN adenovirus of ADAMTS2 suppresses cardiac myocyte hypertrophy.

Embodiment 4 myocardial hypertrophy model mice myocardial hypertrophy and fibrosis detect

1. adopt aorta arch constriction operation (AB) to set up mouse cardiac muscle hypertrophy model

Select 8-10 age in week, body weight is respectively divided into sham operated rats (Sham) and AB art myocardial hypertrophy model group at the wild-type mice (WT) of 23.5-27.5g, ADAMTS2 knock out mice (ADAMTS2-KO), heartspecific ADAMTS2 transgenic mice (ADAMTS2-TG) and nontransgenic mice (ADAMTS2-NTG), i.e. WTSham group, WTAB group, ADAMTS2-KOSham group, ADAMTS2-KOAB group, ADAMTS2-TGSham group, ADAMTS2-TGAB group, ADAMTS2-NTGSham group, ADAMTS2-NTGAB group, often organize 10 mices.Modeling method is with embodiment 2.The postoperative detection carrying out myocardial hypertrophy and Fibrotic detection and cardiac function for 4 weeks respectively of AB.

2. draw materials

(1) previous work: the urine cup preparing volume fraction 10% formaldehyde that 20mL is housed in advance, and post label (mouse number, group, type of surgery and draw materials the date).The culture dish filling mass fraction 10%KCl solution is placed in the place that draws materials.Open analytical balance, return to zero for subsequent use.Weigh again and put to death mice.

(2) draw materials: the vessel pedicle below auricle clamped by the curved tweezer of ophthalmology, cuts heart, be placed in rapidly mass fraction 10%KCl solution.Until cardiac arrest after relaxing period, be placed on sterile gauze, extrude heart intracavity liquid gently, after dipping in dry surface liquid, weigh and record, heart is put into corresponding urine cup, detect for pathology after fixing 48h.

(3) measurement of correlation and calculating: take out mice lungs, after pruning, filter paper blots, and weighs and record.Cut off mouse hind leg tibia place skin, measure and record tibia length.Calculate the heart and weigh the ratio (HW/BW) with body weight, lung weighs with the ratio (LW/BW) of body weight and the heart is heavy and the ratio (HW/TL) of tibia length.

3. pathology detect

3.1 prepare paraffin specimen section

Main operation sequence comprises pruning heart → embedding frame process → running water → dehydration → transparent → waxdip → embedding → section → stand sheet → dry or for subsequent use after toasting.

3.2 hematoxylin-eosins (HE) dye

Key step is: get paraffin specimen and cut into slices 55 DEG C and toast 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → washing 1min → 1% hydrochloride alcohol (getting 3mL concentrated hydrochloric acid fully to mix homogeneously with 297mL70% ethanol) 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, Magnesium sulfate heptahydrate 2g, both are dissolved in 100mL distilled water) 1min → washing 1min → Yihong solution (Zhuhai shellfish rope, BA-4024) 3-5min → distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of in the not dry mounting → fume hood immediately of dimethylbenzene and dry up, microscope is taken pictures.

HE dyeing picture statistics: every pictures selects more than 3 clear border, and core is roughly positioned at the cell of central authorities, with Image-ProPlus6.0 software circle cell area.

3.3 WGAs (WGA) dye

Key step: the paraffin specimen section through 60 DEG C of baking 30min is placed in dimethylbenzene 5min × 3 time → 100% ethanol 5min × 2 time → 95% ethanol 5min → 70% ethanol 5min → distilled water rinsing 5min × 2 time → PBS rinsing 5min → PBS rinsing 10min → discard PBS, drip pancreatin working solution (DIG-3008, Foochow steps new) 37 DEG C of lucifuges hatch 20min → PBS rinsing 5min × 3 time → take out section, the liquid (tissue is sure not drying) around tissue is dried with filter paper, to lie against in wet box → drip WGA-AlexaFlour488 working solution (10 μ g/mL) 37 DEG C of lucifuges with groupization stroke circle and hatch 2h → discard dye liquor, PBS rinsing 5min × 3 time → SlowFadeGoldantifadereagentwithDAPI mounting → viewed under fluoroscopy, microscope is taken pictures.

3.4 Picro-Sirius reds (PSR) dye

Key step is: get paraffin specimen and cut into slices 55 DEG C and toast 30min → dimethylbenzene 2min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → running water 10min → distilled water 1min → mass fraction 0.2% phosphomolybdic acid 2min → 0.1% sirius red picric acid solution drips in tissue, dye in wet box 90min → removal residual liquid → 0.01N hydrochloric acid 4s → 70% ethanol 1 time → 90% ethanol 1 time → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of dimethylbenzene not dry coverslip immediately mounting, microscope is taken pictures.

PSR dyeing picture statistics (Image-ProPlus6.0 software): collagen ratio=area of collagen/(gross area-blank area) × 100%.

Cardiac muscular tissue is made up of myocardial cell and stroma, and heart is a whole end differentiation organ, and myocardial cell loses multiplication capacity, the myocardial cell reaction that various physiology or pathological stimuli cause, and can only be that the volume of individual cells increases and can not quantitatively breed.Therefore, in the pathophysiological process of myocardial hypertrophy, main manifestations is that myocardial cell volume increases, muscle segment increasing number, cell arrangement is disorderly, and cardiac mesenchymal changes the propagation and the conversion that comprise Cardiac Fibroblasts, collagen fiber density increases, and collagen secretion increases, collagen proportional balancing method imbalance etc.

Phenotypic results after WT and ADAMTS2-KO mice adopts AB art to set up myocardial hypertrophy model is shown in Fig. 4-6.Sham(sham-operation) the equal not statistically significant of the difference between HW/BW, LW/BW and HW/TL of WT mice and ADAMTS2-KO mice in group; WT mice AB HW/BW, LW/BW, HW/TL of postoperative 4 weeks are higher than its Sham group; Postoperative 4 weeks of AB, HW/BW, LW/BW and HW/TL all comparatively WT mice rising (Fig. 4) of ADAMTS2-KO mice.HE and WGA stained can be observed: Sham group heart no significant difference, and AB group all increases compared with the heart of Sham group, and the heart of ADAMTS2-KO mice is obviously greater than WT mice; Sham group myocardium myo fibril cell arrangement is neat, fine and close, and form is complete, karyon and nucleolar structure clear; AB group myofilament arrangement disorder, loose, myocardial cell volume obviously increases, form irregularity, karyon engrain, increase, deformity, and kernel is fuzzy, and ADAMTS2-KO group is more obvious than WT group cellular mast, and difference has statistical significance (Fig. 5).After PSR dyeing, find the comparatively Sham group increase of AB group myocardium of ventricle interstitial collagen content, around arteries, collagen increase is more obvious, and collagen increases thick, and arrangement disorder becomes network-like; ADAMTS2-KO mice AB postoperative myocardial interstitial collagen content and perivascular collagen content are then than the postoperative increase of WT mice AB more (Fig. 6).These results suggest that obvious myocardial hypertrophy occurs mice after the modeling of AB art, the myocardial hypertrophy of ADAMTS2-KO mice and fibrosis are greater than WT mice.

Fig. 7-9 is the phenotypic results after ADAMTS2-NTG and ADAMTS2-TG mice adopts AB art to set up myocardial hypertrophy model.The degree that HW/BW, LW/BW and HW/TL of AB postoperative 4 weeks ADAMTS2-TG mices increase is significantly less than ADAMTS2-NTG mice (Fig. 7).HE and WGA stained can be observed: the degree that the postoperative ADAMTS2-TG mouse heart of AB increases is much smaller than ADAMTS2-NTG mice; ADAMTS2-TG mice AB postoperative myocardial cell cross section is long-pending is significantly less than ADAMTS2-NTG mice AB group (Fig. 8).PSR dyeing is visible, and ADAMTS2-TG mice AB postoperative myocardial interstitial collagen content and perivascular collagen content are less than ADAMTS2-NTG mice AB group (Fig. 9).These results suggest that obvious myocardial hypertrophy occurs mice after the modeling of AB art, the myocardial hypertrophy of ADAMTS2-TG mice and fibrosis are less than ADAMTS2-NTG mice.

4. ultrasound detection cardiac function

4.1 early-stage preparations

(1) anesthetic machine prepares: first connect the intake interface on oxygen cylinder and anesthetic machine, then turn on dosing mouth seal cover on anesthetic machine, tighten seal cover after adding rapidly isoflurane to safe scale.Turn on total valve on oxygen cylinder, the knob of adjustment flow control valve, outlet pressure maintains 0.2-0.3mPa.

(2) mice to be measured prepares: after mice to be detected is anaesthetized rapidly with isoflurane, hair is shaved in left anterior pectorial region, the mouse head handled well is stretched into anesthetis conduit pullover in, maintain the stable narcotism of mice with 1.5-2.0% isoflurane.

4.2 cardiac function detect

Mice gets left lateral position or dorsal position, and is shaving hair-fields uniform application ultrasonic coupling agent (Tianjin Cheng Xin company).Adopt high-frequency ultrasound in diagnosis instrument, frequency is 15MHz, selection standard papillary muscles of left ventricle short axis view, measures LVED (Left Ventricular End Systolic Dimension) (LVEDD), left room end systolic diameter (LVESD) and shortening fraction (FS).

Figure 10 is the cardiac function testing result after WT and ADAMTS2-KO mice adopts AB art to set up myocardial hypertrophy model.Compared with WTSham group, WT mice AB shows decreased cardiac function and myocardial hypertrophy in postoperative 4 weeks, and main manifestations is index LVEDD, the LVESD increase all in various degree of myocardial hypertrophy, reflects that the index FS of cardiac function then declines.Postoperative 4 weeks of AB, the cardiac function deterioration degree of ADAMTS2-KO mice is greater than WT mice (Figure 10).

Figure 11 is the cardiac function testing result after ADAMTS2-NTG and ADAMTS2-TG mice adopts AB art to set up myocardial hypertrophy model.Postoperative 4 weeks of AB, compared with ADAMTS2-NTG mice, the cardiac function deterioration degree of ADAMTS2-TG mice is then less than ADAMTS2-NTG group (Figure 11).

From above result; in the myocardial hypertrophy disease model that aorta arch constriction causes, ADAMTS2 genetic flaw significantly promotes myocardial hypertrophy, fibrosis, worsens cardiac function; ADAMTS2 gene overexpression significantly suppress myocardial hypertrophy, fibrosis, cardiac function protecting.Therefore ADAMTS2 gene has cardiac function protecting and suppresses myocardial hypertrophy and Fibrotic effect, particularly ADAMTS2 gene to have the effect of the myocardial hypertrophy relevant disease generation that aorta arch constriction can be suppressed to cause.

Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims (9)

1. containing the application of disintegrin sample metalloproteases 2 in the medicine of screening cardioprotection function of I type thrombospondin sequence.

2. containing the application of disintegrin sample metalloproteases 2 in the medicine preparing cardioprotection function of I type thrombospondin sequence.

3. application according to claim 2; it is characterized in that: comprise disintegrin sample metalloproteases 2 containing I type thrombospondin sequence as the effective ingredient of the medicine of cardioprotection function, the chemical substance that the disintegrin sample metalloproteases 2 containing I type thrombospondin sequence can be promoted to express is as the effective ingredient of the medicine of cardioprotection function.

4. containing the application of disintegrin sample metalloproteases 2 in the medicine of the anti-cardiac fibrosis of screening of I type thrombospondin sequence.

5. containing the application of disintegrin sample metalloproteases 2 in the medicine of the anti-cardiac fibrosis of preparation of I type thrombospondin sequence.

6. application according to claim 5, it is characterized in that: comprise disintegrin sample metalloproteases 2 containing I type thrombospondin sequence as the effective ingredient of the medicine of anti-cardiac fibrosis, the chemical substance that the disintegrin sample metalloproteases 2 containing I type thrombospondin sequence can be promoted to express is as the effective ingredient of the medicine of anti-cardiac fibrosis.

7. the disintegrin sample metalloproteases 2 containing I type thrombospondin sequence prevents in screening, alleviates and/or treats in the medicine of myocardial hypertrophy and applies.

8. the disintegrin sample metalloproteases 2 containing I type thrombospondin sequence prevents in preparation, alleviates and/or treats in the medicine of myocardial hypertrophy and applies.

9. application according to claim 8, it is characterized in that: comprise disintegrin sample metalloproteases 2 containing I type thrombospondin sequence as prevention, alleviate and/or the effective ingredient of medicine for the treatment of myocardial hypertrophy, the chemical substance that the disintegrin sample metalloproteases 2 containing I type thrombospondin sequence can be promoted to express is as prevention, alleviation and/or the effective ingredient of medicine for the treatment of myocardial hypertrophy.