KR101061541B1 - Method for preparing reverse differentiated pluripotent stem cells using herpes simplex amplicon virus containing reverse differentiation inducing factor - Google Patents

Abstract

The present invention comprises the steps of (a) culturing a somatic or immortalized cell line derived from human in the presence of Herpes simplex amplicon viruses comprising a gene encoding a reverse differentiation inducer; And (b) isolating embryonic stem cell-like colonies from the culture obtained from step (a), thereby providing a method for producing iPS cells. .

Herpes simplex amplicon virus, pluripotent stem cell

Description

Method for preparing induced pluripotent stem cells using herpes simplex amplicon viruses containing reprogramming-inducing genes}

The present invention uses a herpes simplex simplex amplicon virus as a gene delivery vehicle for encoding a gene for inducing differentiation, thereby producing iPS cells. It is about.

Induced pluripotent stem cells (iPS cells) refer to cells having pluripotency obtained by dedifferentiation from differentiated cells (eg, somatic cells), and are capable of differentiating into various organ cells. iPS cells can be obtained by reprogramming cells differentiated by dedifferentiation inducers, thus enabling the generation of patient immunocompatible pluripotent cell lines without somatic cell transfer. Thus, iPS cells can be derived from the cells of the patient to avoid immune rejection in clinical applications. In addition, iPS cells do not use eggs or embryos, so there is no bioethical controversy or religious criticism.

In August 2006, Takahashi, K., and Yamanaka, S. et al. Announced the formation of iPS cells by dedifferentiation using mouse cells (Takahashi, K., and Yamanaka, S. (2006) .Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.Cell 126 , 663-676), Takahashi, K. et al. and Yu, J. et al. reported the formation of iPS cells by dedifferentiation in human cells. (Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007) .Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell 131 , 861-872; and Yu, J., Vodyanik, MA, Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, JL, Tian, S., Nie, J. , Jonsdottir, GA, Ruotti, V., Stewart, R. , et al . (2007). Induced Pluripotent Stem Cell Lines Derived from Human Somatic Cells. Science New York, NY). Takahashi, K. et al. Found that dedifferentiation inducers of Sox2, Oct3 / 4, and Klf4 are necessary to obtain iPS cells, and additionally c-Myc plays a role in promoting the formation of iPS cells. In addition, Yu, J. et al. Found that reverse differentiation inducers of Sox2, Oct3 / 4, and Nanog are necessary for obtaining iPS cells, and the formation of iPS cells increases when Lin28 is present.

On the other hand, for iPS cell formation by reprogramming, the step of delivering the dedifferentiation inducer into the somatic cells is essential. Specifically, the dedifferentiation of Sox2, Oct3 / 4, Klf4, and c-Myc Genes encoding inducers can be transferred to somatic cells using individual retroviruses as transporters (Takahashi, K. et al (2007) Cell 131 , 861-872), or inverse of Sox2, Oct3 / 4, Nanog, Lin28 Genes encoding differentiation inducers must be delivered to somatic cells using lentiviruses as transporters respectively (Yu, J., et al . (2007), Science, New York, NY).

However, since the retroviruses or lentiviruses intervene randomly in the chromosome in the nucleus of the cell, iPS cells obtained according to the intercalation position may have a serious impact on safety including the occurrence of cancer when clinically applied. Can be. In the early 2000s, three out of 11 children who had been treated for bubble boy disease (X-SCID disease) with gene therapy using retroviruses in France were reported.

The present inventors carried out various studies to develop a method for producing excellent iPS cells that can be secured. As a result, when the inducer of reverse differentiation is transmitted through the herpes simplex virus amplicon plasmid obtained using a recombinant herpes simplex virus amplicon plasmid, the episomal (outside the chromosome) does not enter the chromosome. Because they exist in the form of extrachromosomal episomes and express genes that induce differentiation, they have been able to avoid safety problems that can be caused by the use of retroviruses or lentiviruses. In addition, the recombinant amplicon plasmid is about 10 kb in size, so that up to 150 kb of DNA can be inserted into the herpes virus, allowing each gene to enter more than 10 copies into a single herpes simplex virus and deliver large amounts simultaneously into the cell. I found that.

Accordingly, an object of the present invention is to provide a method for producing iPS cells using the Herpes simplex amplicon virus.

According to one aspect of the invention, (a) a somatic or immortalized cell line derived from humans in the presence of Herpes simplex amplicon viruses comprising a gene encoding a reverse differentiation inducer Culturing; And (b) isolating embryonic stem cell-like colonies from the culture obtained from step (a), there is provided a method for producing iPS cells do.

In the production method of the present invention, the culture of step (a) is a herpes simplex amplicon virus comprising a gene encoding Sox2; Herpes simplex amplicon virus comprising a gene encoding Oct3 / 4; And a herpes simplex amplicon virus comprising a gene encoding Nanog (optionally further comprising a gene encoding Lin28). In addition, the culture of step (a) is a herpes simplex amplicon virus comprising a gene encoding Sox2; Herpes simplex amplicon virus comprising a gene encoding Oct3 / 4; And a herpes simplex amplicon virus comprising a gene encoding Klf4 (optionally further comprising a gene encoding c-Myc). The herpes simplex virus is a herpes simplex virus amplicon plasmid (Herpes simplex virus amplicon plasmid), a gene encoding each corresponding reverse differentiation inducer, preferably the herpes simplex virus ampoule having the nucleotide sequence of SEQ ID NO: 17 The expression plasmid obtained by recombination into the lycon plasmid can be obtained by packaging in a permissive cell line. In addition, the packaging may be performed by co-transfection of the expression plasmid, BAC DNA (fHSVΔpacΔ27 0+), and helper-plasmid (pEBHICP27) into the recipient cells.

In addition, the culture of step (a) is a gene encoding Sox2; Gene encoding Oct3 / 4; And one herpes simplex amplicon virus simultaneously comprising a gene encoding Nanog (optionally further comprising a gene encoding Lin28). In addition, the culture is a gene encoding Sox2; Gene encoding Oct3 / 4; And one herpes simplex amplicon virus simultaneously comprising a gene encoding Klf4 (optionally further comprising a gene encoding c-Myc).

If step (a) is performed using one type of herpes simplex virus, the herpes simplex virus comprises (i) a gene encoding Sox2, a gene encoding Oct3 / 4, a gene encoding Nanog, and a selective The gene encoding Lin28; Or a gene construct comprising a gene encoding Sox2, a gene encoding Oct3 / 4, a gene encoding Klf4, and optionally a gene encoding c-Myc, wherein the genes encode a peptide of SEQ ID NO: 1 Recombining the induced gene constructs linked to the herpes simplex virus amplicon plasmid to produce an expression plasmid, and (ii) receiving the expression plasmid obtained in step (i) into a permissive cell. can be obtained by a method comprising the step of packaging in a line. The gene encoding the peptide of SEQ ID NO: 1 may have a nucleotide sequence of SEQ ID NO: 2, the gene structure may be composed of the nucleotide sequence of SEQ ID NO: 15 or 16. The herpes simplex virus amplicon plasmid may have a nucleotide sequence of SEQ ID NO. In addition, the packaging may be performed by co-transfection of the expression plasmid, BAC DNA (fHSVΔpacΔ27 0+), and helper-plasmid (pEBHICP27) into the recipient cells.

According to the present invention, when a reverse differentiation inducer is delivered through a herpes simplex amplicon virus obtained using a herpes simplex virus amplicon plasmid, it is present in the form of episomes in the nucleus without being inserted into the chromosome. The use of viruses such as viruses or lentiviruses as transporters can avoid the safety problems that may arise. In addition, the herpes simplex is expressed as an expression plasmid obtained by recombining a multiple reverse differentiation inducing gene construct obtained by linking genes encoding the reverse differentiation inducers to a DNA fragment encoding a peptide of SEQ ID NO: 1 into the viral amplicon plasmid. When viral particles are formed, the particles can be introduced into differentiated somatic cells to simultaneously express several dedifferentiation inducing factors from one polycistronic mRNA. The multiple reverse differentiation gene expression plasmids prepared as described above were applied to receiving cells such as vero cells together with BAC DNA (fHSVΔpac △ 27 0+) and pEBHICP27 plasmid containing genes necessary for the production of herpes simplex virus. After co-transfection, the cells are cultured to isolate virus particles containing the gene construct and introduce them into differentiated somatic cells. You can get it.

In the present specification, "induced pluripotent stem cells (iPS cells)" is also referred to as "reprogrammed pluripotent stem cells", and the pluripotency ( refers to cells induced to have pluripotency). The dedifferentiated pluripotent stem cells may be variously differentiated into organ cells such as brain and heart.

The present invention comprises the steps of: (a) culturing a somatic or immortalized cell line derived from human in the presence of Herpes simplex amplicon viruses comprising a gene encoding a reverse differentiation inducer; And (b) isolating embryonic stem cell-like colonies from the culture obtained from step (a), thereby providing a method for producing iPS cells. .

Herpes simplex virus, unlike retroviruses and lentiviruses, does not enter the chromosome of the host cell and exists in the episome outside the chromosome. The safety problems that can be caused by use can be avoided. In particular, the herpes simplex virus amplicon plasmid used to form the herpes simplex virus is a "gutted" DNA plasmid that has only its DNA replication ( oriS ) and packaging signal ( pac ). Relatively large transgenes can also be inserted.

According to the present invention, a safety problem when a herpes simplex virus amplicon plasmid is introduced into a differentiated somatic cell by introducing a herpes simplex virus obtained from a recombinant plasmid in which a gene encoding a reverse differentiation inducing factor is introduced into the herpes simplex virus amplicon plasmid. It has been found that de-differentiated pluripotent stem cells can be prepared while avoiding.

The dedifferentiation inducer includes all factors having the function of inducing reprogramming and preferably includes a combination of dedifferentiation inducers known to be involved in reprogramming. For example, the dedifferentiation inducer may be selected from the group consisting of Sox2, Oct3 / 4, Nanog, Klf4, Lin28, and Myc, which are known to induce reprogramming. The amino acid sequence and base sequence of Sox2, Oct3 / 4, Nanog, Klf4, Lin28, and c-Myc are known from GenBank et al., And are shown in SEQ ID NOs: 3 to 14, respectively (see Table 1).

Inverse differentiation inducer Kinds SEQ ID NO: Sox2 Amino acid sequence 3 Sequence 4 Oct3 / 4 Amino acid sequence 5 Sequence 6 Nanog Amino acid sequence 7 Sequence 8 Klf4 Amino acid sequence 9 Sequence 10 Lin28 Amino acid sequence 11 Sequence 12 c-Myc Amino acid sequence 13 Sequence 14

Preferably, said dedifferentiation inducer is a combination of a gene encoding Oct3 / 4, a gene encoding Nanog, and a gene encoding Sox2 (and, optionally, a combination further comprising a gene encoding Lin28) , A gene encoding Oct3 / 4, a gene encoding Klf4, and a gene encoding Sox2 (and, optionally, a combination further comprising a gene encoding c-Myc). Those skilled in the art will recognize that various factors known or known to be involved in inducing differentiation, as well as Sox2, Oct3 / 4, Nanog, Klf4, Lin28, c-Myc described above, can be applied without limitation to the preparation method according to the present invention. will be.

In the production method of the present invention, the culture of step (a) is a herpes simplex amplicon virus comprising a gene encoding Sox2; Herpes simplex amplicon virus comprising a gene encoding Oct3 / 4; And a herpes simplex amplicon virus comprising a gene encoding Nanog (optionally further comprising a gene encoding Lin28). In addition, the culture of step (a) is a herpes simplex amplicon virus comprising a gene encoding Sox2; Herpes simplex amplicon virus comprising a gene encoding Oct3 / 4; And a herpes simplex amplicon virus comprising a gene encoding Klf4 (optionally further comprising a gene encoding c-Myc).

The herpes simplex virus is a herpes simplex virus amplicon plasmid (Herpes simplex virus amplicon plasmid), a gene encoding each corresponding reverse differentiation inducer, preferably the herpes simplex virus ampoule having the nucleotide sequence of SEQ ID NO: 17 The expression plasmid obtained by recombination into the lycon plasmid can be obtained by packaging in a permissive cell line. In addition, the packaging may be performed by co-transfection of the expression plasmid, BAC DNA (fHSVΔpacΔ27 0+), and helper-plasmid (pEBHICP27) into the recipient cells.

According to the present invention, when the dedifferentiation inducing factors are linked through a DNA fragment encoding the peptide of SEQ ID NO: 1, it is possible to simultaneously obtain several dedifferentiation inducing factors from one polycistronic mRNA. That is, when the DNA fragment encoding the peptide of SEQ ID NO: 1 is inserted in the same frame between genes encoding dedifferentiation inducing factors, the ribosome is between the 26th and 27th amino acids among the 27 amino acids of the 2A fragment. By breaking the peptide chain, the extra amino acid derived from the peptide of 26 SEQ ID NO: 1 is derived from the reverse differentiation inducing factor (protein 1) attached to the C-terminus and the peptide of SEQ ID NO: 1 to the N-terminus. The dedifferentiation inducing factor (protein 2) is isolated with one amino acid attached. The mechanism is schematically shown in FIG. 1. The peptide of SEQ ID NO: 1 is Hasegawa, K., Cowan, A.B., Nakatsuji, N., and Suemori, H. (2007). Efficient multicistronic expression of a transgene in human embryonic stem cells. Stem cells (Dayton, Ohio) 25, 1707-1712, and Hasegawa, K., et al., Describe the introduction of transgenes mediated by 2A fragments derived from foot-and-mouth disease virus (FMDV) in human embryonic stem cells. Multicistronic expression is reported. However, Hasegawa, K. et al. Only disclose efficient expression of transgenes in human embryonic stem cells.

According to the present invention, multiple genes are linked by linking respective genes encoding two or more dedifferentiation inducing factors through a DNA fragment encoding a peptide of SEQ ID NO. 1, for example, a DNA fragment having a nucleotide sequence of SEQ ID NO. In the case of constructing a multi-gene construct, a multi-gene expression plasmid may be prepared, and when the herpes simplex virus particles into which the recombinant amplicon plasmid is introduced are introduced into differentiated somatic cells. It has been found that iPS cells can be obtained with high efficiency.

Thus, in the production method of the present invention, the culture of step (a) is a gene encoding Sox2; Gene encoding Oct3 / 4; And one herpes simplex amplicon virus simultaneously comprising a gene encoding Nanog (optionally further comprising a gene encoding Lin28). In addition, the culture is a gene encoding Sox2; Gene encoding Oct3 / 4; And one herpes simplex amplicon virus simultaneously comprising a gene encoding Klf4 (optionally further comprising a gene encoding c-Myc).

As described above, when step (a) is performed using one herpes simplex virus, the herpes simplex virus (i) encodes a gene encoding Sox2, a gene encoding Oct3 / 4, Nanog Genes, and optionally, genes encoding Lin28; Or a gene construct comprising a gene encoding Sox2, a gene encoding Oct3 / 4, a gene encoding Klf4, and optionally a gene encoding c-Myc, wherein said genes encode a peptide of SEQ ID NO: 1 Recombining the sequence-directed gene construct into a herpes simplex virus amplicon plasmid to produce an expression plasmid, and (ii) the expression plasmid obtained in step (i) is permissive. It can be obtained by a method comprising the step of packaging in a cell line.

In step (i), the nucleotide sequence encoding the peptide of SEQ ID NO: 1 may be the nucleotide sequence of SEQ ID NO: 2. In addition, the gene construct may be composed of the nucleotide sequence of SEQ ID NO: 15 or 16. However, those skilled in the art will appreciate that the Sox2, Oct3 / 4, Nanog, Klf4, Lin28, c-Myc, as well as various factors known or known to be involved in the induction of reverse differentiation can be applied to the gene construct according to the present invention without limitation. Will recognize. Those skilled in the art will also recognize that, in the gene construct according to the present invention, the order of linkage of said dedifferentiated genes may be arbitrarily selected. The gene construct can be isolated in a conventional manner from viruses (ie, viral particles) obtained by appropriate packaging methods using viral vector plasmids transformed with the dedifferentiated gene construct, as mentioned below. A viral vector plasmid transformed with the reverse differentiation gene construct, ie, a multiple reprogramming-inducing gene expression plasmid comprising the gene construct, is a virus (ie, a transporter capable of delivering into a host cell) It is packaged in (viral particles) and delivered into the host cell.

 Since the gene construct is small, about 4-5 kb in size, various viral vector plasmids such as retroviral plasmids, lentiviral plasmids, and adenovirus plasmids adenovirus plasmid, herpes simplex amplicon viral plasmid, and the like. Among them, when using the herpes simplex amplicon virus, the resulting virus does not get into the chromosome and is present in the form of episomes, which is a safety problem that may be caused by using a viral vector such as retrovirus or lentivirus. Since it can be avoided and the cytotoxicity is low, it can be used preferably. That is, the multiple reverse differentiation inducing gene expression plasmid can be obtained by recombining the gene construct into a viral vector plasmid, and the viral vector plasmid is a herpes simplex virus amplicon plasmid. , More preferably, a herpes simplex virus amplicon plasmid having the nucleotide sequence of SEQ ID NO.

The multiple reverse differentiation inducing gene expression plasmid, for example, amplifies genes encoding reverse differentiation inducing factors such as Oct3 / 4, Nanog, and Sox2 genes by PCR and the like, and pHGCX (Saeki, Y., Fraefel, C. , Ichikawa, T., Breakefield, XO, and Chiocca, EA (2001) .Improve helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome.Mol Ther 3, 591-601) and the PCR-T / A plasmid yT & A (RBC T & A Cloning Kit, Cat. No. RC001) and other vectors using appropriate restriction enzymes such as NheI, NotI, BamHI, BglII, XbaI and EcoRI Genes and 2A fragments (eg, fragments of SEQ ID NO: 2) can be obtained by cloning (see FIG. 2). Preferably, the recombinant plasmid in which the gene construct is recombined is recombined into a herpes simplex virus amplicon plasmid (eg, an amplicon plasmid having a nucleotide sequence of SEQ ID NO: 17) to a promoter (eg, an elongation factor 1 promoter. , Cytomegalovirus (CMV) promoter, etc.) and poly A sequences (e.g., SV40 virus poly A sequence, bovine growth factor (BGH) poly A sequence) Differentiation inducing gene expression plasmids can be constructed (see FIG. 3).

Packaging (ie, step (i)) the expression plasmid obtained as described above into a permissive cell line is a Vero 2-2 cell (African green monkey kidney cell; from Dr. Rozanne Sandri-Goldin, University of California, Irvine, CA, USA). The packaging is a method using a non-helper virus system (for example, a system using a helper-BAC DNA and pEBHICP27 plasmid (plasmid produced by separating the ICP27 gene)) using the above-mentioned recipient cell line, or This can be done via methods using helper-viruses (eg, helper-adenoviruses or helper-herpes simplex viruses) that do not have self-replicating capabilities. For example, when the helper-herpes simplex virus is used, there is a possibility that the helper-virus is mixed little by little during the separation of the herpes simplex amplicon virus and causes cytotoxicity. Therefore, the packaging is a non-helper virus system (Saeki, Y., Fraefel, C., Ichikawa, T., Breakefield, XO, and Chiocca, EA (2001). free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome.Mol Ther 3, 591-601). In the non-helper virus system, the entire herpes simplex virus genome, except for the pac (packaging) signal, is placed in a bacterial artificial chromosome (fHSVΔpac △ 27 0+) and the ICP27 gene is added to the BAC DNA to increase safety. Remove and serve as another plasmid (pEBHICP27). Therefore, when co-transfection of these two plasmids and the above-mentioned multiple reverse differentiation induction gene expression amplicon plasmids into permissive cell lines such as vero 2-2 cells, BAC DNA and The gene product required for the production of the herpes simplex virus produced from the pEBHICP27 plasmid creates the structure of the herpes simplex virus, and the multiple dedifferentiation-induced gene expression amplicon plasmids are formed inside the capsid of the herpes simplex virus through a rolling circle mechanism. By filling the inside of the capsid, a virus (ie, viral particles) can be obtained (see FIG. 4).

In step (a) of the preparation method of the present invention, the medium is a conventional cell culture medium, for example, antibiotics such as fetal bovine serum, penicillin / streptomycin, non-essential amino acids (non DMEM medium supplemented with -essential amino acid) or the like can be used under normal cell culture conditions. The concentration of the viral particles in the medium is about 1 M.O.I. may be multiplicity of infection, but is not limited thereto.

Somatic cells derived from humans include, without limitation, human skin, hair, adult stem cells, and the like. Immortalized cell lines can also be used, for example, immortalized cell lines derived from humans, such as the human embryonic kidney cell line. In addition, Oct3 / 4 promoter known to specifically express in stem cells; And a hygromycin resistance gene and an eGFP gene when using an immortalized cell line (that is, an immortalized reporter cell line) into which an antibiotic resistance gene (hygromycin resistance gene) and / or an eGFP fluorescent gene is introduced. Is expressed by the Oct4 promoter, which only works specifically for embryonic stem cells, so that subsequent stem cell separation processes can be easily performed. Immortalized reporter cell lines incorporating Oct3 / 4 promoter, antibiotic resistance gene (hygromycin resistance gene), eGFP fluorescent gene, etc. can be constructed as follows:

Obtain BAC (bacterial chromosome) DNA containing the entire human Oct3 / 4 locus (Children's Hospital Oakland Research Institute, Cat # RP11-100L8), and independently in known plasmids such as pHygrEGFP (Clontech cat # PT3203-5). A fusion gene joining the hygromycin resistance gene with the eGFP fluorescent gene to fit the codon frame "and" human elogation factor 1 alpha (EF1a) promoter-blastocidin resistance protein coding gene (pEF / Bsd plasmid (Invitrogen, K511-01) "expression unit is cloned by conventional genetic engineering methods. The" hygromycin resistance gene: eGFP fluorescent gene fusion gene and human elogation factor 1 alpha (EF1a) promoter-blastocidin resistance protein coding. To insert the gene expression unit after the Oct3 / 4 promoter on BAC DNA, the following method can be used: First, the "hygromycin resistance gene: eGFP". 150 of the upstream and downstream BAC DNA sequences above and below the desired position for insertion after the Oct3 / 4 promoter on the BAC DNA where the fusion gene and the human EF1a promoter-blastocidin resistant gene "expression unit will be inserted. The upper (5 'terminal) and the lower (3' terminal) portions of the "hygromycin resistance gene: eGFP fluorescent fusion gene-human EF1a promoter-blastosodin resistance (blastocidin) gene expression unit" prepared separately at about -50 bp The nucleotide sequence immediately below the promoter to be inserted into 1503 bp and 50 bp Oct3 / 4, respectively, is annealed by making a sense and antisense oligonucleotide to form a double strand, and then attaching using a ligase. This recombination plasmid is placed simultaneously in Bacteria with BAC DNA (including Oct3 / 4 locus) so that homologous recombination inserts the expression unit correctly behind the Oct3 / 4 promoter, the desired site of BAC DNA. Sequence analysis confirms that the expression units to be inserted enter the desired BAC DNA site. After the Oct3 / 4 promoter of BAC DNA, "Hygromycin resistance gene: eGFP fluorescence fusion gene" and "human EF1a promoter-blastosidine resistance gene expression unit" were obtained, the recombinant BAC DNA with 293 cells, etc. After transfecting this BAC DNA into an immortalized cell line, blastosidine is used to select only stable cell lines in which BAC DNA is stably inserted into the chromosome.

The reporter cell line prepared as described above has the characteristic that the hygromycin resistance gene and the eGFP gene are expressed by Oct4 promoter that operates specifically in embryonic stem cells. Therefore, when the reporter cell line is dedifferentiated into iPS cells, the hygromycin resistance gene and eGFP fluorescence are expressed so that selection or search by antibiotics can be easily performed.

IPS cells obtained by dedifferentiation as described above are cultured for stem cell culture medium, for example, 0.05 mM beta-mercaptoethanol, 1% non-essential amino acid, 20% knock-out serum replacement, Embryonic stem cell-like colonies were isolated from the cultures after incubation with DMEM-12 medium supplemented with 100 U / ml penicillin, 100 ug / ml spreptomycin, and 4 ng / ml bFGF. It can be obtained by. Since the colonies have a morphologically distinctive shape in which small, rounded cells are clustered with relatively large nuclei in culture, they can be separated by physical methods using Pasteur pipettes bent with alcohol lamps. Can be. In addition, when immortalized reporter cell lines are used as described above, iPS cells can be separated by antibiotic resistance and fluorescence.

In the production method of the present invention, when the gene construct containing multiple reprogramming-inducing genes prepared as described above are introduced into differentiated somatic cells using a virus as a vector, high efficiency IPS cells can be obtained, and an example of the method for producing the dedifferentiated pluripotent stem cells of the present invention described above is as shown in FIG. 5.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrating the present invention, and the scope of the present invention is not limited to these examples.

Example  1. Multiple Dedifferentiation  Construction of Inducing Factor Expression Plasmids

Sox2, Oct3 / 4, and Nanog genes having the nucleotide sequences of SEQ ID NOs: 4, 6, and 8 were amplified using PCR, and the primers used are shown in Table 2 below.

Inverse differentiation inducer Kinds SEQ ID NO: order NheI-Oct3 / 4 Forward 18 GGGGGCTAGCCGCCATGGCGGGACACCTGGCTTC NotI-Oct3 / 4 Reverse 19 GGGGGCGGCCGCTCAGTTTGAATGCATGGGAG XhoI-Sox2 Forward 20 GGGGCTCGAGCCGCCATGTACAACATGATGGAGAC XbaI-Sox2 Reverse 21 GGGGTCTAGATCACATGTGTGAGAGGGGCAGTGTG BglII-Nanog Forward 22 GGGGAGATCTGCCGCCATGAGTGTGGATCCAGCTTG EcoRI-Nanog Reverse 23 GGGGGAATTCACACGTCTTCAGGTTGCATG

The pHGCX vector was cut with restriction enzymes NheI and EcoRI, and then treated with Cal Intestinal Alkaline Phosphatase (CIP), and cut and amplified with restriction enzymes NheI and NotI, Oct3 / 4 gene (insert 1), and a forward primer for amplifying 2A fragments (5'- GGGGGCGGCCGCAAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGGATGTAGAAAGCAATCCAGGTCCAGGATCCGGGG-3 ', SEQ ID NO: 24) and reverse primer (5'-CCCCGATCCTGGACCTGGATTGCTTTCTACATCCCCAGCCAGTTTGAGTAAATCAAAGTTAAGAGTTTGGACAGGAGCGACAATTTTGCGGCCGCCCCC-3', SEQ ID NO: 25) was 2-3 minutes denature at 95 ℃, gradually to fall to room temperature and annealing (annealing), with restriction enzymes Double-cutting (NotI / BamH1) to the recombinant plasmid by ligation of the 2A segment (insert 2) prepared to have restriction enzyme sites NotI and BamHI on both sides, and the amplified Nanog gene (insert 3) cut with BglII and EcoRI. Recombinant plasmid-1) was constructed. The yT & A (RBC T & A Cloning Kit, Cat.No. RC001) vector was cut with restriction enzymes EcoRI and XbaI, treated with Cal Intestinal Alkaline Phosphatase (CIP), and a forward primer for amplifying 2A fragments (5'-GGGGGAATTCAAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGAGACTCCACACTACATGATGATCACGATGACACT SEQ ID NO: 26) and reverse primer (5'-CCCCCTCGAGTGGACCTGGATTGCTTTCTACATCCCCAGCCAGTTTGAGTAAATCAAAGTTAAGAGTTTGGACAGGAGCGACAATTTTGAATTCCCCC-3 ', SEQ ID NO: 27) denature 2-3 min at 95 ° C, and slowly drop to room temperature to double anneal (annealing) / restriction enzymes 2A segment (insert 1) prepared to have restriction enzyme sites EcoRI and XhoI on both sides, and the Sox2 gene (insert 2 ′) cut and amplified by XhoI and XbaI (recombinant plasmid-2) Was produced. The recombinant plasmid-2 obtained above was treated with restriction enzymes EcoRI and XbaI to ligation the 2A-Sox recombinant gene fragment to the EcoRI / XbaI site of recombinant plasmid-2. As described above, the production process of a recombinant plasmid comprising a gene construct (ie, Oct3 / 4-2A-Nanog-2A-Sox2, SEQ ID NO: 15) in which Oct3 / 4, Nanog, and Sox2 genes are connected through a 2A fragment is performed. As shown in FIG. The recombinant plasmid comprising the gene construct of SEQ ID NO: 15 was recombined into a herpes simplex virus amplicon plasmid (pHGCX) having the nucleotide sequence of SEQ ID NO: 17, so that the gene construct of SEQ ID NO: 15 was a cytomegalovirus (CMV) promoter and Multiple reverse differentiation inducing gene expression plasmids were inserted between poly A sequences derived from bovine growth hormone (BGH) genes (see FIG. 3).

Example  2. Multiple Dedifferentiation  Inducer expression herpes Simplex  Preparation of the virus

Multiple reverse differentiation inducing gene expression plasmid obtained in Example 1 and helper-plasmid (pEBHICP27) and BAC DNA (fHSVΔpacΔ27 0+) necessary for constructing the structure of the herpes simplex virus were co-transduced into vero cells to induce multiple reverse differentiation inducing gene A herpes simplex virus comprising the construct was obtained (see FIG. 4).

The co-transduction was carried out in multiple reverse differentiation induction genes obtained in Example 1 in vero 2-2 cells (Dr. Rozanne Sandri-Goldin, University of California, Irvine, CA, USA) grown more than 95% in a 6 cm culture vessel. Expression plasmids, ie, recombinant amplicon plasmids (1.2 ug), helper-plasmids (pEBHICP27, 0.4 ug) and BAC DNA (4 ug) were mixed using FuGENEHD Transfection Reagent (8: 2) (Roche, Germany) It was. Finally, after 60 hours, the virus particles gather the cells with the culture medium, break the cells by freezing and thawing three times to release the virus in the cells, and then centrifuged at 1,350 xg to remove the debris from the cells. Was used after concentration by ultracentrifugation at 20,000 rpm for 3 hours.

Through this process, several herpes amplicon plasmids enter into the capsid until 150 kb, and the capsid filled with the amplicon plasmid wraps around the cell membrane of the host cell and infects the herpes simplex amplicon virus. Was prepared.

Example  3. Weston Blotting

When the herpes simplex virus having the multiple reverse differentiation gene construct obtained in Example 2 was infected with human cells, Western blotting was performed to confirm that the 2A system works properly to form the respective reverse differentiation proteins in the cells. . Recombinant herpes simplex virus was infected with G16-9 (human glioblastoma; glioblastoma; Gli36 derived cell line that express HSV-1 VP 16 constitutuvely; widely available from many labs) and cell extracts were made 24 hours later (lane 3, FIG. 6), a cell extract of G16-9 cells infected with the herpes simplex amplicon virus expressing only Oct3 / 4 as a positive control was generated (lane 2, FIG. 6) and not expressing Oct3 / 4 as a negative control. Cell extracts of G16-9 cells infected with the herpes simplex amplicon virus (lane 1, FIG. 6) were prepared, and the results of Western blotting using the cell extracts are shown in FIG. 6.

The upper left picture of Figure 6 is a fluorescence picture obtained after the infection of the virus expressing Oct3 / 4 (HSVamp-Oct3 / 4 promoter-Oct3 / 4), the lower left picture is contained in the gene structure that Oct3 / 4 is connected to 2A Fluorescence photograph obtained after infection with the virus (HSVamp-hOct4promoter-Oct3 / 4-2A-Nanog-2A-Sox2) .The EGFP is attached to the herpes simplex virus immediate early (IE) promoter in the amplicon plasmid. Rex amplicon viruses show EGFP fluorescence. Fluorescence pictures on the left show that the herpes simplex amplicon viruses produced in vero cells were treated with G16-9 cells and the virus was well formed.

6 is a result of Western blotting with the antibody specific for Oct3 / 4 after SDS-PAGE electrophoresis of the G16-9 cell extracts obtained as a result of the three viral infections described above. From the results of FIG. 6, it can be seen that G16-9 cells transformed with the recombinant herpes simplex virus containing the gene construct consisting of multiple reverse differentiation inducing genes obtained according to the present invention express Oct3 / 4 ( lane 3, FIG. 6) and the slightly larger size of the Oct3 / 4 protein in the third lane of FIG. 6 indicate that 26 amino acids derived from the 2A peptide of SEQ ID NO: 1 are still attached to the C-terminus of Oct3 / 4. Because there is. From these results, it can be seen that the multiple reverse differentiation inducing gene expression unit works effectively from the recombinant virus produced according to the present invention.

Example  4. Cell culture and iPS  Cell Line Formation Measurement

To a 6-well plate, DMEM (Gibco) medium supplemented with purified bovine serum (defined FBS) at a final concentration of 10% and antibiotics penicillin (100 U / ml) and streptomycin (100 ug / ml) was added to human foreskin fibroblasts ( Human foreskin fibroblast cells (ATCC, SCRC-1041) were inoculated at about 1 × ^{10 4-1} × 10 ⁵ per well, and the virus obtained in Example 2 was added at about 1 MOI and incubated at 37 ° C. and 5% C. The process was repeated three times, once every three days. Finally, on day 5 after the virus was added, the cultured cells (human foreskin fibroblasts) were transferred onto STO feeder cell layers and cultured on human embryonic stem cell culture medium containing bFGF on day 12. DMEM- supplemented with 0.05 mM beta-mercaptoethanol, 1% non-essential amino acid, 20% knock out serum replacement, 100 U / ml penicillin, 100 ug / ml spreptomycin, and 4 ng / ml bFGF 12 medium) and incubated. The culture process is summarized in FIG. 7. Finally, iPS cell colonies began to form on the 15th day after the virus was applied, and on the 17th day, cells growing like embryonic stem cells were harvested.

Observing the iPS cell colonies obtained on the 17th day is the same as the bottom of FIG. 7 shows the morphology of four representative iPS cell colonies immediately before harvest observed on day 17 (A, B, C, D).

1 is a schematic diagram showing the operating mechanism of the gene construct according to the present invention.

Figure 2 shows a schematic diagram of an example of the manufacturing process of a recombinant plasmid comprising a multiple reverse differentiation gene construct.

3 is an example of a cleavage map of multiple retrodifferentiation inducing factor expression plasmids in which multiple retrodifferentiation gene constructs are recombined.

4 shows an example of virus production via a helper-free virus system using multiple retrodifferentiation inducing factor expression plasmids, BAC DNA, and pEBHICP27 plasmid.

5 is a schematic diagram showing a method for preparing iPS cells by simultaneously delivering / expressing multiple induction of differentiation gene constructs.

The upper left picture of Figure 6 is a fluorescence picture obtained after the infection of the virus expressing Oct3 / 4 (HSVamp-Oct3 / 4 promoter-Oct3 / 4), the lower left picture is contained in the gene structure that Oct3 / 4 is connected to 2A Fluorescence was obtained after infection with the virus (HSVamp-hOct4promoter-Oct3 / 4-2A-Nanog-2A-Sox2). 6 is a result of Western blotting with antibodies specific for Oct3 / 4 after SDS-PAGE electrophoresis of G16-9 cell extracts obtained as a result of virus infection.

FIG. 7 shows the culturing process for obtaining iPS cells from human foreskin fibroblast cells (top), and the bottom of FIG. 7 shows four representative iPS cell colonies just before harvesting on day 17 (A, B, C, D).

<110> College of Medicine Pochon CHA University Industry-Academic Cooperation Foundation <120> Method for preparing induced pluripotent stem cells using herpes          simplex amplicon viruses containing reprogramming-inducing genes <130> PN0180 <160> 27 <170> KopatentIn 1.71 <210> 1 <211> 27 <212> PRT <213> Foot-and-mouth disease virus <400> 1 Lys Leu Val Ala Pro Val Lys Gln Thr Pro Asn Phe Asp Leu Leu Lys   1 5 10 15 Leu Ala Gly Asp Val Glu Ser Asn Pro Gly Pro              20 25 <210> 2 <211> 81 <212> DNA <213> Foot-and-mouth disease virus <400> 2 aaaattgtcg ctcctgtcaa acaaactctt aactttgatt tactcaaact ggctggggat 60 gtagaaagca atccaggtcc a 81 <210> 3 <211> 317 <212> PRT <213> Homo sapiens <400> 3 Met Tyr Asn Met Met Glu Thr Glu Leu Lys Pro Pro Gly Pro Gln Gln   1 5 10 15 Thr Ser Gly Gly Gly Gly Gly Asn Ser Thr Ala Ala Ala Ala Gly Gly              20 25 30 Asn Gln Lys Asn Ser Pro Asp Arg Val Lys Arg Pro Met Asn Ala Phe          35 40 45 Met Val Trp Ser Arg Gly Gln Arg Arg Lys Met Ala Gln Glu Asn Pro      50 55 60 Lys Met His Asn Ser Glu Ile Ser Lys Arg Leu Gly Ala Glu Trp Lys  65 70 75 80 Leu Leu Ser Glu Thr Glu Lys Arg Pro Phe Ile Asp Glu Ala Lys Arg                  85 90 95 Leu Arg Ala Leu His Met Lys Glu His Pro Asp Tyr Lys Tyr Arg Pro             100 105 110 Arg Arg Lys Thr Lys Thr Leu Met Lys Lys Asp Lys Tyr Thr Leu Pro         115 120 125 Gly Gly Leu Leu Ala Pro Gly Gly Asn Ser Met Ala Ser Gly Val Gly     130 135 140 Val Gly Ala Gly Leu Gly Ala Gly Val Asn Gln Arg Met Asp Ser Tyr 145 150 155 160 Ala His Met Asn Gly Trp Ser Asn Gly Ser Tyr Ser Met Met Gln Asp                 165 170 175 Gln Leu Gly Tyr Pro Gln His Pro Gly Leu Asn Ala His Gly Ala Ala             180 185 190 Gln Met Gln Pro Met His Arg Tyr Asp Val Ser Ala Leu Gln Tyr Asn         195 200 205 Ser Met Thr Ser Ser Gln Thr Tyr Met Asn Gly Ser Pro Thr Tyr Ser     210 215 220 Met Ser Tyr Ser Gln Gln Gly Thr Pro Gly Met Ala Leu Gly Ser Met 225 230 235 240 Gly Ser Val Val Lys Ser Glu Ala Ser Ser Ser Pro Pro Val Val Thr                 245 250 255 Ser Ser Ser His Ser Arg Ala Pro Cys Gln Ala Gly Asp Leu Arg Asp             260 265 270 Met Ile Ser Met Tyr Leu Pro Gly Ala Glu Val Pro Glu Pro Ala Ala         275 280 285 Pro Ser Arg Leu His Met Ser Gln His Tyr Gln Ser Gly Pro Val Pro     290 295 300 Gly Thr Ala Ile Asn Gly Thr Leu Pro Leu Ser His Met 305 310 315 <210> 4 <211> 954 <212> DNA <213> Homo sapiens <400> 4 atgtacaaca tgatggagac ggagctgaag ccgccgggcc cgcagcaaac ttcggggggc 60 ggcggcggca actccaccgc ggcggcggcc ggcggcaacc agaaaaacag cccggaccgc 120 gtcaagcggc ccatgaatgc cttcatggtg tggtcccgcg ggcagcggcg caagatggcc 180 caggagaacc ccaagatgca caactcggag atcagcaagc gcctgggcgc cgagtggaaa 240 cttttgtcgg agacggagaa gcggccgttc atcgacgagg ctaagcggct gcgagcgctg 300 cacatgaagg agcacccgga ttataaatac cggccccggc ggaaaaccaa gacgctcatg 360 aagaaggata agtacacgct gcccggcggg ctgctggccc ccggcggcaa tagcatggcg 420 agcggggtcg gggtgggcgc cggcctgggc gcgggcgtga accagcgcat ggacagttac 480 gcgcacatga acggctggag caacggcagc tacagcatga tgcaggacca gctgggctac 540 ccgcagcacc cgggcctcaa tgcgcacggc gcagcgcaga tgcagcccat gcaccgctac 600 gacgtgagcg ccctgcagta caactccatg accagctcgc agacctacat gaacggctcg 660 cccacctaca gcatgtccta ctcgcagcag ggcacccctg gcatggctct tggctccatg 720 ggttcggtgg tcaagtccga ggccagctcc agcccccctg tggttacctc ttcctcccac 780 tccagggcgc cctgccaggc cggggacctc cgggacatga tcagcatgta tctccccggc 840 gccgaggtgc cggaacccgc cgcccccagc agacttcaca tgtcccagca ctaccagagc 900 ggcccggtgc ccggcacggc cattaacggc acactgcccc tctcacacat gtga 954 <210> 5 <211> 360 <212> PRT <213> Homo sapiens <400> 5 Met Ala Gly His Leu Ala Ser Asp Phe Ala Phe Ser Pro Pro Gly   1 5 10 15 Gly Gly Gly Asp Gly Pro Gly Gly Pro Glu Pro Gly Trp Val Asp Pro              20 25 30 Arg Thr Trp Leu Ser Phe Gln Gly Pro Pro Gly Gly Pro Gly Ile Gly          35 40 45 Pro Gly Val Gly Pro Gly Ser Glu Val Trp Gly Ile Pro Pro Cys Pro      50 55 60 Pro Pro Tyr Glu Phe Cys Gly Gly Met Ala Tyr Cys Gly Pro Gln Val  65 70 75 80 Gly Val Gly Leu Val Pro Gln Gly Gly Leu Glu Thr Ser Gln Pro Glu                  85 90 95 Gly Glu Ala Gly Val Gly Val Glu Ser Asn Ser Asp Gly Ala Ser Pro             100 105 110 Glu Pro Cys Thr Val Thr Pro Gly Ala Val Lys Leu Glu Lys Glu Lys         115 120 125 Leu Glu Gln Asn Pro Glu Glu Ser Gln Asp Ile Lys Ala Leu Gln Lys     130 135 140 Glu Leu Glu Gln Phe Ala Lys Leu Leu Lys Gln Lys Arg Ile Thr Leu 145 150 155 160 Gly Tyr Thr Gln Ala Asp Val Gly Leu Thr Leu Gly Val Leu Phe Gly                 165 170 175 Lys Val Phe Ser Gln Thr Thr Ile Cys Arg Phe Glu Ala Leu Gln Leu             180 185 190 Ser Phe Lys Asn Met Cys Lys Leu Arg Pro Leu Leu Gln Lys Trp Val         195 200 205 Glu Glu Ala Asp Asn Asn Glu Asn Leu Gln Glu Ile Cys Lys Ala Glu     210 215 220 Thr Leu Val Gln Ala Arg Lys Arg Lys Arg Thr Ser Ile Glu Asn Arg 225 230 235 240 Val Arg Gly Asn Leu Glu Asn Leu Phe Leu Gln Cys Pro Lys Pro Thr                 245 250 255 Leu Gln Gln Ile Ser His Ile Ala Gln Gln Leu Gly Leu Glu Lys Asp             260 265 270 Val Val Arg Val Trp Phe Cys Asn Arg Arg Gln Lys Gly Lys Arg Ser         275 280 285 Ser Ser Asp Tyr Ala Gln Arg Glu Asp Phe Glu Ala Ala Gly Ser Pro     290 295 300 Phe Ser Gly Gly Pro Val Ser Phe Pro Leu Ala Pro Gly Pro His Phe 305 310 315 320 Gly Thr Pro Gly Tyr Gly Ser Pro His Phe Thr Ala Leu Tyr Ser Ser                 325 330 335 Val Pro Phe Pro Glu Gly Glu Ala Phe Pro Pro Val Ser Val Thr Thr             340 345 350 Leu Gly Ser Pro Met His Ser Asn         355 360 <210> 6 <211> 1083 <212> DNA <213> Homo sapiens <400> 6 atggcgggac acctggcttc ggatttcgcc ttctcgcccc ctccaggtgg tggaggtgat 60 gggccagggg ggccggagcc gggctgggtt gatcctcgga cctggctaag cttccaaggc 120 cctcctggag ggccaggaat cgggccgggg gttgggccag gctctgaggt gtgggggatt 180 cccccatgcc ccccgccgta tgagttctgt ggggggatgg cgtactgtgg gccccaggtt 240 ggagtggggc tagtgcccca aggcggcttg gagacctctc agcctgaggg cgaagcagga 300 gtcggggtgg agagcaactc cgatggggcc tccccggagc cctgcaccgt cacccctggt 360 gccgtgaagc tggagaagga gaagctggag caaaacccgg aggagtccca ggacatcaaa 420 gctctgcaga aagaactcga gcaatttgcc aagctcctga agcagaagag gatcaccctg 480 ggatatacac aggccgatgt ggggctcacc ctgggggttc tatttgggaa ggtattcagc 540 caaacgacca tctgccgctt tgaggctctg cagcttagct tcaagaacat gtgtaagctg 600 cggcccttgc tgcagaagtg ggtggaggaa gctgacaaca atgaaaatct tcaggagata 660 tgcaaagcag aaaccctcgt gcaggcccga aagagaaagc gaaccagtat cgagaaccga 720 gtgagaggca acctggagaa tttgttcctg cagtgcccga aacccacact gcagcagatc 780 agccacatcg cccagcagct tgggctcgag aaggatgtgg tccgagtgtg gttctgtaac 840 cggcgccaga agggcaagcg atcaagcagc gactatgcac aacgagagga ttttgaggct 900 gctgggtctc ctttctcagg gggaccagtg tcctttcctc tggccccagg gccccatttt 960 ggtaccccag gctatgggag ccctcacttc actgcactgt actcctcggt ccctttccct 1020 gagggggaag cctttccccc tgtctccgtc accactctgg gctctcccat gcattcaaac 1080 tga 1083 <210> 7 <211> 305 <212> PRT <213> Homo sapiens <400> 7 Met Ser Val Asp Pro Ala Cys Pro Gln Ser Leu Pro Cys Phe Glu Ala   1 5 10 15 Ser Asp Cys Lys Glu Ser Ser Pro Met Pro Val Ile Cys Gly Pro Glu              20 25 30 Glu Asn Tyr Pro Ser Leu Gln Met Ser Ser Ala Glu Met Pro His Thr          35 40 45 Glu Thr Val Ser Pro Leu Pro Ser Ser Met Asp Leu Leu Ile Gln Asp      50 55 60 Ser Pro Asp Ser Ser Thr Ser Pro Lys Gly Lys Gln Pro Thr Ser Ala  65 70 75 80 Glu Lys Ser Val Ala Lys Lys Glu Asp Lys Val Pro Val Lys Lys Gln                  85 90 95 Lys Thr Arg Thr Val Phe Ser Ser Thr Gln Leu Cys Val Leu Asn Asp             100 105 110 Arg Phe Gln Arg Gln Lys Tyr Leu Ser Leu Gln Gln Met Gln Glu Leu         115 120 125 Ser Asn Ile Leu Asn Leu Ser Tyr Lys Gln Val Lys Thr Trp Phe Gln     130 135 140 Asn Gln Arg Met Lys Ser Lys Arg Trp Gln Lys Asn Asn Trp Pro Lys 145 150 155 160 Asn Ser Asn Gly Val Thr Gln Lys Ala Ser Ala Pro Thr Tyr Pro Ser                 165 170 175 Leu Tyr Ser Ser Tyr His Gln Gly Cys Leu Val Asn Pro Thr Gly Asn             180 185 190 Leu Pro Met Trp Ser Asn Gln Thr Trp Asn Asn Ser Thr Trp Ser Asn         195 200 205 Gln Thr Gln Asn Ile Gln Ser Trp Ser Asn His Ser Trp Asn Thr Gln     210 215 220 Thr Trp Cys Thr Gln Ser Trp Asn Asn Gln Ala Trp Asn Ser Pro Phe 225 230 235 240 Tyr Asn Cys Gly Glu Glu Ser Leu Gln Ser Cys Met Gln Phe Gln Pro                 245 250 255 Asn Ser Pro Ala Ser Asp Leu Glu Ala Ala Leu Glu Ala Ala Gly Glu             260 265 270 Gly Leu Asn Val Ile Gln Gln Thr Thr Arg Tyr Phe Ser Thr Pro Gln         275 280 285 Thr Met Asp Leu Phe Leu Asn Tyr Ser Met Asn Met Gln Pro Glu Asp     290 295 300 Val 305 <210> 8 <211> 918 <212> DNA <213> Homo sapiens <400> 8 atgagtgtgg atccagcttg tccccaaagc ttgccttgct ttgaagcatc cgactgtaaa 60 gaatcttcac ctatgcctgt gatttgtggg cctgaagaaa actatccatc cttgcaaatg 120 tcttctgctg agatgcctca cacggagact gtctctcctc ttccttcctc catggatctg 180 cttattcagg acagccctga ttcttccacc agtcccaaag gcaaacaacc cacttctgca 240 gagaagagtg tcgcaaaaaa ggaagacaag gtcccggtca agaaacagaa gaccagaact 300 gtgttctctt ccacccagct gtgtgtactc aatgatagat ttcagagaca gaaatacctc 360 agcctccagc agatgcaaga actctccaac atcctgaacc tcagctacaa acaggtgaag 420 acctggttcc agaaccagag aatgaaatct aagaggtggc agaaaaacaa ctggccgaag 480 aatagcaatg gtgtgacgca gaaggcctca gcacctacct accccagcct ttactcttcc 540 taccaccagg gatgcctggt gaacccgact gggaaccttc caatgtggag caaccagacc 600 tggaacaatt caacctggag caaccagacc cagaacatcc agtcctggag caaccactcc 660 tggaacactc agacctggtg cacccaatcc tggaacaatc aggcctggaa cagtcccttc 720 tataactgtg gagaggaatc tctgcagtcc tgcatgcagt tccagccaaa ttctcctgcc 780 agtgacttgg aggctgcctt ggaagctgct ggggaaggcc ttaatgtaat acagcagacc 840 actaggtatt ttagtactcc acaaaccatg gatttattcc taaactactc catgaacatg 900 caacctgaag acgtgtga 918 <210> 9 <211> 479 <212> PRT <213> Homo sapiens <400> 9 Met Arg Gln Pro Pro Gly Glu Ser Asp Met Ala Val Ser Asp Ala Leu   1 5 10 15 Leu Pro Ser Phe Ser Thr Phe Ala Ser Gly Pro Ala Gly Arg Glu Lys              20 25 30 Thr Leu Arg Gln Ala Gly Ala Pro Asn Asn Arg Trp Arg Glu Glu Leu          35 40 45 Ser His Met Lys Arg Leu Pro Pro Val Leu Pro Gly Arg Pro Tyr Asp      50 55 60 Leu Ala Ala Ala Thr Val Ala Thr Asp Leu Glu Ser Gly Gly Ala Gly  65 70 75 80 Ala Ala Cys Gly Gly Ser Asn Leu Ala Pro Leu Pro Arg Arg Glu Thr                  85 90 95 Glu Glu Phe Asn Asp Leu Leu Asp Leu Asp Phe Ile Leu Ser Asn Ser             100 105 110 Leu Thr His Pro Pro Glu Ser Val Ala Ala Thr Val Ser Ser Ser Ala         115 120 125 Ser Ala Ser Ser Ser Ser Ser Pro Ser Ser Ser Gly Pro Ala Ser Ala     130 135 140 Pro Ser Thr Cys Ser Phe Thr Tyr Pro Ile Arg Ala Gly Asn Asp Pro 145 150 155 160 Gly Val Ala Pro Gly Gly Thr Gly Gly Gly Leu Leu Tyr Gly Arg Glu                 165 170 175 Ser Ala Pro Pro Pro Thr Ala Pro Phe Asn Leu Ala Asp Ile Asn Asp             180 185 190 Val Ser Pro Ser Gly Gly Phe Val Ala Glu Leu Leu Arg Pro Glu Leu         195 200 205 Asp Pro Val Tyr Ile Pro Pro Gln Gln Pro Gln Pro Pro Gly Gly Gly     210 215 220 Leu Met Gly Lys Phe Val Leu Lys Ala Ser Leu Ser Ala Pro Gly Ser 225 230 235 240 Glu Tyr Gly Ser Pro Ser Val Ile Ser Val Ser Lys Gly Ser Pro Asp                 245 250 255 Gly Ser His Pro Val Val Val Ala Pro Tyr Asn Gly Gly Pro Pro Arg             260 265 270 Thr Cys Pro Lys Ile Lys Gln Glu Ala Val Ser Ser Cys Thr His Leu         275 280 285 Gly Ala Gly Pro Pro Leu Ser Asn Gly His Arg Pro Ala Ala His Asp     290 295 300 Phe Pro Leu Gly Arg Gln Leu Pro Ser Arg Thr Thr Pro Thr Leu Gly 305 310 315 320 Leu Glu Glu Val Leu Ser Ser Arg Asp Cys His Pro Ala Leu Pro Leu                 325 330 335 Pro Pro Gly Phe His Pro His Pro Gly Pro Asn Tyr Pro Ser Phe Leu             340 345 350 Pro Asp Gln Met Gln Pro Gln Val Pro Pro Leu His Tyr Gln Glu Leu         355 360 365 Met Pro Pro Gly Ser Cys Met Pro Glu Glu Pro Lys Pro Lys Arg Gly     370 375 380 Arg Arg Ser Trp Pro Arg Lys Arg Thr Ala Thr His Thr Cys Asp Tyr 385 390 395 400 Ala Gly Cys Gly Lys Thr Tyr Thr Lys Ser Ser His Leu Lys Ala His                 405 410 415 Leu Arg Thr His Thr Gly Glu Lys Pro Tyr His Cys Asp Trp Asp Gly             420 425 430 Cys Gly Trp Lys Phe Ala Arg Ser Asp Glu Leu Thr Arg His Tyr Arg         435 440 445 Lys His Thr Gly His Arg Pro Phe Gln Cys Gln Lys Cys Asp Arg Ala     450 455 460 Phe Ser Arg Ser Asp His Leu Ala Leu His Met Lys Arg His Phe 465 470 475 <210> 10 <211> 1440 <212> DNA <213> Homo sapiens <400> 10 atgaggcagc cacctggcga gtctgacatg gctgtcagcg acgcgctgct cccatctttc 60 tccacgttcg cgtctggccc ggcgggaagg gagaagacac tgcgtcaagc aggtgccccg 120 aataaccgct ggcgggagga gctctcccac atgaagcgac ttcccccagt gcttcccggc 180 cgcccctatg acctggcggc ggcgaccgtg gccacagacc tggagagcgg cggagccggt 240 gcggcttgcg gcggtagcaa cctggcgccc ctacctcgga gagagaccga ggagttcaac 300 gatctcctgg acctggactt tattctctcc aattcgctga cccatcctcc ggagtcagtg 360 gccgccaccg tgtcctcgtc agcgtcagcc tcctcttcgt cgtcgccgtc gagcagcggc 420 cctgccagcg cgccctccac ctgcagcttc acctatccga tccgggccgg gaacgacccg 480 ggcgtggcgc cgggcggcac gggcggaggc ctcctctatg gcagggagtc cgctccccct 540 ccgacggctc ccttcaacct ggcggacatc aacgacgtga gcccctcggg cggcttcgtg 600 gccgagctcc tgcggccaga attggacccg gtgtacattc cgccgcagca gccgcagccg 660 ccaggtggcg ggctgatggg caagttcgtg ctgaaggcgt cgctgagcgc ccctggcagc 720 gagtacggca gcccgtcggt catcagcgtc agcaaaggca gccctgacgg cagccacccg 780 gtggtggtgg cgccctacaa cggcgggccg ccgcgcacgt gccccaagat caagcaggag 840 gcggtctctt cgtgcaccca cttgggcgct ggaccccctc tcagcaatgg ccaccggccg 900 gctgcacacg acttccccct ggggcggcag ctccccagca ggactacccc gaccctgggt 960 cttgaggaag tgctgagcag cagggactgt caccctgccc tgccgcttcc tcccggcttc 1020 catccccacc cggggcccaa ttacccatcc ttcctgcccg atcagatgca gccgcaagtc 1080 ccgccgctcc attaccaaga gctcatgcca cccggttcct gcatgccaga ggagcccaag 1140 ccaaagaggg gaagacgatc gtggccccgg aaaaggaccg ccacccacac ttgtgattac 1200 gcgggctgcg gcaaaaccta cacaaagagt tcccatctca aggcacacct gcgaacccac 1260 acaggtgaga aaccttacca ctgtgactgg gacggctgtg gatggaaatt cgcccgctca 1320 gatgaactga ccaggcacta ccgtaaacac acggggcacc gcccgttcca gtgccaaaaa 1380 tgcgaccgag cattttccag gtcggaccac ctcgccttac acatgaagag gcatttttaa 1440                                                                         1440 <210> 11 <211> 209 <212> PRT <213> Homo sapiens <400> 11 Met Gly Ser Val Ser Asn Gln Gln Phe Ala Gly Gly Cys Ala Lys Ala   1 5 10 15 Ala Glu Glu Ala Pro Glu Glu Ala Pro Glu Asp Ala Ala Arg Ala Ala              20 25 30 Asp Glu Pro Gln Leu Leu His Gly Ala Gly Ile Cys Lys Trp Phe Asn          35 40 45 Val Arg Met Gly Phe Gly Phe Leu Ser Met Thr Ala Arg Ala Gly Val      50 55 60 Ala Leu Asp Pro Pro Val Asp Val Phe Val His Gln Ser Lys Leu His  65 70 75 80 Met Glu Gly Phe Arg Ser Leu Lys Glu Gly Glu Ala Val Glu Phe Thr                  85 90 95 Phe Lys Lys Ser Ala Lys Gly Leu Glu Ser Ile Arg Val Thr Gly Pro             100 105 110 Gly Gly Val Phe Cys Ile Gly Ser Glu Arg Arg Pro Lys Gly Lys Ser         115 120 125 Met Gln Lys Arg Arg Ser Lys Gly Asp Arg Cys Tyr Asn Cys Gly Gly     130 135 140 Leu Asp His His Ala Lys Glu Cys Lys Leu Pro Pro Gln Pro Lys Lys 145 150 155 160 Cys His Phe Cys Gln Ser Ile Ser His Met Val Ala Ser Cys Pro Leu                 165 170 175 Lys Ala Gln Gln Gly Pro Ser Ala Gln Gly Lys Pro Thr Tyr Phe Arg             180 185 190 Glu Glu Glu Glu Glu Ile His Ser Pro Thr Leu Leu Pro Glu Ala Gln         195 200 205 Asn     <210> 12 <211> 630 <212> DNA <213> Homo sapiens <400> 12 atgggctccg tgtccaacca gcagtttgca ggtggctgcg ccaaggcggc agaagaggcg 60 cccgaggagg cgccggagga cgcggcccgg gcggcggacg agcctcagct gctgcacggt 120 gcgggcatct gtaagtggtt caacgtgcgc atggggttcg gcttcctgtc catgaccgcc 180 cgcgccgggg tcgcgctcga ccccccagtg gatgtctttg tgcaccagag taagctgcac 240 atggaagggt tccggagctt gaaggagggt gaggcagtgg agttcacctt taagaagtca 300 gccaagggtc tggaatccat ccgtgtcacc ggacctggtg gagtattctg tattgggagt 360 gagaggcggc caaaaggaaa gagcatgcag aagcgcagat caaaaggaga caggtgctac 420 aactgtggag gtctagatca tcatgccaag gaatgcaagc tgccacccca gcccaagaag 480 tgccacttct gccagagcat cagccatatg gtagcctcat gtccgctgaa ggcccagcag 540 ggccctagtg cacagggaaa gccaacctac tttcgagagg aagaagaaga aatccacagc 600 cctaccctgc tcccggaggc acagaattga 630 <210> 13 <211> 454 <212> PRT <213> Homo sapiens <400> 13 Met Asp Phe Phe Arg Val Val Glu Asn Gln Gln Pro Pro Ala Thr Met   1 5 10 15 Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp              20 25 30 Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr Gln          35 40 45 Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile      50 55 60 Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser Arg  65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr Pro Phe Ser                  85 90 95 Leu Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser Phe Ser Thr Ala Asp             100 105 110 Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln         115 120 125 Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile     130 135 140 Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val 145 150 155 160 Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser                 165 170 175 Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu Tyr             180 185 190 Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser Val         195 200 205 Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys Ala     210 215 220 Ser Gln Asp Ser Ser Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu Ser 225 230 235 240 Ser Thr Glu Ser Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His                 245 250 255 Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu             260 265 270 Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro         275 280 285 Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser Lys     290 295 300 Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His 305 310 315 320 Gln His Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro Ala                 325 330 335 Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu Arg Gln Ile Ser             340 345 350 Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn         355 360 365 Val Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu     370 375 380 Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390 395 400 Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala                 405 410 415 Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile Ser Glu Glu             420 425 430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu Gln         435 440 445 Leu Arg Asn Ser Cys Ala     450 <210> 14 <211> 1365 <212> DNA <213> Homo sapiens <400> 14 ctggattttt ttcgggtagt ggaaaaccag cagcctcccg cgacgatgcc cctcaacgtt 60 agcttcacca acaggaacta tgacctcgac tacgactcgg tgcagccgta tttctactgc 120 gacgaggagg agaacttcta ccagcagcag cagcagagcg agctgcagcc cccggcgccc 180 agcgaggata tctggaagaa attcgagctg ctgcccaccc cgcccctgtc ccctagccgc 240 cgctccgggc tctgctcgcc ctcctacgtt gcggtcacac ccttctccct tcggggagac 300 aacgacggcg gtggcgggag cttctccacg gccgaccagc tggagatggt gaccgagctg 360 ctgggaggag acatggtgaa ccagagtttc atctgcgacc cggacgacga gaccttcatc 420 aaaaacatca tcatccagga ctgtatgtgg agcggcttct cggccgccgc caagctcgtc 480 tcagagaagc tggcctccta ccaggctgcg cgcaaagaca gcggcagccc gaaccccgcc 540 cgcggccaca gcgtctgctc cacctccagc ttgtacctgc aggatctgag cgccgccgcc 600 tcagagtgca tcgacccctc ggtggtcttc ccctaccctc tcaacgacag cagctcgccc 660 aagtcctgcg cctcgcaaga ctccagcgcc ttctctccgt cctcggattc tctgctctcc 720 tcgacggagt cctccccgca gggcagcccc gagcccctgg tgctccatga ggagacaccg 780 cccaccacca gcagcgactc tgaggaggaa caagaagatg aggaagaaat cgatgttgtt 840 tctgtggaaa agaggcaggc tcctggcaaa aggtcagagt ctggatcacc ttctgctgga 900 ggccacagca aacctcctca cagcccactg gtcctcaaga ggtgccacgt ctccacacat 960 cagcacaact acgcagcgcc tccctccact cggaaggact atcctgctgc caagagggtc 1020 aagttggaca gtgtcagagt cctgagacag atcagcaaca accgaaaatg caccagcccc 1080 aggtcctcgg acaccgagga gaatgtcaag aggcgaacac acaacgtctt ggagcgccag 1140 aggaggaacg agctaaaacg gagctttttt gccctgcgtg accagatccc ggagttggaa 1200 aacaatgaaa aggcccccaa ggtagttatc cttaaaaaag ccacagcata catcctgtcc 1260 gtccaagcag aggagcaaaa gctcatttct gaagaggact tgttgcggaa acgacgagaa 1320 cagttgaaac acaaacttga acagctacgg aactcttgtg cgtaa 1365 <210> 15 <211> 3111 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 15 atggcgggac acctggcttc ggatttcgcc ttctcgcccc ctccaggtgg tggaggtgat 60 gggccagggg ggccggagcc gggctgggtt gatcctcgga cctggctaag cttccaaggc 120 cctcctggag ggccaggaat cgggccgggg gttgggccag gctctgaggt gtgggggatt 180 cccccatgcc ccccgccgta tgagttctgt ggggggatgg cgtactgtgg gccccaggtt 240 ggagtggggc tagtgcccca aggcggcttg gagacctctc agcctgaggg cgaagcagga 300 gtcggggtgg agagcaactc cgatggggcc tccccggagc cctgcaccgt cacccctggt 360 gccgtgaagc tggagaagga gaagctggag caaaacccgg aggagtccca ggacatcaaa 420 gctctgcaga aagaactcga gcaatttgcc aagctcctga agcagaagag gatcaccctg 480 ggatatacac aggccgatgt ggggctcacc ctgggggttc tatttgggaa ggtattcagc 540 caaacgacca tctgccgctt tgaggctctg cagcttagct tcaagaacat gtgtaagctg 600 cggcccttgc tgcagaagtg ggtggaggaa gctgacaaca atgaaaatct tcaggagata 660 tgcaaagcag aaaccctcgt gcaggcccga aagagaaagc gaaccagtat cgagaaccga 720 gtgagaggca acctggagaa tttgttcctg cagtgcccga aacccacact gcagcagatc 780 agccacatcg cccagcagct tgggctcgag aaggatgtgg tccgagtgtg gttctgtaac 840 cggcgccaga agggcaagcg atcaagcagc gactatgcac aacgagagga ttttgaggct 900 gctgggtctc ctttctcagg gggaccagtg tcctttcctc tggccccagg gccccatttt 960 ggtaccccag gctatgggag ccctcacttc actgcactgt actcctcggt ccctttccct 1020 gagggggaag cctttccccc tgtctccgtc accactctgg gctctcccat gcattcaaac 1080 aaaattgtcg ctcctgtcaa acaaactctt aactttgatt tactcaaact ggctggggat 1140 gtagaaagca atccaggtcc aatgagtgtg gatccagctt gtccccaaag cttgccttgc 1200 tttgaagcat ccgactgtaa agaatcttca cctatgcctg tgatttgtgg gcctgaagaa 1260 aactatccat ccttgcaaat gtcttctgct gagatgcctc acacggagac tgtctctcct 1320 cttccttcct ccatggatct gcttattcag gacagccctg attcttccac cagtcccaaa 1380 ggcaaacaac ccacttctgc agagaagagt gtcgcaaaaa aggaagacaa ggtcccggtc 1440 aagaaacaga agaccagaac tgtgttctct tccacccagc tgtgtgtact caatgataga 1500 tttcagagac agaaatacct cagcctccag cagatgcaag aactctccaa catcctgaac 1560 ctcagctaca aacaggtgaa gacctggttc cagaaccaga gaatgaaatc taagaggtgg 1620 cagaaaaaca actggccgaa gaatagcaat ggtgtgacgc agaaggcctc agcacctacc 1680 taccccagcc tttactcttc ctaccaccag ggatgcctgg tgaacccgac tgggaacctt 1740 ccaatgtgga gcaaccagac ctggaacaat tcaacctgga gcaaccagac ccagaacatc 1800 cagtcctgga gcaaccactc ctggaacact cagacctggt gcacccaatc ctggaacaat 1860 caggcctgga acagtccctt ctataactgt ggagaggaat ctctgcagtc ctgcatgcag 1920 ttccagccaa attctcctgc cagtgacttg gaggctgcct tggaagctgc tggggaaggc 1980 cttaatgtaa tacagcagac cactaggtat tttagtactc cacaaaccat ggatttattc 2040 ctaaactact ccatgaacat gcaacctgaa gacgtgaaaa ttgtcgctcc tgtcaaacaa 2100 actcttaact ttgatttact caaactggct ggggatgtag aaagcaatcc aggtccaatg 2160 tacaacatga tggagacgga gctgaagccg ccgggcccgc agcaaacttc ggggggcggc 2220 ggcggcaact ccaccgcggc ggcggccggc ggcaaccaga aaaacagccc ggaccgcgtc 2280 aagcggccca tgaatgcctt catggtgtgg tcccgcgggc agcggcgcaa gatggcccag 2340 gagaacccca agatgcacaa ctcggagatc agcaagcgcc tgggcgccga gtggaaactt 2400 ttgtcggaga cggagaagcg gccgttcatc gacgaggcta agcggctgcg agcgctgcac 2460 atgaaggagc acccggatta taaataccgg ccccggcgga aaaccaagac gctcatgaag 2520 aaggataagt acacgctgcc cggcgggctg ctggcccccg gcggcaatag catggcgagc 2580 ggggtcgggg tgggcgccgg cctgggcgcg ggcgtgaacc agcgcatgga cagttacgcg 2640 cacatgaacg gctggagcaa cggcagctac agcatgatgc aggaccagct gggctacccg 2700 cagcacccgg gcctcaatgc gcacggcgca gcgcagatgc agcccatgca ccgctacgac 2760 gtgagcgccc tgcagtacaa ctccatgacc agctcgcaga cctacatgaa cggctcgccc 2820 acctacagca tgtcctactc gcagcagggc acccctggca tggctcttgg ctccatgggt 2880 tcggtggtca agtccgaggc cagctccagc ccccctgtgg ttacctcttc ctcccactcc 2940 agggcgccct gccaggccgg ggacctccgg gacatgatca gcatgtatct ccccggcgcc 3000 gaggtgccgg aacccgccgc ccccagcaga cttcacatgt cccagcacta ccagagcggc 3060 ccggtgcccg gcacggccat taacggcaca ctgcccctct cacacatgtg a 3111 <210> 16 <211> 3606 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 atggcgggac acctggcttc ggatttcgcc ttctcgcccc ctccaggtgg tggaggtgat 60 gggccagggg ggccggagcc gggctgggtt gatcctcgga cctggctaag cttccaaggc 120 cctcctggag ggccaggaat cgggccgggg gttgggccag gctctgaggt gtgggggatt 180 cccccatgcc ccccgccgta tgagttctgt ggggggatgg cgtactgtgg gccccaggtt 240 ggagtggggc tagtgcccca aggcggcttg gagacctctc agcctgaggg cgaagcagga 300 gtcggggtgg agagcaactc cgatggggcc tccccggagc cctgcaccgt cacccctggt 360 gccgtgaagc tggagaagga gaagctggag caaaacccgg aggagtccca ggacatcaaa 420 gctctgcaga aagaactcga gcaatttgcc aagctcctga agcagaagag gatcaccctg 480 ggatatacac aggccgatgt ggggctcacc ctgggggttc tatttgggaa ggtattcagc 540 caaacgacca tctgccgctt tgaggctctg cagcttagct tcaagaacat gtgtaagctg 600 cggcccttgc tgcagaagtg ggtggaggaa gctgacaaca atgaaaatct tcaggagata 660 tgcaaagcag aaaccctcgt gcaggcccga aagagaaagc gaaccagtat cgagaaccga 720 gtgagaggca acctggagaa tttgttcctg cagtgcccga aacccacact gcagcagatc 780 agccacatcg cccagcagct tgggctcgag aaggatgtgg tccgagtgtg gttctgtaac 840 cggcgccaga agggcaagcg atcaagcagc gactatgcac aacgagagga ttttgaggct 900 gctgggtctc ctttctcagg gggaccagtg tcctttcctc tggccccagg gccccatttt 960 ggtaccccag gctatgggag ccctcacttc actgcactgt actcctcggt ccctttccct 1020 gagggggaag cctttccccc tgtctccgtc accactctgg gctctcccat gcattcaaac 1080 aaaattgtcg ctcctgtcaa acaaactctt aactttgatt tactcaaact ggctggggat 1140 gtagaaagca atccaggtcc aatggctgtc agcgacgcgc tgctcccatc tttctccacg 1200 ttcgcgtctg gcccggcggg aagggagaag acactgcgtc aagcaggtgc cccgaataac 1260 cgctggcggg aggagctctc ccacatgaag cgacttcccc cagtgcttcc cggccgcccc 1320 tatgacctgg cggcggcgac cgtggccaca gacctggaga gcggcggagc cggtgcggct 1380 tgcggcggta gcaacctggc gcccctacct cggagagaga ccgaggagtt caacgatctc 1440 ctggacctgg actttattct ctccaattcg ctgacccatc ctccggagtc agtggccgcc 1500 accgtgtcct cgtcagcgtc agcctcctct tcgtcgtcgc cgtcgagcag cggccctgcc 1560 agcgcgccct ccacctgcag cttcacctat ccgatccggg ccgggaacga cccgggcgtg 1620 gcgccgggcg gcacgggcgg aggcctcctc tatggcaggg agtccgctcc ccctccgacg 1680 gctcccttca acctggcgga catcaacgac gtgagcccct cgggcggctt cgtggccgag 1740 ctcctgcggc cagaattgga cccggtgtac attccgccgc agcagccgca gccgccaggt 1800 ggcgggctga tgggcaagtt cgtgctgaag gcgtcgctga gcgcccctgg cagcgagtac 1860 ggcagcccgt cggtcatcag cgtcagcaaa ggcagccctg acggcagcca cccggtggtg 1920 gtggcgccct acaacggcgg gccgccgcgc acgtgcccca agatcaagca ggaggcggtc 1980 tcttcgtgca cccacttggg cgctggaccc cctctcagca atggccaccg gccggctgca 2040 cacgacttcc ccctggggcg gcagctcccc agcaggacta ccccgaccct gggtcttgag 2100 gaagtgctga gcagcaggga ctgtcaccct gccctgccgc ttcctcccgg cttccatccc 2160 cacccggggc ccaattaccc atccttcctg cccgatcaga tgcagccgca agtcccgccg 2220 ctccattacc aagagctcat gccacccggt tcctgcatgc cagaggagcc caagccaaag 2280 aggggaagac gatcgtggcc ccggaaaagg accgccaccc acacttgtga ttacgcgggc 2340 tgcggcaaaa cctacacaaa gagttcccat ctcaaggcac acctgcgaac ccacacaggt 2400 gagaaacctt accactgtga ctgggacggc tgtggatgga aattcgcccg ctcagatgaa 2460 ctgaccaggc actaccgtaa acacacgggg caccgcccgt tccagtgcca aaaatgcgac 2520 cgagcatttt ccaggtcgga ccacctcgcc ttacacatga agaggcattt taaaattgtc 2580 gctcctgtca aacaaactct taactttgat ttactcaaac tggctgggga tgtagaaagc 2640 aatccaggtc caatgtacaa catgatggag acggagctga agccgccggg cccgcagcaa 2700 acttcggggg gcggcggcgg caactccacc gcggcggcgg ccggcggcaa ccagaaaaac 2760 agcccggacc gcgtcaagcg gcccatgaat gccttcatgg tgtggtcccg cgggcagcgg 2820 cgcaagatgg cccaggagaa ccccaagatg cacaactcgg agatcagcaa gcgcctgggc 2880 gccgagtgga aacttttgtc ggagacggag aagcggccgt tcatcgacga ggctaagcgg 2940 ctgcgagcgc tgcacatgaa ggagcacccg gattataaat accggccccg gcggaaaacc 3000 aagacgctca tgaagaagga taagtacacg ctgcccggcg ggctgctggc ccccggcggc 3060 aatagcatgg cgagcggggt cggggtgggc gccggcctgg gcgcgggcgt gaaccagcgc 3120 atggacagtt acgcgcacat gaacggctgg agcaacggca gctacagcat gatgcaggac 3180 cagctgggct acccgcagca cccgggcctc aatgcgcacg gcgcagcgca gatgcagccc 3240 atgcaccgct acgacgtgag cgccctgcag tacaactcca tgaccagctc gcagacctac 3300 atgaacggct cgcccaccta cagcatgtcc tactcgcagc agggcacccc tggcatggct 3360 cttggctcca tgggttcggt ggtcaagtcc gaggccagct ccagcccccc tgtggttacc 3420 tcttcctccc actccagggc gccctgccag gccggggacc tccgggacat gatcagcatg 3480 tatctccccg gcgccgaggt gccggaaccc gccgccccca gcagacttca catgtcccag 3540 cactaccaga gcggcccggt gcccggcacg gccattaacg gcacactgcc cctctcacac 3600 atgtga 3606 <210> 17 <211> 6723 <212> DNA <213> herpes simplex virus 7 <400> 17 ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc 60 ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc 120 gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata 180 taagcagagc tctctggcta actagagaac ccactgctta ctggcttatc gaaattaata 240 cgactcacta tagggagacc caagctggct agcgtttaaa cttaagcttg gtaccgagct 300 cggatccact agtccagtgt ggtggaattc tgcagatatc cagcacagtg gcggccgctc 360 gagtctagag ggcccgttta aacccgctga tcagcctcga ctgtgccttc tagttgccag 420 ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc cactcccact 480 gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt 540 ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa tagcgttaat 600 taaaattcca gctgagcgcc ggtcgctacc attaccagtt ggtctggtgt caaaaataat 660 aataaccggg caggccatgt ctgcccgtat ttcgcgtaag gaaatccatt atgtactatt 720 taaaaaacac aaacttttgg atgttcggtt tattcttttt cttttacttt tttatcatgg 780 gagcctactt cccgtttttc ccgatttggc tacatgacat caaccatatc agcaaaagtg 840 atacgggtat tatttttgcc gctatttctc tgttctcgct attattccaa ccgctgtttg 900 gtctgctttc tgacaaactc ggaacttgtt tattgcagct tataatggtt acaaataaag 960 caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta gttgtggttg 1020 tccaaactca tcaatgtatc ttatcatgtc tggatctctg acctgagatt ggcggcactg 1080 aggtagagat gcccgaaccc ccccgaggga gcgcgggacg cgccggggag ggctggggcc 1140 ggggagggct ggggccgggg agggctgggg ccggggaggg ctggggccgg ggagggctgg 1200 ggccggggag ggctggggcc ggggagggct ggggctgggg agggctgggg ctggggaggg 1260 ggcggtggtg tgtagcagga gcggtgtgtt gcgccggggt acgtctggag gagcgggagg 1320 tgcgcggtga cgtgtggatg aggaacagga gttgttgcgc ggtgagttgt cgctgtgagt 1380 tgtgttgttg ggcaggtgtg gtggatgacg tgacgtgtga cgtgcggagt gcgccgtgct 1440 ctgttggttt cacctgtggc agcccgggcc ccccgcgggc gcgcgcgcgc gcaaaaaagg 1500 cgggcggcgg tccgggcggc gtgcgcgcgc gcggcgggcg tggggggcgg ggccgcggga 1560 gcggggggag gagcgggggg aggagcgggg ggaggagcgg ggggaggagc ggggggagga 1620 gcggggggag gagcgggggg aggagcgggg ggaggagcgg ggggaggagc ggggggagga 1680 gcggggggag gagcgggggg aggagcgggg ggaggagcgg ggggaggagc ggggggagga 1740 gcggggggag gagcgggggg aggagcgggg ggaggagcgg ccagacgccg aaaacgggcc 1800 ccccccaaaa cacacccccc gggggtcgcg cgcggccctt taaagcggtg gcggcgggca 1860 gcccgggccc cccgcggccg agactagcga gttagacagg caagcactac tcgcctctgc 1920 acgcacatgc ttgcctgtca aactctacca ccccggcacg ctctctgtct ccatggcccg 1980 ccgccgccgc catcgcggcc cccgccgccc ccggccgccc gggcccacgg gcgccgtccc 2040 aaccgcacag tcccaggtaa cgagctcgaa ttaattcttg aagacgaaag ggcctcgtga 2100 tacgcctatt tttataggtt aatgtcatga taataatggt ttcttagggt cgacccaggt 2160 ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 2220 aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg 2280 aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc 2340 cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg 2400 ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt 2460 cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta 2520 ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat 2580 gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga 2640 gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca 2700 acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact 2760 cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc 2820 acgatgcctg cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact 2880 ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt 2940 ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt 3000 gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt 3060 atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata 3120 ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag 3180 attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat 3240 ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 3300 aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 3360 aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 3420 ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 3480 tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 3540 ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 3600 cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 3660 agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 3720 gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 3780 ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 3840 tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 3900 tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 3960 cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 4020 tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 4080 gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 4140 ataggtcgac ctatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca 4200 gtatacactc cgctatcgct acgtgactgg gtcatggctg cgccccgaca cccgccaaca 4260 cccgctgacg cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg 4320 accgtctccg ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgagg 4380 cagccggcca ttatgcacga ccccgccccg acgccggcac gccgggggcc cgtggccgcg 4440 gcccgttggt cgaacccccg gccccgccca tccgcgccat ctgccatggg cggggcgcga 4500 gggcgggtgg gtccgcgccc cgccccgcat ggcatctcat taccgcccga tccggcggtt 4560 tccgcttccg ttccgcatgc taacgaggaa cgggcagggg gcggggcccg ggccccgact 4620 tcccggttcg gcggtaatga gatacgagcc ccgcgcgccc gttggccgtc cccgggcccc 4680 ccggtcccgc ccgccggacg ccgggaccaa cgggacggcg ggcggcccaa gggccgcccg 4740 ccttgccgcc cccccattgg ccggcgggcg ggaccgcccc aagggggcgg ggccgccggg 4800 taaaagaagt gagaacgcga agcgttcgca cttcgtccca atatatatat attattaggg 4860 cgaagtgcga gcactggcgc cgtgcccgac tccgcgccgg ccccgggggc gggcccgggc 4920 ggcggggggc gggtctctcc ggcgcacata aaggcccggc gcgaccgacg cccgcagacg 4980 gcgccggcca cgaacgacgg gagcggctgc ggagcacgcg gaccgggagc gggagtcgca 5040 gagggccgtc ggagcggacg gcgtcggcat cgcgacgccc cggctcggga tcgggatcgc 5100 atcggaaagg gacacgcgga cgcggggggg aaagacccgc ccaccccacc cacgaaacac 5160 aggggacgca ccccgggggc ctccgacgac agaaacccac cggtccgcct tttttgcacg 5220 ggtaagcacc ttgggtgggc ggaggagggg gggacgcggg ggtggaggag gggggacgcg 5280 ggggcggagg aggggggacg cgggggcgga ggagggggga cgcgggggcg gaggaggggg 5340 gacgcggggg cggaggaggg ggctcacccg cgttcgtgcc ttcccgcagg aggaacgtcc 5400 tcgtcgataa gctgatccat cgccaccatg gtgagcaagg gcgaggagct gttcaccggg 5460 gtggtgccca tcctggtcga gctggacggc gacgtaaacg gccacaagtt cagcgtgtcc 5520 ggcgagggcg agggcgatgc cacctacggc aagctgaccc tgaagttcat ctgcaccacc 5580 ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc 5640 ttcagccgct accccgacca catgaagcag cacgacttct tcaagtccgc catgcccgaa 5700 ggctacgtcc aggagcgcac catcttcttc aaggacgacg gcaactacaa gacccgcgcc 5760 gaggtgaagt tcgagggcga caccctggtg aaccgcatcg agctgaaggg catcgacttc 5820 aaggaggacg gcaacatcct ggggcacaag ctggagtaca actacaacag ccacaacgtc 5880 tatatcatgg ccgacaagca gaagaacggc atcaaggtga acttcaagat ccgccacaac 5940 atcgaggacg gcagcgtgca gctcgccgac cactaccagc agaacacccc catcggcgac 6000 ggccccgtgc tgctgcccga caaccactac ctgagcaccc agtccgccct gagcaaagac 6060 cccaacgaga agcgcgatca catggtcctg ctggagttcg tgaccgccgc cgggatcact 6120 ctcggcatgg acgagctgta caagtaaagc ggccaacttg tttattgcag cttataatgg 6180 ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc 6240 tagttgtggt ttgtccaaac tcatcaatgt atcttatcat gtctggatcg gtttgaagat 6300 cttccgatgt acgggccaga tatacgcgtt gacattgatt attgactagt tattaatagt 6360 aatcaattac ggggtcatta gttcatagcc catatatgga gttccgcgtt acataactta 6420 cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg tcaataatga 6480 cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg gtggactatt 6540 tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt acgcccccta 6600 ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg accttatggg 6660 actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg gtgatgcggt 6720 ttt 6723 <210> 18 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 gggggctagc cgccatggcg ggacacctgg cttc 34 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 gggggcggcc gctcagtttg aatgcatggg ag 32 <210> 20 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ggggctcgag ccgccatgta caacatgatg gagac 35 <210> 21 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 ggggtctaga tcacatgtgt gagaggggca gtgtg 35 <210> 22 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 22 ggggagatct gccgccatga gtgtggatcc agcttg 36 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 23 gggggaattc acacgtcttc aggttgcatg 30 <210> 24 <211> 103 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 24 gggggcggcc gcaaaattgt cgctcctgtc aaacaaactc ttaactttga tttactcaaa 60 ctggctgggg atgtagaaag caatccaggt ccaggatccg ggg 103 <210> 25 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 25 ccccgatcct ggacctggat tgctttctac atccccagcc agtttgagta aatcaaagtt 60 aagagtttgg acaggagcga caattttgcg gccgccccc 99 <210> 26 <211> 101 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 26 gggggaattc aaaattgtcg ctcctgtcaa acaaactctt aactttgatt tactcaaact 60 ggctggggat gtagaaagca atccaggtcc actcgagggg g 101 <210> 27 <211> 98 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 27 ccccctcgag tggacctgga ttgctttcta catccccagc cagtttgagt aaatcaaagt 60 taagagtttg gacaggagcg acaattttga attccccc 98  

Claims (17)

delete delete delete delete delete (a) a gene encoding Sox2; Gene encoding Oct3 / 4; Culturing a somatic or immortalized cell line derived from a human in the presence of one herpes simplex amplicon virus comprising a gene encoding Nanog; And (b) separating embryonic stem cell-like colonies from the culture obtained from step (a). (a) a gene encoding Sox2; Gene encoding Oct3 / 4; Gene encoding Nanog; Culturing a human-derived somatic or immortalized cell line in the presence of a single herpes simplex amplicon virus comprising a gene encoding Lin28; And (b) separating embryonic stem cell-like colonies from the culture obtained from step (a). (a) a gene encoding Sox2; Gene encoding Oct3 / 4; Culturing a human-derived somatic or immortalized cell line in the presence of one herpes simplex amplicon virus comprising a gene encoding Klf4; And (b) separating embryonic stem cell-like colonies from the culture obtained from step (a). (a) a gene encoding Sox2; Gene encoding Oct3 / 4; Gene encoding Klf4; Culturing a human-derived somatic or immortalized cell line in the presence of one herpes simplex amplicon virus simultaneously comprising a gene encoding c-Myc; And (b) separating embryonic stem cell-like colonies from the culture obtained from step (a). delete delete delete The method of claim 6, wherein the herpes simplex virus is (i) a gene encoding Sox2, a gene encoding Oct3 / 4, a gene encoding Nanog, and optionally a gene encoding Lin28; Or a gene construct comprising a gene encoding Sox2, a gene encoding Oct3 / 4, a gene encoding Klf4, and optionally a gene encoding c-Myc, wherein the genes encode a peptide of SEQ ID NO: 1 Preparing an expression plasmid by recombining the induced gene construct connected through the herpes simplex virus amplicon plasmid into a herpes simplex virus amplicon plasmid, and (ii) a method comprising the step of packaging the expression plasmid obtained in step (i) into a permissive cell line. The method of claim 13, wherein the gene encoding the peptide of SEQ ID NO: 1 has a nucleotide sequence of SEQ ID NO: 2. The method of claim 13, wherein the gene construct is composed of the nucleotide sequence of SEQ ID NO: 15 or 16. The method of claim 13, wherein the herpes simplex virus amplicon plasmid has a nucleotide sequence of SEQ ID NO: 17. The method of claim 13, wherein said packaging is performed by co-transfection of said expression plasmid, fHSVΔpacΔ27 0+, and pEBHICP27 to the recipient cells.

Images