KR100981995B1 - FRM-EGF fusion protein and composition for wound healing comprising the same - Google Patents

Abstract

The present invention relates to a polynucleotide encoding a FRM-EGF fusion protein and a composition for promoting wound healing comprising the same, more specifically, a polynucleotide encoding a FRM-EGF fusion protein, a vector comprising the polynucleotide, and the Provided are a wound healing promoting composition comprising the vector as an active ingredient. The fusion protein of the present invention is suitable for gene therapy because it has high protein expression efficiency and extracellular excretion effect, and has a remarkable effect on wound healing effect, neovascularization and dermatitis relief.

FRM, EGF, FRM-EGF fusion protein, wound healing, neovascularization, dermatitis

Description

Polynucleotide encoding a F-M fusion protein and a composition for promoting wound healing comprising the same {FRM-EGF fusion protein and composition for wound healing comprising the same}

The present invention relates to a polynucleotide encoding a FRM-EGF fusion protein and a composition for promoting wound healing comprising the same, in detail, a polynucleotide encoding a FRM-EGF fusion protein, a vector comprising the polynucleotide, and the vector It relates to a composition for promoting wound healing as an active ingredient.

The normal wound healing process has three stages: inflammatory response, granulation tissue formation, new epithelial cells and neovascularization. When these mechanisms are done properly, complete healing is possible, but in diabetic foot ulcer patients, all these mechanisms are impaired, resulting in the slower angiogenesis or granulation tissue formation than the normal population, resulting in the worst case cutting due to secondary infection. This happens. Many studies are being conducted to effectively treat diabetic foot ulcers that can cause serious health and economic problems, and among them, treatment methods using growth factors have been actively studied.

Growth factor opens up the possibility of treating malignant or chronic wounds by inducing the activity of various cells. Growth factors regulate many factors necessary for cell activity, such as cell division and migration and angiogenesis. Growth factors involved in this process include epidermal growth factor (EGF), platelet derived growth factor (PDGF), fibroblast growth factor (FGF), keratinocyte growth factor (KGF), transforming growth factor-β (TGF-β), and granulocyte colony stimulating factor (G-CSF) and vascular endothelial growth factor (VEGF).

EGF was first detected in the salivary glands of rats in 1962 and human EGF (hEGF) was isolated in 1975 (Taylor JM, et. Al., J Biol Chem 247: 5928-34, 1972; avage CR , et. al., J Biol Chem 248: 7669-72, 1973). Mature EGF consists of 53 amino acids and comprises three disulfide bonds (Gregory H, Nature 257: 325-7, 1975; Cohen S, et. Al., Proc. Natl. Acad. Sci. USA 72: 1317-21, 1975). EGF's role in wound healing involves the activation of platelets, macrophages, and monocytes by binding to EGF receptors on epithelial and fibroblasts, thereby proliferating, differentiating and forming neovascularization, and in many cell lines. Various biological phenomena, such as DNA, RNA, and protein synthesis, enhance wound healing (Servold SA, Clin Podiatr Med Surg, 8: 937-53, 1991; Brown GL, et. Al., J Exp Med, 163: 1319-24, 1986; Carpenter, G., et. Al., Annu Rev Biochem, 48: 193-216, 1979). Based on various previous results, it has been shown that EGF has a great effect on the treatment of skin wounds (Andree C, et. Al., Proc Natl Acad Sci USA, 91: 12188-92, 1994; Brazzell RK, et. Al., Invest Ophthalmol Vis Sci 32: 336-40, 1991; Hong JP, et.al., Ann Plast Surg, 56: 394-8, 2006). Proteins are synthesized through DNA recombination technology (Andree C). , et. al., Proc Natl Acad Sci USA, 91). Recombinant protein preparations endothelial growth factor is applied directly to the surface of the sterile wound or sprayed. However, the wound surface of the skin during the healing process contains a large amount of non-specific protease that rapidly degrades all proteins, so it is necessary to apply at least once a day by breaking down the applied endothelial growth factor protein quickly. Because of the high molecular weight, recombinant proteins rarely penetrate into the wound after being applied to the surface. Therefore, 50-100 times the dose required for the actual wound recovery must be applied. Recombinant protein preparations are costly to produce, transport, and store, so they need to be administered 50-100 times the amount needed to repair the wound and applied daily to the wound site. In fact, in Korea, which has already been commercialized for many years, the cost is too high and is not widely used in clinical practice. In addition, daily application to the wound is very uncomfortable for medical staff, and opening the wound site daily for wound healing may be undesirable from a therapeutic point of view.

Recently, gene therapy has gained much attention as a way to compensate for this. Gene therapy can enhance the wound healing effect by administering DNA directly to the wound and expressing the necessary protein in the cells of the wound for a long time. According to the technical method of delivering DNA into cells, gene therapy can be largely divided into a method using a viral carrier and a non-viral carrier. Viral carriers have the advantages of high gene transfer and expression efficiency and long-term gene expression, while varying the risk of mutations and malignant tumors through the induction of immune responses and unwanted integration into human chromosome DNA. And fatal side effects may occur. Virus carriers have been used extensively in laboratories for research purposes, but they are still difficult to use for therapeutic purposes in humans. The non-viral carrier gene therapy method uses plasmid-type genes, which are safer than the viral carrier method but have low expression efficiency. There was a drawback of short duration of expression.

The present inventors have tried to develop a plasmid for gene therapy of endothelial growth factor gene, which has been fully demonstrated its efficacy and safety for wound repair, and has a FRM (furin recognition motif) coupled to the N terminus of endothelial growth factor gene. The plasmid containing the fusion protein not only increases the protein expression efficiency but also significantly increases the efficiency of excretion out of the cell, thereby confirming that the wound healing effect is significantly increased when the gene therapy using the same is completed, thereby completing the present invention.

It is an object of the present invention to provide a polynucleotide encoding a FRM-EGF fusion protein that is efficient for gene therapy.

Another object of the present invention is to provide a vector comprising a polynucleotide encoding the FRM-EGF fusion protein of the present invention, a cell transformed with the vector, and a method for producing a FRM-EGF fusion protein using the vector.

Still another object of the present invention is to provide a composition for promoting wound healing, a composition for promoting neovascularization and a composition for treating skin inflammation, including a vector comprising a polynucleotide encoding a FRM-EGF fusion protein.

In order to achieve the above object, the present invention provides a polynucleotide encoding the FRM-EGF fusion protein.

In order to achieve another object of the present invention, a vector comprising a polynucleotide encoding the FRM-EGF fusion protein of the present invention, a transformant transformed with the vector is provided.

In order to achieve the another object of the present invention, there is provided a composition for promoting wound healing, a composition for promoting neovascularization and a composition for treating skin inflammation, comprising a vector comprising a polynucleotide encoding a FRM-EGF fusion protein.

Since the expression level of the FRM-EGF fusion protein of the present invention is higher than that of mature EGF, and the secretion efficiency to the outside of the cell is high, the vector containing the polynucleotide encoding the fusion protein of the present invention is suitable for gene therapy, The composition has a wound healing effect and neovascularization and skin inflammation alleviating effect.

Hereinafter, the present invention will be described in detail.

The EGF gene in the human chromosome consists of the signal peptide, the prepro-site, the mature EGF, the transmembrane domain and the cytoplasmic domain from the N 'terminus. In the protein synthesis process, endothelial growth factor protein is converted into 827 amino acids and secreted out of the cell, and then hydrolyzed to produce 6kDa mature EGF protein having only 53 amino acids. The full-length EGF gene (828 bp) includes a mature EGF gene (159 bp) corresponding to 6 kDa mature EGF and a cytoplasmic domain (membrane-anchoring domain) and a transmembrane domain (see FIG. 1). Since EGF is synthesized in cells, they are not completely secreted out of cells, and more than half of endothelial growth factors are known to have biological effects by being attached to the outer wall of synthesized cells. This phenomenon is undesirable in gene therapy and can halve the effects of gene therapy. When a growth factor or hormone is produced, its biological effects are limited to the cells that produced it (autocrine), only around the cells it produces (paracrine), and finally away from cells produced through the blood. It can be divided into endocrine where the effect is far away. In case of EGF, autocrine and paracrine are the main modes of action, and endocrine is known to be relatively weak. The problem is that paracrine action, which is effective in the vicinity of the produced cell, is only effective in the next cell when a large amount is attached to the produced cell membrane, such as endothelial growth factor. If it can be secreted, it can maximize the effectiveness of gene therapy by allowing it to be effective not only in the cell immediately next to the cell but also in cells that are far apart.

Furin is an enzyme present in the Golgi apparatus and is one of the proteases that plays an important role in the synthesis and secretion of many proteins, hormones and growth factors. Most of the peptide hormones are synthesized in ribosomes and then secreted into ER (endoplasmic reticulum) in the form of preprohormones. The hormone precursors are transported through the ER to the Golgi apparatus and completed by excision of unnecessary parts by the furin present therein. In the form of hormones, the final secretion. Furin recognition motifs (FRMs) are known to enhance the transport of proteins in endoplasmic reticulum by making the autocatalytic cleavage more active. In the case of plasmids that use powerful promoters for gene therapy, too much product is produced when overproduced proteins or peptides pass through the ER and Golgi, causing ER trafficking. Inversely, it is known that it can be suppressed. When this happens, the efficiency of gene therapy can be compromised. In order to overcome this phenomenon, the present inventors prepared a fusion protein of furin and FRM for the purpose of allowing EGF produced in excess efficiently to rapidly pass ER and Golgi. The FRM-EGF fusion protein of the present invention means that the FRM is bound to the N terminus of the full-length EGF protein, and preferably has the amino acid sequence of SEQ ID NO: 1.

The present invention also provides a polynucleotide encoding the FRM-EGF fusion protein. Preferably, the polynucleotide of the present invention may have a nucleotide sequence encoding the amino acid of SEQ ID NO: 1, more preferably may have a nucleotide sequence represented by SEQ ID NO: 2.

The polynucleotide encoding the FRM-EGF fusion protein may be operably linked to an expression control sequence and inserted into the expression vector. 'Operably linked' as used herein means that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by another nucleic acid fragment. In addition, "expression control sequence" refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell. Such regulatory sequences include promoters for initiating transcription, any operator sequence for regulating transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control termination of transcription and translation. The promoter may be a promoter (constitutive promoter) to induce the expression of the gene of interest at all times at all times, for example, CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199 , 1991; Monahan et al., Gene Therapy, 7: 24-30, 2000) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985) and chicken β actin promoter. Preferably, the chicken β actin promoter showing a certain degree of expression in vivo and in vitro can be used.

The fusion protein of the present invention can be produced by chemical synthesis or genetic recombination method, preferably by using a recombinant vector transformed to the host cell can be produced by separating and purifying the expressed protein therefrom.

Accordingly, the present invention provides a recombinant vector comprising a nucleotide encoding the FRM-EGF fusion protein of the present invention and a transformant transformed with the recombinant vector. The transformant includes microorganisms such as E. coli, yeast, and the like.

In an embodiment of the present invention, a human EGF gene is used as a template, and specific EGF828 (EGF159), FRM-EGF159, mature EGF, transmembrane domain and cytoplasmic domain containing EGF828 or FRM-EGF, respectively. Obtained by PCR using a primer set, it was ligated to the pβ-vector containing the chicken β actin promoter. Each recombinant vector was then transformed into E. coli (see Example 1).

The present invention also provides a method for producing a fusion protein of the present invention by culturing the transformant transformed with the recombinant vector.

The process for producing the fusion protein of the present invention by genetic recombination involves the following steps:

First, a recombinant vector is prepared by inserting a gene encoding a fusion protein into a vector. As a vector for inserting a foreign gene, various types of vectors such as plasmids, viruses, and cosmids can be used. In the present invention, in order to increase the expression level of the transfected gene in the host cell, the recombinant vector must be linked to be operable to transcriptional and translational expression control sequences that function in the selected expression host. The type of recombinant vector is not particularly limited as long as it functions to express a desired gene and to produce a desired protein in various host cells of prokaryotic and eukaryotic cells, but has a promoter with strong activity and strong expression, similar to natural state. Vectors that can produce large amounts of foreign protein in form are preferred. The recombinant vector preferably contains at least a promoter, an initiation codon, a gene encoding a desired protein, and a termination codon terminator. In addition, DNAs encoding signal peptides, enhancer sequences, non-translated regions, selectable marker regions, or replicable units on the 5 'and 3' sides of the desired gene may be appropriately included.

A wide variety of expression host / vector combinations can be used to express the fusion protein according to the invention. Suitable expression vectors for eukaryotic hosts include, but are not limited to, expression control sequences derived from SV40, bovine papilloma virus, adenovirus, adeno-associated virus, cytomegalovirus and retrovirus. . Expression vectors that can be used in bacterial hosts include bacterial plasmids that can be exemplified by E. coli, such as pET, pRSET, pBluescript, pGEX2T, pUC vectors, col E1, pCR1, pBR322, pMB9, pβ and derivatives thereof, Plasmids with a wider host range, such as RP4, phage DNA that can be exemplified by a wide variety of phage lambda derivatives such as λgt10 and λgt11, NM989, and other DNA such as DNA phages of M13 and filamentary single strands Phage is included. Useful expression vectors for yeast cells are 2 ° C. plasmids and derivatives thereof. A useful vector for insect cells is pVL941.

Secondly, the host cell is transformed using the recombinant vector and then cultured. Methods for preparing transformants by introducing recombinant vectors into host cells are described in Sambrook, J. et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74 (1989). The calcium phosphate method or the calcium chloride / rubidium chloride method, the electroporation method, the electroinjection method, the chemical treatment methods such as PEG, a gene gun, etc. can be used. When the transformant expressing the recombinant vector is cultured in a nutrient medium, a large amount of useful protein can be prepared and separated. The medium and culture conditions may be appropriately selected depending on the host cell. In culture, conditions such as temperature, pH of the medium, and incubation time should be appropriately adjusted to be suitable for cell growth and protein production. A host cell that can be transformed with a recombinant vector according to the present invention includes both prokaryotic and eukaryotic cells, and a host having high DNA introduction efficiency and a high expression efficiency of introduced DNA is usually used. Bacteria, for example, known eukaryotic and prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera fruitgifer (SF9), CHO, COS1, Animal cells such as COS 7, BSC 1, BSC 40, BMT 10, human embryonic kidney cell lines, mouse embryonic fibroblast lines, CHO cells and the like are examples of host cells that can be used.

Third, induction and accumulation of the expression of the fusion protein.

Finally, the fusion protein is separated and purified. In general, recombinantly produced peptides can be recovered from the medium or cell lysate. If membrane bound, it may be liberated from the membrane using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for hybrid peptide expression can be disrupted by various physical or chemical means, such as freeze-thaw purification, sonication, mechanical disruption or cell digestion, and can be isolated and purified by conventional biochemical separation techniques. Sambrook et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press (1989); Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA (1990). Electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent chromatography, size exclusion chromatography, etc.), isoelectric focusing and various variations and combinations thereof, It is not limited to this. In the FRM-EGF fusion protein having the amino acid sequence represented by SEQ ID NO: 1 of the present invention, EGF159 was able to observe that the protein was present only in the cell, whereas EGF828 was sufficiently discharged out of the cell. It was also found that in all cell lines, EGF828 with FRM (FRM-EGF828) expressed more EGF protein than EGF828 without FRM. In particular, the expression rate of HEK 293 cell line showed a difference of about 2 times depending on the presence of furin cleavage site (FIG. 5). Therefore, EGF must have a cytoplasmic domain (membrane-anchoring domain) in the EGF gene to release protein out of the cell. FRM significantly increases expression in cells and increases the efficiency of EGF completely out of the cell. It could be confirmed that it can be made (see FIGS. 5 to 7). In addition, in order to confirm whether the FRM-EGF828 fusion protein of the present invention has the same biological activity as that of endogenous EGF, changes in PI3K and GSK3β, which are lower signaling materials affected by phosphorylation when EGF meets the EGF receptor and activates a signal As a result, it was confirmed that the same biological activity as the endogenous EGF (see Fig. 8).

The vector containing the polynucleotide encoding the fusion protein of the present invention has already had a clinical therapeutic effect in the form of a recombinant protein preparation for the intractable chronic diabetic cutaneous wound or other wounds secondary to refractory. It has been demonstrated that the efficiency of expressing EGF, which is currently used in actual clinical practice, has been increased and the efficiency of secretion out of cells has been significantly increased (see Example 2), which makes it suitable for gene therapy for wound healing. The gene therapy method using the vector of the present invention is not a form of protein to be administered to the wound site every day, but expresses a long-term endothelial growth factor in the wound tissue with a single injection, which can facilitate the rapid recovery of the wound very conveniently and expression efficiency Is significantly increased and improved to the level that can be used in actual clinical practice.

In order to confirm whether the vector of the present invention actually has a wound healing effect in an animal model, the present inventors made a diabetic animal model and injected the vector of the present invention into a wound site to investigate the wound recovery rate. It can be seen that the recovery rate of the wound is fast to the same extent as (see FIGS. 10 and 11).

In addition, as a result of investigating the neovascularization effect in the diabetic model, when the gene treatment with the vector of the present invention was recovered to the same degree as the normal control (see Fig. 12), it was observed that the skin inflammation is also reduced (see Fig. 13). .

Therefore, the present invention provides a composition for promoting wound healing, comprising the recombinant vector of the present invention as an active ingredient. The present invention also provides a composition for promoting neovascularization and a composition for treating skin inflammation using the recombinant vector of the present invention as an active ingredient.

The composition may be administered orally or parenterally, and may be formulated by methods well known in the art for preparing such dosage forms, and include commonly used fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like. Diluents or excipients can be used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, water, or the like in the recombinant protein of the present invention. It is prepared by mixing cross or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used. Oral liquid preparations include suspensions, solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . For parenteral administration, it may be administered as an external potion, cream, gel, ointment, spray, spray, suspension, etc., when formulated, diluents such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are commonly used. Or using excipients. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, and lyophilized preparations. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, ethyl oleate and the like can be used. The composition of the invention is preferably topically injected with the vector of the invention for gene therapy.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

≪ Example 1 >

EGF Cloning

<1-1> Preparation of PCR Product Encoding FRM-EGF Fusion Protein

The human EGF gene is composed of a signal peptide, a prepro-site, a mature EGF, a transmembrane domain and a cytoplasmic domain (membrane-anchoring domain) from the N 'terminus (FIG. 1). In the protein synthesis process, the EGF protein is converted into 827 amino acids and secreted out of the cell to undergo proteolysis to produce 6kDa mature EGF protein having only 53 amino acids. Therefore, the present inventors have used a human mature EGF plasmid, which includes a 159 bp mature EGF gene (EGF159) or a 828 bp cytoplasmic domain (membrane-anchoring domain) corresponding to 6 kDa mature EGF. A plasmid containing EGF828) was prepared and used to compare the amount of EGF protein expression. At this time, the FRM of the nucleotide sequence shown in SEQ ID NO: 8 was inserted into the EGF N terminus to overcome the blockage in the ER of the recombinant protein, which is commonly used when using a strong promoter.

More specifically, the human EGF gene was used by donated by Dr. Siu-Yuen Chan of Hong Kong University and the primer sequences for gene amplification are summarized in Table 1. Using PCR premix (Invitrogen, CA, USA), EGF159 was first denatured at 95 ° C. for 10 minutes using a primer pair represented by SEQ ID NOs: 13 and 14, followed by 30 seconds denaturation at 94 ° C., binding at 57 ° C., 68 PCR products were obtained by further expansion at 30 ° C. for 30 minutes and further expansion at 68 ° C. for 7 minutes. FRM-EGF159 was extended for 30 seconds at 94 ° C., 40 ° C. binding, 68 ° C. extension for 30 cycles, 68 minutes further at 68 ° C. using a primer pair represented by SEQ ID NOs: 7 and 14, followed by cloning by PCR product. Was carried out. On the other hand, EGF828 was obtained by dividing into two parts. First, the PCR product is made from the signal peptide (56 ° C binding) and the mature EGF sequence from the full length EGF to the transmembrane domain and the cytoplasmic domain (56 ° C binding). First, the signal peptide portion was denatured at 95 ° C for 10 minutes by PCR process using a primer pair represented by SEQ ID NOs: 9 and 10 at 95 ° C for 10 minutes from a gene donated at the University of Hong Kong (Full length EGF). PCR products were obtained by binding at 56 ° C., expansion at 68 ° C. for 30 cycles, and further expansion at 68 ° C. for 7 minutes. Secondly, starting from the mature EGF sequence, the transmembrane domain and the cytoplasmic domain (56 ° C binding) were denatured at 95 ° C for 10 minutes with the primer pairs represented by SEQ ID NOs: 11 and 12, and then denatured at 94 ° C for 30 seconds, The product is obtained by binding at 56 ° C., expansion at 68 ° C. for 30 cycles, further expansion at 68 ° C. for 7 minutes. Then, using each of the PCR products obtained in the first and second as a template, the primer pairs represented by SEQ ID NOs: 9 and 12 were denatured for 10 minutes at 95 ° C in the PCR process, and then denatured at 94 ° C for 30 seconds, and at 56 ° C. Binding, expansion at 68 ° C. for 30 cycles, extension at 68 ° C. for 7 minutes yields the EGF828 product. FRM-EGF828 uses this PCR product again as a template to denature at 95 ° C for 10 minutes with the primer pairs shown in SEQ ID NOs: 8 and 12, then denature at 94 ° C for 30 seconds, bind at 56 ° C, and expand at 68 ° C. Expansion at 30 cycles, 68 ° C. for 7 minutes yielded the FRM-EGF828 product containing the desired furin recognition site.

Table 1.

Primer (5 '→ 3') Furin sequence -1 (SEQ ID NO: 7) CCGAATTCATGCGGGGACGGCGGAATAGTGACTC
TGAATGTCCC Furin sequence -2 (SEQ ID NO: 8) CCGAATTCATGCGGGGACGGCGGATGCTGCTCAC
TCTTATC Signal peptide-Forward (SEQ ID NO: 9)  CCGAATTCATGCTGCTCACTCTTATC Signal peptide-Reverse (SEQ ID NO: 10) TTCAGAGTCACTATTGTCTCTATTTCCTGCGAGA
GT EGF828-Forward (SEQ ID NO: 11)  ACTCTCGCAGGAAATAGAGACAATAGTGACTCT GAA EGF828-Reverse (SEQ ID NO: 12)  AAAAGCGGCCGCTCACTGCGTCTCCATTTG EGF159-Forward (SEQ ID NO: 13)  AATAGTGACTCTGAATGTCCCCTG EGF159-Reverse (SEQ ID NO: 14)  GCGCAGTTCCCACCACTTCAG

<1-2> Plasmid Preparation Comprising EGF Gene Sequence

Each of the four PCR products (EGF159, FRM-EGF159, EGF828, FRM-EGF828) prepared in Example <1-1> and the expression vector were ligated. The vector used a pβ-vector containing a chicken β-actin promoter showing a certain level of expression in vitro and in vivo, which is a restriction enzyme ARI (adiponectin) from pβ-FADN donated by Dr. Kim Sung-wan, University of Utah, USA And ligation was used to remove the NotI, and ligation was performed by observing the multi-cloning site of the pβ-vector and then ligating the pβ-vector and EGF genes after treatment with EcoRⅠ and NotⅠ restriction enzymes present in the vector but not in the EGF sequence. The plasmid was isolated.

First, each of the four PCR products and pβ-vector was treated with EcoR I and Not I restriction enzymes, followed by ligation at 4 ° C. for 16 hours using T4 DNA ligase (Bionia, Daejeon, Korea). (pβ-EGF159, pβ-FRM-EGF159, pβ-EGF828, pβ-FRM-EGF828) were prepared (see FIG. 3). The self sequence of the pβ-FRM-EGF828 vector is shown in SEQ ID NO: 5.

<1-3> Plasmid Transformation Using Escherichia Coli

Four plasmids prepared in Example <1-2>, ie pβ-EGF159, pβ-FRM-EGF159, pβ-EGF828 and pβ-FRM-EGF828, were subjected to E. coli DH5α (Invitrogen, CA, USA) at 42 ° C. After transformation for 90 seconds, the cells were transformed and grown for 1 hour in a 37 ° C incubator. Then, overnight incubation in a solid medium containing empicillin and then using a mini-rap kit (Qiagen, CA, USA) to purify the plasmid and to identify the plasmid EcoR I, Not I restriction enzyme (DCC-bionet, Gyeonggi-do , Korea) and electrophoresed on 1% agarose gel and confirmed using SL-20 DNA Image Visualizer (Surin Science, Seoul, Korea) (see FIG. 4).

<Example 2>

Recombinant EGF Protein Manufacturing

In order to confirm that the cloned EGF plasmid is expressed in various cell lines, four kinds of plasmids prepared in Example 1 were transformed into three cell lines (HEK 293, NIH 3T3, and CHO cell lines), followed by transformation of medium and cells. The protein obtained by dissolving was isolated and confirmed the expression of EGF using a human EGF ELISA kit. At this time, BPEI (branched polyethylenimine, 25 kDa, Sigma-Aldrich, USA), a cationic gene carrier, was used as a carrier of the EGF plasmid.

First, human embryonic kidney cell line HEK 293 (Human Embryo Kidney 293), mouse embryonic fibroblast cell line NIH3T3, and Chinese hamster ovary cell line CHO (Chinese Hamster Ovary) were used as cell lines for expression of EGF. HEK293 and NIH3T3 cell lines were cultured in Dulbecco's Modified Eagle Media (DMEM) (Gibo, CA, USA) .Chinese Hamster Ovary (CHO) cells were cultured in F-12 Coon's modification medium (Sigma, CA, USA). It was. All cell lines were maintained in medium containing 10% fetal bovine serum (Gibco, CA, USA) and antibiotics at 37 ° C, 95% air and 5% CO2 until the experiment.

First, each cell line was cultured in a 6-well plate to be 80% of the area for transformation, and when the cells were stabilized after 24 hours, transfection was performed. Prior to transformation, the cells were incubated in serum-free medium for 1 hour in advance. Branched-PEI (Sigma, MO, USA) was used as a transfection reagent, and the amount of DNA was 10 ug and the DNA / BPEI was set at 5 Nitrogen / Phosphate. The DNA / BPEI complex was reacted at room temperature for 30 minutes, and then placed in cells and incubated for 5 hours, and then changed to a medium containing 10% fetal calf serum. After culturing the transformed cell line as described above for 48 hours, the medium was collected in a 1.5ml tube and refrigerated until protein quantitative testing. The cells were washed once with PBS and then washed with mammalian tissue lysis / Extraction reagent (Sigma, MO, USA) was used to isolate only the protein. The amount of protein expressed was measured using a Quantikine human EGF ELISA kit (R & D, MN, USA). First, the sample was added 200 ul per well, and then reacted at room temperature for 2 hours, washed three times with washing buffer, 200 ul of EGF conjugate was added and reacted at room temperature for 1 hour, and then washed three times with washing buffer, followed by 200 ul of substrate solution. And then observe the change in color. After 30 minutes, 50 ul of a stop solution was added, and absorbance was measured at 450 nm, and each was corrected at a wavelength of 540 nm. All experiments were evaluated for significance by Student t-test.

As a result, the expression amount between the medium and the protein extracted in the cell showed a big difference between the cell lines (Figs. 5 to 7). In the HEK293 cell line, the amount of EGF expression in the protein extracted from the cells was equal to or higher than that in the medium, but in the case of the CHO cell line and the NIH3T3 cell line, the expression amount in the medium was increased. Compared to the amount of EGF expression in the extracted protein was more than six times more.

Comparing the amount of EGF expression by the transformed plasmids, it was observed that EGF159 was only present in the cells while EGF828 was made in the cells, and EGF was sufficiently discharged out of the cells. It was also found that all cell lines expressed more EGF protein than EGF828 without FRM (FRM-EGF828). In particular, the expression rate of HEK 293 cell line showed a difference of about 2 times depending on the presence of furin cleavage site (FIG. 5). Therefore, EGF must have a membrane-anchoring domain in the EGF gene to release proteins out of the cell. FRM can significantly increase the expression in cells and increase the efficiency of EGF completely out of the cell. Could.

<Example 3>

Determination of Biological Activity of Recombinant EGF Proteins of the Invention

To confirm that the overexpressed EGF protein released from the cell has the same biological function as the endogenous EGF protein, changes in PI3K and GSK3β, which are summer signaling agents affected by phosphorylation when EGF encounters the EGF receptor and activates a signal Observed by Western blot (Saito Y, et. Al., Biochem J 303: 27-31, 1994). For this experiment, the cultured cells of NIH3T3 cells overexpressing EGF protein were used as the EGF protein discharged out of the cells, and human lung cancer cells and A549 cells with excessive expression of EGF receptor were used to observe changes in PI3K and GSK3β. . Human lung cancer cell line A549 cells were cultured in Dulbecco's Modified Eagle Media (DMEM) (Gibo, CA, USA).

More specifically, the method of Example 2 transformed the NIH3T3 cell line with FRM-EGF828 and cultured, and then, after 48 hours, only the medium was separated and reacted with the A549 cell line for 2, 5, 10, 15, and 30 minutes. . After the reaction was completed, wash the A549 cells with phosphate buffered saline once, isolate the protein with lysis buffer, centrifuge at 12000 rpm for 10 min at 4 ℃, separate the supernatant, and quantify the protein with BCA kit. Was carried out. For protein isolation, 10% or 12% SDS PAGE gels were used and the amount of protein loaded was 30 ug per well. After protein separation, the PAGE gel was separated and transferred to PVDF membrane, and then blocked with 5% skim milk powder / 0.1% TTBS (Tris-base 2.42 g, NaCl 8 g, Tween 20 1 ml) and PI3K and GSK3β (primary antibody). Cell Signaling, MA, USA) was added and reacted overnight at 4 ° C., followed by rabbit secondary antibody (Bio-Rad, CA, USA) for 1 hour at room temperature for color reaction. AP-conjugated substrate kit (Bio-Rad, CA, USA) was used.

As a result, in the case of PI3K, the highest phosphorylation was observed at 2 minutes, and phosphorylation decreased gradually with time, and in the case of GSK3β, the highest phosphorylation was observed at 10 minutes. It could be seen to decrease gradually (FIG. 8). The difference between PI3K and GSK3β in phosphorylation is that PI3K is the first protein to be phosphorylated when EGF signal is activated, and GSK3β is phosphorylated through proteins such as PI3K, PDK, and PKB. I judged that I could. As a result, it was confirmed in this experiment that EGF expressed through pβ-EGF828 has a biologically appropriate function like endogenous EGF.

As a result of measuring protein expression and biological activity using pβ-EGF129, pβ-FRM-EGF129, pβEGF828, and pβ-EGF828 prepared in the above example, pβ-EGF828 showed the best results, and thus, animal model experiments. Pβ-EGF828 was used.

<Example 4>

Gene therapy with pβ-FRM-EGF828 in diabetic animal models

<4-1> Diabetes Animal Model Preparation and Wound Healing Effect

The purpose of this study was to determine the therapeutic effect of pβ-FRM-EGF828 by injecting diabetes into artificially induced animals.

First, streptozotocin (Streptozotocin), which is known to cause insulin secretion deficient diabetes by selectively destroying insulin secreting pancreatic beta cells, was administered to 6-week-old C57BL6J mice to induce diabetes. To compare the results of treatment, the control group did not cause diabetes, the control group induced diabetes only by streptozotocin, and the group treated with pβ-EGF after induction of diabetes (DM + pβ- The rats were divided into three groups, such as EGF), and eight rats were used for each group. After inducing diabetes, a 5mm diameter full thickness skin ulcer was made on the skin of the back using a skin tissue biopsy tool (Stifel Co., Germany). As shown in FIG. 9, immediately after the wound was made, the plasmid pβ-FRM-EGF828 was injected into the margin of the ulcer with an ultrasonic contrast agent and injected with SonovueR (Bracco, UK), a microbubble generating agent, in an amount of 2W / cm 2. Gene therapy was performed by injection (Sonitron-1000, USA).

As a result, as shown in FIG. 10, diabetic rats, which are positive control mice, were significantly delayed in the recovery of skin wounds, but when the gene therapy was performed in diabetic rats, the wounds were remarkably accelerated. It was confirmed that the wound recovered as soon as the same.

In addition, as a result of confirming the reduction of the wound area over time, the mice treated with the gene using the plasmid pβ-FRM-EGF828 accelerated the wound recovery rate to the same extent as those of the normal control mice (FIG. 11).

<4-2> Confirmation of neovascularization effect in diabetic animal model

On day 6 of pβ-FRM-EGF828 injection, skin ulceration tissue was biopsied to make a tissue staining slide, and immunofluorescence staining was performed using anti-CD31 monoclonal antibody, an angiogenic marker, to generate neoangiogenesis. The degree of As a result, as shown in FIG. 12, green fluorescence was shown to be very strong in the normal control group, indicating that angiogenesis was active at the wounded area, whereas in the positive control group, green fluorescence was faint and almost no neovascularization occurred. This is the same result as previously known. However, in the group treated with the plasmid pβ-FRM-EGF828, green fluorescence appeared almost to the same level as that of the normal control group, indicating that the disorder of angiogenesis caused by diabetes was almost restored to normal by endothelial growth factor gene therapy.

<4-3> Diagnosis of Skin Inflammation in Diabetic Animal Models

After injecting pβ-FRM-EGF828 as in Example <4-1>, the skin tissues were biopsied in each experimental group on day 12 and stained with H & E (hematoxylin and eosin) for 100 times. As a result, diabetic control showed severe edema in the tissue, infiltration of inflammatory cells and poor skin microstructure, whereas skin of diabetic rats treated with plasmid pβ-FRM-EGF828 through gene therapy The tissue showed no edema, no infiltration of inflammatory cells, and showed that the skin microstructure was normally well formed (FIG. 13).

Figure 1 shows the nucleotide sequence of full-length EGF, where A, B, C, and D represent the components of EGF159, FRM-EGF159, EGF828, and FRM-EGF828, respectively (S: signal peptide, TM: transmembrane). Domain and CP: cytoplasmic domain).

Figure 2 is a schematic diagram showing the process of preparing by inserting fragments of EGF159, FRM-EGF159, EGF828, FRM-EGF828 into the pβ vector.

Figure 3 is a schematic diagram of the vector prepared in one embodiment of the present invention, Figure 3a is pβ-EGF159, Figure 3b is pβ-FRM-EGF159, Figure 3c is a schematic diagram of pβ-EGF828, Figure 3d pβ-FRM-EGF828 Are shown respectively.

4 is a gel photograph confirmed by electrophoresis whether the vector of the present invention is properly inserted.

5 is a graph confirming the expression level of the vector of the present invention in HEK293 cells.

6 is a graph confirming the expression level of the vector of the present invention in CHO cells.

Figure 7 is a graph confirming the expression level of the vector of the present invention in NIH3T3 cells.

8 shows the results of confirming the biological activity of the FRM-EGF828 fusion protein of the present invention in A549 cells.

Figure 9 is a photograph showing the process of administering pβ-FRM-EGF828 to diabetes-induced C57BL6J mice.

Figure 10 is a photograph confirming the effect of phase treatment oil over time of pβ-FRM-EGF828 of the present invention in a diabetic animal model compared to the control.

11 is a graph showing the change of the wound area with time after injection of pβ-FRM-EGF828 of the present invention in a diabetic animal model.

12 is a photograph of an immunofluorescence reaction using CD31 antibody, a neovascular marker, to show the neovascularization effect of pβ-FRM-EGF828 of the present invention in a diabetic animal model.

FIG. 13 is a photograph of H & E staining of wound tissue after administration of pβ-FRM-EGF828 of the present invention in an animal model of diabetes.

<110> Inje university industry-academic cooperation foundation <120> FRM-EGF fusion protein and composition for wound healing          configuring the same <160> 14 <170> KopatentIn 1.71 <210> 1 <211> 1212 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE (222) (1) .. (1212) <223> FRM-EGF amino acid full sequence <400> 1 Met Arg Gly Arg Arg Met Leu Leu Thr Leu Ile Ile Leu Leu Pro Val   1 5 10 15 Val Ser Lys Phe Ser Phe Val Ser Leu Ser Ala Pro Gln His Trp Ser              20 25 30 Cys Pro Glu Gly Thr Leu Ala Gly Asn Gly Asn Ser Thr Cys Val Gly          35 40 45 Pro Ala Pro Phe Leu Ile Phe Ser His Gly Asn Ser Ile Phe Arg Ile      50 55 60 Asp Thr Glu Gly Thr Asn Tyr Glu Gln Leu Val Val Asp Ala Gly Val  65 70 75 80 Ser Val Ile Met Asp Phe His Tyr Asn Glu Lys Arg Ile Tyr Trp Val                  85 90 95 Asp Leu Glu Arg Gln Leu Leu Gln Arg Val Phe Leu Asn Gly Ser Arg             100 105 110 Gln Glu Arg Val Cys Asn Ile Glu Lys Asn Val Ser Gly Met Ala Ile         115 120 125 Asn Trp Ile Asn Glu Glu Val Ile Trp Ser Asn Gln Gln Glu Gly Ile     130 135 140 Ile Thr Val Thr Asp Met Lys Gly Asn Asn Ser His Ile Leu Leu Ser 145 150 155 160 Ala Leu Lys Tyr Pro Ala Asn Val Ala Val Asp Pro Val Glu Arg Phe                 165 170 175 Ile Phe Trp Ser Ser Glu Val Ala Gly Ser Leu Tyr Arg Ala Asp Leu             180 185 190 Asp Gly Val Gly Val Lys Ala Leu Leu Glu Thr Ser Glu Lys Ile Thr         195 200 205 Ala Val Ser Leu Asp Val Leu Asp Lys Arg Leu Phe Trp Ile Gln Tyr     210 215 220 Asn Arg Glu Gly Ser Asn Ser Leu Ile Cys Ser Cys Asp Tyr Asp Gly 225 230 235 240 Gly Ser Val His Ile Ser Lys His Pro Thr Gln His Asn Leu Phe Ala                 245 250 255 Met Ser Leu Phe Gly Asp Arg Ile Phe Tyr Ser Thr Trp Lys Met Lys             260 265 270 Thr Ile Trp Ile Ala Asn Lys His Thr Gly Lys Asp Met Val Arg Ile         275 280 285 Asn Leu His Ser Ser Phe Val Pro Leu Gly Glu Leu Lys Val Val His     290 295 300 Pro Leu Ala Gln Pro Lys Ala Glu Asp Asp Thr Trp Glu Pro Glu Gln 305 310 315 320 Lys Leu Cys Lys Leu Arg Lys Gly Asn Cys Ser Ser Thr Val Cys Gly                 325 330 335 Gln Asp Leu Gln Ser His Leu Cys Met Cys Ala Glu Gly Tyr Ala Leu             340 345 350 Ser Arg Asp Arg Lys Tyr Cys Glu Asp Val Asn Glu Cys Ala Phe Trp         355 360 365 Asn His Gly Cys Thr Leu Gly Cys Lys Asn Thr Pro Gly Ser Tyr Tyr     370 375 380 Cys Thr Cys Pro Val Gly Phe Val Leu Leu Pro Asp Gly Lys Arg Cys 385 390 395 400 His Gln Leu Val Ser Cys Pro Arg Asn Val Ser Glu Cys Ser His Asp                 405 410 415 Cys Val Leu Thr Ser Glu Gly Pro Leu Cys Phe Cys Pro Glu Gly Ser             420 425 430 Val Leu Glu Arg Asp Gly Lys Thr Cys Ser Gly Cys Ser Ser Pro Asp         435 440 445 Asn Gly Gly Cys Ser Gln Leu Cys Val Pro Leu Ser Pro Val Ser Trp     450 455 460 Glu Cys Asp Cys Phe Pro Gly Tyr Asp Leu Gln Leu Asp Glu Lys Ser 465 470 475 480 Cys Ala Ala Ser Gly Pro Gln Pro Phe Leu Leu Phe Ala Asn Ser Gln                 485 490 495 Asp Ile Arg His Met His Phe Asp Gly Thr Asp Tyr Gly Thr Leu Leu             500 505 510 Ser Gln Gln Met Gly Met Val Tyr Ala Leu Asp His Asp Pro Val Glu         515 520 525 Asn Lys Ile Tyr Phe Ala His Thr Ala Leu Lys Trp Ile Glu Arg Ala     530 535 540 Asn Met Asp Gly Ser Gln Arg Glu Arg Leu Ile Glu Glu Gly Val Asp 545 550 555 560 Val Pro Glu Gly Leu Ala Val Asp Trp Ile Gly Arg Arg Phe Tyr Trp                 565 570 575 Thr Asp Arg Gly Lys Ser Leu Ile Gly Arg Ser Asp Leu Asn Gly Lys             580 585 590 Arg Ser Lys Ile Ile Thr Lys Glu Asn Ile Ser Gln Pro Arg Gly Ile         595 600 605 Ala Val His Pro Met Ala Lys Arg Leu Phe Trp Thr Asp Thr Gly Ile     610 615 620 Asn Pro Arg Ile Glu Ser Ser Ser Leu Gln Gly Leu Gly Arg Leu Val 625 630 635 640 Ile Ala Ser Ser Asp Leu Ile Trp Pro Ser Gly Ile Thr Ile Asp Phe                 645 650 655 Leu Thr Asp Lys Leu Tyr Trp Cys Asp Ala Lys Gln Ser Val Ile Glu             660 665 670 Met Ala Asn Leu Asp Gly Ser Lys Arg Arg Arg Leu Thr Gln Asn Asp         675 680 685 Val Gly His Pro Phe Ala Val Ala Val Phe Glu Asp Tyr Val Trp Phe     690 695 700 Ser Asp Trp Ala Met Pro Ser Val Ile Arg Val Asn Lys Arg Thr Gly 705 710 715 720 Lys Asp Arg Val Arg Leu Gln Gly Ser Met Leu Lys Pro Ser Ser Leu                 725 730 735 Val Val Val His Pro Leu Ala Lys Pro Gly Ala Asp Pro Cys Leu Tyr             740 745 750 Gln Asn Gly Gly Cys Glu His Ile Cys Lys Lys Arg Leu Gly Thr Ala         755 760 765 Trp Cys Ser Cys Arg Glu Gly Phe Met Lys Ala Ser Asp Gly Lys Thr     770 775 780 Cys Leu Ala Leu Asp Gly His Gln Leu Leu Ala Gly Gly Glu Val Asp 785 790 795 800 Leu Lys Asn Gln Val Thr Pro Leu Asp Ile Leu Ser Lys Thr Arg Val                 805 810 815 Ser Glu Asp Asn Ile Thr Glu Ser Gln His Met Leu Val Ala Glu Ile             820 825 830 Met Val Ser Asp Gln Asp Asp Cys Ala Pro Val Gly Cys Ser Met Tyr         835 840 845 Ala Arg Cys Ile Ser Glu Gly Glu Asp Ala Thr Cys Gln Cys Leu Lys     850 855 860 Gly Phe Ala Gly Asp Gly Lys Leu Cys Ser Asp Ile Asp Glu Cys Glu 865 870 875 880 Met Gly Val Pro Val Cys Pro Pro Ala Ser Ser Lys Cys Ile Asn Thr                 885 890 895 Glu Gly Gly Tyr Val Cys Arg Cys Ser Glu Gly Tyr Gln Gly Asp Gly             900 905 910 Ile His Cys Leu Asp Ile Asp Glu Cys Gln Leu Gly Val His Ser Cys         915 920 925 Gly Glu Asn Ala Ser Cys Thr Asn Thr Glu Gly Gly Tyr Thr Cys Met     930 935 940 Cys Ala Gly Arg Leu Ser Glu Pro Gly Leu Ile Cys Pro Asp Ser Thr 945 950 955 960 Pro Pro Pro His Leu Arg Glu Asp Asp His His Tyr Ser Val Arg Asn                 965 970 975 Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu His Asp             980 985 990 Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr Ala Cys Asn Cys         995 1000 1005 Val Val Gly Tyr Ile Gly Glu Arg Cys Gln Tyr Arg Asp Leu Lys Trp    1010 1015 1020 Trp Glu Leu Arg His Ala Gly His Gly Gln Gln Gln Lys Val Ile Val 1025 1030 1035 1040 Val Ala Val Cys Val Val Val Leu Val Met Leu Leu Leu Leu Ser Leu                1045 1050 1055 Trp Gly Ala His Tyr Tyr Arg Thr Gln Lys Leu Leu Ser Lys Asn Pro            1060 1065 1070 Lys Asn Pro Tyr Glu Glu Ser Ser Arg Asp Val Arg Ser Arg Arg Pro        1075 1080 1085 Ala Asp Thr Glu Asp Gly Met Ser Ser Cys Pro Gln Pro Trp Phe Val    1090 1095 1100 Val Ile Lys Glu His Gln Asp Leu Lys Asn Gly Gly Gln Pro Val Ala 1105 1110 1115 1120 Gly Glu Asp Gly Gln Ala Ala Asp Gly Ser Met Gln Pro Thr Ser Trp                1125 1130 1135 Arg Gln Glu Pro Gln Leu Cys Gly Met Gly Thr Glu Gln Gly Cys Trp            1140 1145 1150 Ile Pro Val Ser Ser Asp Lys Gly Ser Cys Pro Gln Val Met Glu Arg        1155 1160 1165 Ser Phe His Met Pro Ser Tyr Gly Thr Gln Thr Leu Glu Gly Gly Val    1170 1175 1180 Glu Lys Pro His Ser Leu Leu Ser Ala Asn Pro Leu Trp Gln Gln Arg 1185 1190 1195 1200 Ala Leu Asp Pro Pro His Gln Met Glu Leu Thr Gln                1205 1210 <210> 2 <211> 843 <212> DNA <213> Homo sapiens <220> <221> gene (222) (1) .. (843) <223> FRM-EGF828 nucleotide sequence <400> 2 atgcggggac ggcggatgct gctcactctt atcattctgt tgccagtagt ttcaaaattt 60 agttttgtta gtctctcagc accgcagcac tggagctgtc ctgaaggtac tctcgcagga 120 aatagagaca atagtgactc tgaatgtccc ctgtcccacg atgggtactg cctccatgat 180 ggtgtgtgca tgtatattga agcattggac aagtatgcat gcaactgtgt tgttggctac 240 atcggggagc gatgtcagta ccgagacctg aagtggtggg aactgcgcca cgctggccac 300 gggcagcagc agaaggtcat cgtggtggct gtctgcgtgg tggtgcttgt catgctgctc 360 ctcctgagcc tgtggggggc ccactactac aggactcaga agctgctatc gaaaaaccca 420 aagaatcctt atgaggagtc gagcagagat gtgaggagtc gcaggcctgc tgacactgag 480 gatgggatgt cctcttgccc tcaaccttgg tttgtggtta taaaagaaca ccaagacctc 540 aagaatgggg gtcaaccagt ggctggtgag gatggccagg cagcagatgg gtcaatgcaa 600 ccaacttcat ggaggcagga gccccagtta tgtggaatgg gcacagagca aggctgctgg 660 attccagtat ccagtgataa gggctcctgt ccccaggtaa tggagcgaag ctttcatatg 720 ccctcctatg ggacacagac ccttgaaggg ggtgtcgaga agccccattc tctcctatca 780 gctaacccat tatggcaaca aagggccctg gacccaccac accaaatgga gctgactcag 840 tga 843 <210> 3 <211> 315 <212> DNA <213> Homo sapiens <220> <221> gene (222) (1) .. (315) <223> FRM-EGF159 nucleotide sequence <400> 3 atgcggggac ggcggatgct gctcactctt atcattctgt tgccagtagt ttcaaaattt 60 agttttgtta gtctctcagc accgcagcac tggagctgtc ctgaaggtac tctcgcagga 120 aatagagaca atagtgactc tgaatgtccc ctgtcccacg atgggtactg cctccatgat 180 ggtgtgtgca tgtatattga agcattggac aagtatgcat gcaactgtgt tgttggctac 240 atcggggagc gatgtcagta ccgagacctg aagtggtggg aactgcgcca cgctggccac 300 gggcagcagc agaag 315 <210> 4 <211> 15 <212> DNA <213> Homo sapiens <220> <221> gene (222) (1) .. (15) <223> Furin Recognition Motif nucleotide sequence <400> 4 atgcggggac ggcgg 15 <210> 5 <211> 5129 <212> DNA <213> Artificial Sequence <220> P223-FRM-EGF828 plasmid nucleotide full sequence <400> 5 gtcgaggtga gccccacgtt ctgcttcact ctccccatct cccccccctc cccaccccca 60 attttgtatt tatttatttt ttaattattt tgtgcagcga tgggggcggg gggggggggg 120 gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc ggagaggtgc 180 ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg 240 gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcgt tgccttcgcc 300 ccgtgccccg ctccgcgccg cctcgcgccg cccgccccgg ctctgactga ccgcgttact 360 cccacaggtg agcgggcggg acggcccttc tcctccgggc tgtaattagc gcttggttta 420 atgacggctc gtttcttttc tgtggctgcg tgaaagcctt aaagggctcc gggagggccc 480 tttgtgcggg ggggagcggc tcggggggtg cgtgcgtgtg tgtgtgcgtg gggagcgccg 540 cgtgcggccc gcgctgcccg gcggctgtga gcgctgcggg cgcggcgcgg ggctttgtgc 600 gctccgcgtg tgcgcgaggg gagcgcggcc gggggcggtg ccccgcggtg cgggggggct 660 gcgaggggaa caaaggctgc gtgcggggtg tgtgcgtggg ggggtgagca gggggtgtgg 720 gcgcggcggt cgggctgtaa cccccccctg cacccccctc cccgagttgc tgagcacggc 780 ccggcttcgg gtgcggggct ccgtgcgggg cgtggcgcgg ggctcgccgt gccgggcggg 840 gggtggcggc aggtgggggt gccgggcggg gcggggccgc ctcgggccgg ggagggctcg 900 ggggaggggc gcggcggccc cggagcgccg gcggctgtcg aggcgcggcg agccgcagcc 960 attgcctttt atggtaatcg tgcgagaggg cgcagggact tcctttgtcc caaatctggc 1020 ggagccgaaa tctgggaggc gccgccgcac cccctctagc gggcgcgggc gaagcggtgc 1080 ggcgccggca ggaaggaaat gggcggggag ggccttcgtg cgtcgccgcg ccgccgtccc 1140 cttctccatc tccagcctcg gggctgccgc agggggacgg ctgccttcgg gggggacggg 1200 gcagggcggg gttcggcttc tggcgtgtga ccggcggggt ttatatcttc ccttctctgt 1260 tcctccgcag cccccaagct tggtaccatg cgtcaacgtc gtcatgctga agggaccttt 1320 accagtgatg taagttctta tttggaaggc caagctgcca aggagaaacc gaattcatgc 1380 ggggacggcg gatgctgctc actcttatca ttctgttgcc agtagtttca aaatttagtt 1440 ttgttagtct ctcagcaccg cagcactgga gctgtcctga aggtactctc gcaggaaata 1500 gagacaatag tgactctgaa tgtcccctgt cccacgatgg gtactgcctc catgatggtg 1560 tgtgcatgta tattgaagca ttggacaagt atgcatgcaa ctgtgttgtt ggctacatcg 1620 gggagcgatg tcagtaccga gacctgaagt ggtgggaact gcgccacgct ggccacgggc 1680 agcagcagaa ggtcatcgtg gtggctgtct gcgtggtggt gcttgtcatg ctgctcctcc 1740 tgagcctgtg gggggcccac tactacagga ctcagaagct gctatcgaaa aacccaaaga 1800 atccttatga ggagtcgagc agagatgtga ggagtcgcag gcctgctgac actgaggatg 1860 ggatgtcctc ttgccctcaa ccttggtttg tggttataaa agaacaccaa gacctcaaga 1920 atgggggtca accagtggct ggtgaggatg gccaggcagc agatgggtca atgcaaccaa 1980 cttcatggag gcaggagccc cagttatgtg gaatgggcac agagcaaggc tgctggattc 2040 cagtatccag tgataagggc tcctgtcccc aggtaatgga gcgaagcttt catatgccct 2100 cctatgggac acagaccctt gaagggggtg tcgagaagcc ccattctctc ctatcagcta 2160 acccattatg gcaacaaagg gccctggacc caccacacca aatggagctg actcagtgag 2220 cggccgcttc gagcagacat gataagatac attgatgagt ttggacaaac cacaactaga 2280 atgcagtgaa aaaaatgctt tatttgtgaa atttgtgatg ctattgcttt atttgtaacc 2340 attataagct gcaataaaca agttaacaac aacaattgca ttcattttat gtttcaggtt 2400 cagggggaga tgtgggaggt tttttaaagc aagtaaaacc tctacaaatg tggtaaaatc 2460 gataaggatc cgggctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag 2520 ttgcgcagcc tgaatggcga atggacgcgc cctgtagcgg cgcattaagc gcggcgggtg 2580 tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg 2640 ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 2700 ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 2760 agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 2820 tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta 2880 tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat tggttaaaaa 2940 atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg cttacaattt 3000 cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatggtgcac 3060 tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc cgccaacacc 3120 cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac aagctgtgac 3180 cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac gcgcgagacg 3240 aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta 3300 gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta 3360 aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata 3420 ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc 3480 ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga 3540 agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct 3600 tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg 3660 tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta 3720 ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat 3780 gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt 3840 acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga 3900 tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga 3960 gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat taactggcga 4020 actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc 4080 aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc 4140 cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg 4200 tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat 4260 cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata 4320 tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct 4380 ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 4440 ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 4500 cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 4560 aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgttcttct 4620 agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 4680 tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 4740 ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 4800 cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 4860 atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 4920 ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 4980 tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 5040 gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 5100 gccttttgct cacatggctc gacagatct 5129 <210> 6 <211> 5 <212> PRT <213> Homo sapiens <220> <221> BINDING (222) (1) .. (5) <223> Furin Recognition Motif amino acid sequence <400> 6 Met Arg Gly Arg Arg   1 5 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Furin <400> 7 ccgaattcat gcggggacgg cggaatagtg actctgaatg tccc 44 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Furin <400> 8 ccgaattcat gcggggacgg cggatgctgc tcactcttat c 41 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for Signal peptide <400> 9 ccgaattcat gctgctcact cttatc 26 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for Signal peptide <400> 10 ttcagagtca ctattgtctc tatttcctgc gagagt 36 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for EGF828 <400> 11 actctcgcag gaaatagaga caatagtgac tctgaa 36 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for EGF828 <400> 12 aaaagcggcc gctcactgcg tctccatttg 30 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for EGF159 <400> 13 aatagtgact ctgaatgtcc cctg 24 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for EGF159 <400> 14 gcgcagttcc caccacttca g 21  

Claims (11)

delete Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2. delete A vector comprising the polynucleotide of claim 2. The vector of claim 4, wherein the vector comprises a nucleotide sequence of SEQ ID NO: 5. 6. A transformant transformed with the vector of claim 4. delete A composition for promoting wound healing comprising the vector of claim 4 as an active ingredient. 9. The composition of claim 8, wherein the wound is a chronic diabetic skin wound or intractable skin wound. A neovascularization composition comprising the vector of claim 4 as an active ingredient. A composition for treating skin inflammation comprising the vector of claim 4 as an active ingredient.

Images